Portal de Periódicos da CAPES

Development of a Yeast Stop Codon Assay Readily and Generally Applicable to Human Genes

2001; Elsevier BV; Volume: 159; Issue: 4 Linguagem: Inglês

10.1016/s0002-9440(10)62510-2

1525-2191

Akihiko Kataoka, Mitsuhiro Tada, Masahiro Yano, Keiji Furuuchi, Santoso Cornain, Junichi Hamada, Gaku Suzuki, Hidehisa Yamada, Satoru Todo, T. Moriuchi,

RNA Research and Splicing

We established a yeast-based method to screen chain-terminating mutations that is readily applicable to any gene of interest. Based on the finding that 18- to 24-base-long homologous sequences are sufficient for gap repair in vivo in yeast, we used a strategy to amplify a test-gene fragment with addition of 24-bp sequences homologous to both cut-ends of a yeast expression vector, pMT18. After co-transformation with the amplified fragment and the linearized pMT18, each yeast (Saccharomyces cerevisiae) cell automatically forms a single-copy circular plasmid (because of CEN/ARS), which expresses a test-gene::ADE2 chimera protein. When the reading frame of the test-gene contains a nonsense or frameshift mutation, truncation of the chimera protein results in lack of ADE2 activity, leading to formation of a red colony. By using a nested polymerase chain reaction using proofreading Pfu polymerase to ensure specificity of the product, the assay achieved a low background (false positivity). We applied the assay to BRCA1, APC, hMSH6, and E-cadherin genes, and successfully detected mutations in mRNA and genomic DNA. Because this method—universal stop codon assay—requires only 4 to 5 days to screen a number of samples for any target gene, it may serve as a high-throughput screening system of general utility for chain-terminating mutations that are most prevalent in human genetic diseases. We established a yeast-based method to screen chain-terminating mutations that is readily applicable to any gene of interest. Based on the finding that 18- to 24-base-long homologous sequences are sufficient for gap repair in vivo in yeast, we used a strategy to amplify a test-gene fragment with addition of 24-bp sequences homologous to both cut-ends of a yeast expression vector, pMT18. After co-transformation with the amplified fragment and the linearized pMT18, each yeast (Saccharomyces cerevisiae) cell automatically forms a single-copy circular plasmid (because of CEN/ARS), which expresses a test-gene::ADE2 chimera protein. When the reading frame of the test-gene contains a nonsense or frameshift mutation, truncation of the chimera protein results in lack of ADE2 activity, leading to formation of a red colony. By using a nested polymerase chain reaction using proofreading Pfu polymerase to ensure specificity of the product, the assay achieved a low background (false positivity). We applied the assay to BRCA1, APC, hMSH6, and E-cadherin genes, and successfully detected mutations in mRNA and genomic DNA. Because this method—universal stop codon assay—requires only 4 to 5 days to screen a number of samples for any target gene, it may serve as a high-throughput screening system of general utility for chain-terminating mutations that are most prevalent in human genetic diseases. The task of identifying mutation in nucleic acid sequences is a crucial part of research in human genetics and molecular oncology. Because DNA sequencing primarily defines the location and nature of the change, it is considered to be the ultimate method of mutation detection. A long sequence of a gene of interest (GOI), however, often precludes the direct analysis of many samples in a limited period of time. Therefore an appropriate screening method to make up the drawback is necessary. To date, various screening methods based on primary DNA structure have been reported;1Grompe M The rapid detection of unknown mutations in nucleic acids.Nat Genet. 1993; 5: 111-117Crossref PubMed Scopus (308) Google Scholar denaturing gradient gel electrophoresis, heteroduplex analysis, chemical mismatch cleavage, and single-strand conformational polymorphism analysis. These, especially the last one, have widely been used as practically useful techniques. However, because of the limit in DNA length examinable by these techniques, we must divide a GOI into many parts, for each of which an optimization of experimental condition is required. Another drawback is that the sensitivity of mutation detection is primarily affected by the physical properties of the DNA fragment, often falling below 100% even in the best hands.2Kashiwazaki H Tonoki H Tada M Chiba I Shindoh M Totsuka Y Iggo R Moriuchi T High frequency of p53 mutations in human oral epithelial dysplasia and primary squamous cell carcinoma detected by yeast functional assay.Oncogene. 1997; 15: 2667-2674Crossref PubMed Scopus (83) Google Scholar After Ishioka and colleagues3Ishioka C Suzuki T FitzGerald M Krainer M Shimodaira H Shimada A Nomizu T Isselbacher KJ Haber D Kanamaru R Detection of heterozygous truncating mutations in the BRCA1 and APC genes by using a rapid screening assay in yeast.Proc Natl Acad Sci USA. 1997; 94: 2449-2453Crossref PubMed Scopus (42) Google Scholar first reported an efficient screening method using yeast prototrophy (URA3 marker) for uracil, namely yeast-based stop codon assay, a modification using yeast color selection (ADE2 marker) has been reported for detection of chain-terminating mutations in some specific genes.4Andreutti-Zaugg C Scott RJ Iggo R Inhibition of nonsense-mediated messenger RNA decay in clinical samples facilitates detection of human MSH2 mutations with an in vivo fusion protein assay and conventional techniques.Cancer Res. 1997; 57: 3288-3293PubMed Google Scholar, 5Furuuchi K Tada M Yamada H Kataoka A Furuuchi N Hamada J Takahashi M Todo S Moriuchi T Somatic mutations of the APC gene in primary breast cancers.Am J Pathol. 2000; 156: 1997-2005Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 6Zhang C-L Tada M Kobayashi H Nozaki M Moriuchi T Abe H Detection of PTEN nonsense mutation and psiPTEN expression in central nervous system high-grade astrocytic tumors by a yeast-based stop codon assay.Oncogene. 2000; 19: 4346-4353Crossref PubMed Scopus (18) Google Scholar Taking advantage of gap repair and production of GOI::ADE2 (EC 4.1.1.21) chimera protein as a visible reporter in yeast, this method permits a quantitative, efficient detection of chain-terminating mutations as red colonies because of accumulation of an ADE2 substrate in vivo in yeast.7Weisman LS Bacallao R Wickner W Multiple methods of visualizing the yeast vacuole permit evaluation of its morphology and inheritance during the cell cycle.J Cell Biol. 1987; 105: 1539-1547Crossref PubMed Scopus (159) Google Scholar This method requires, however, construction of an expression vector that is specific to each tested GOI (cloning of GOI into the vector), and thus is not immediately applicable to a newly interested gene. To remove this drawback without compromising the reliability of assay, we made two modifications: 1) amplification of GOI by a nested polymerase chain reaction (PCR) procedure with addition of short terminal sequences for gap repair, and 2) utilization of a universal vector for the acceptor of the amplified GOI. We determined optimal conditions of the assay in regard to the specificity and efficiency of gap repair, and confirmed quantitativeness of the mutation detection and its general applicability to a variety of GOI, minimizing the assay background (false positivity). We here present the establishment of the assay named "universal stop codon assay." Taking the prevalence of chain-terminating mutations in the whole mutation spectrum8McKusick VA Mendelian inheritance in man.in: ed 12. A Catalog of Human Genes and Genetic Disorders. vols 1–3. The Johns Hopkins University Press, Baltimore1998Google Scholar into account, we suggest that the assay is able to cover the majority of human genetic diseases including cancers. This assay utilizes a YCp type yeast expression vector, which is held in a single copy in a yeast cell and expresses a chimera protein of the reading frame of a tested gene fragment and ADE2 gene (phosphoribosylaminoimidazole carboxylase, E.C. 4.1.1.21). To permit an automatic integration of the gene fragment in-frame to ADE2 gene by homologous recombination in yeast, short sequences homologous to the vector cut-ends are added to the fragment during PCR amplification. Failure in producing a complete chimera protein because of the presence of a chain-terminating mutation in the tested fragment leads to accumulation of phosphoribosylaminoimidazole in yeast cells, resulting in red color of a yeast colony (Figure 1, A and B). The S. cerevisiae/Escherichia coli shuttle expression vector pLS381, an immediate origin of pCA57,4Andreutti-Zaugg C Scott RJ Iggo R Inhibition of nonsense-mediated messenger RNA decay in clinical samples facilitates detection of human MSH2 mutations with an in vivo fusion protein assay and conventional techniques.Cancer Res. 1997; 57: 3288-3293PubMed Google Scholar which has URA3 marker, CEN/ARS sequence, Amp-resistant gene, ColE1 Ori, and ADE2 driven by CYC promoter, was used for construction of vectors as follows. pLS381 was linearized at the Bam HI site between CYC promoter and ADE2, and a double-strand oligonucleotide (5′-CACTAAATT AATAATGACC GGCGCC ATGGATTCTA GAACAGTTG-3′) was integrated into the vector in yeast to replace a Sfo I site with a Bam HI site. The resultant new vector, pMT18 (Figure 1a), was linearized with Sfo I and dephosphorylated with calf intestinal alkaline phosphatase (Gibco-BRL, Tokyo, Japan). Complete digestion of pLS381 and pMT18 was confirmed by an additional agarose gel electrophoresis after gel purification and calf intestinal alkaline-phosphatase treatment. Yeast strain yPH857 was transformed with the linearized 50-ng pMT18 or pLS381 in a manner described below for comparison of self-ligation of the vectors. To insert a spacer sequence, a double-strand oligonucleotide, 5′-tta ata atg acc ggc GCC… GGA TCC gcc atg gat tct aga-3′, flanking a tag sequence (FLAG, 5′-ATG GAT TAC AAG GAT GAC GAC GAT AAG ATC-3′) was integrated into the Sfo I-linearized pMT18, yielding pMT18flag. This was also linearized with Sfo I, treated with calf intestinal alkaline phosphatase, and tested for complete digestion. For nested PCR to amplify GOI with addition of sequences for gap repair, two primer sets (external and internal) were designed by using a computer program OLIGO ver. 4.1 (MedProbe, Oslo, Norway). External primers were made in both outer arms encompassing the target site, giving a special priority to the specificity and the absence of a secondary structure. Gene-specific parts of internal primers were designed as their 5′-termini matching the codon frame of a target sequence (Table 1). Length and position of the primers were selected not to form a dimer of more than 4 bases in the 3′-termini. To the 5′ end of the gene-specific part of an internal primer, a sequence for gap repair (homologous recombination) matching the corresponding cut-end of the vector was added as follows. For gap repair into pMT18, 5′-CAC ACT AAA TTA ATA ATG ACC GGC ATG-3′ (last ATG for translational start) and 5′-ACC AAC TGT TCT AGA ATC CAT GGC-3′ were added to the 5′-termini of forward and reverse primers respectively. For gap repair into pMT18flag, 5′-GTC GTC ATC CTT GTA ATC CAT GGC-3′ was added to the 5′ end of reverse primers.Table 1Primers Used in this StudyGene*Gene, accession no.: gene name and accession number denoted in GenBank.Accession no.*Gene, accession no.: gene name and accession number denoted in GenBank.Use†Use: external or internal primer set. To an internal primer (name starting with "g"), vector end sequences ("(vs)+") for gap repair was added at the 5′-terminus, as described in Materials and Methods.Forward primer: name, sequence, position‡Position; positions in nucleotide number were of GenBank data.Reverse primer: name, sequence, position‡Position; positions in nucleotide number were of GenBank data.Size Tm§Size; size without gap repair sequences; Tm; annealing temperature used for PCR.BRCA1 exon 11L78833ExternalBR1EX11F2, aaaagaataggctgaggaggaagtc,BR1EX11R2, ctcatttcccatttctctttcaggt,1232 bpmiddle 1/3nt. 35021–35045nt. 36228–3625258°CInternalgBREX11F2, (vs)+agaaatctaagcccacctaat,gBREX11R2, (vs)+agtaatgagtccagtttcgtt,1017 bpnt. 35086–35106 from codon 629nt. 36082–36102 to codon 96758°CBRCA1 exon 11L78833ExternalBR1EX11Fn, gtaccttgttatttttgtatattttcag,BR1EX11R22409 bpupper 2/3nt. 33844–3387158°CInternalgBR1EX11F, gctgcttgtgaattttctgagacg,gBREX11R22232 bpnt. 33871–33894 from codon 22458°CBRCA1 exon 11L78833ExternalBR1EX11F2BR1EX11Rn, gggcaaacacaaaaacctggttcc,2306 bplower 2/3nt. 37303–3732660°CInternalgBREX11F2gBR1EX11R, tccaatacctaagtttgaatccatgc,2220 bpnt. 37280–37305 to codon 1366+ 6 bp58°CAPC exon 15M74088ExternalAPCEX15F, aaatgaaaccctcgattgaatcc,APCEX15R, gctgctctgattctgtttcattc,1692 bpnt. 2951–2973nt. 4620–464255°CInternalgAPCMCRF, (vs)+aatcgagtgggttctaatc,gAPCMCRR, (vs)+cgtggcaaaatgtaataa,1143 bpnt. 3355–3373 from codon 1113nt. 4480–4497 to codon 149351°ChMSH6 cDNAU54777ExternalMSH6F1, agggaggtcatttttacagtgc,MSH6R1, ctacatcgtgcctccatcattt,1009 bpnt. 552–573nt. 1539–156055°CInternalgMSH6F1, (vs)+cctgaaatactgagagcaa,gMSH6R1, (vs)+gaaatcctcaggcacatag,699 bpnt. 578–596 from codon 170nt. 1258–1276 to codon 40252°CE-cadherinZ13009ExternalEcadF1, ccatgggcccttggagccgc,EcadR1, ctggaagagcaccttccatgac,834 bp1/3 partnt. 93–112nt. 905–92658°CgEcad1Fc, (vs)+ctctcggcgctgctgctgct,gEcad1Rc, (vs)+agcaccttccatgacagacccctt,804 bpnt. 116–135 from codon 8nt. 896–919 to codon 27560°CE-cadherinZ13009ExternalEcadF3, aacgcattgccacatacactc,EcadR3B, ggggcttcattcacatccag,784 bp2/3 partnt. 762–782nt. 1526–154557°CInternalgEcadF2, (vs)+ttctctcacgctgtgtcatccaac,gEcadR2, (vs)+ggtgacggtggctgtggagg,732 bpnt. 785–808 from codon 231nt. 1497–1516 to codon 47458°CE-cadherinZ13009ExternalEcadF4, cgtagcagtgacgaatgtggt,EcadR4, gggaagggagctgaaaaacc,1374 bp3/3 partnt. 1453–1473nt. 2807–282657°CInternalgEcad3F2, (vs)+gtctctctcaccacctccaca,gEcad3R2, (vs)+gccccattcgttcaagtagtc,1209 bpnt. 1484–1504 from codon 464nt. 2672–2692 to codon 86657°C* Gene, accession no.: gene name and accession number denoted in GenBank.† Use: external or internal primer set. To an internal primer (name starting with "g"), vector end sequences ("(vs)+") for gap repair was added at the 5′-terminus, as described in Materials and Methods.‡ Position; positions in nucleotide number were of GenBank data.§ Size; size without gap repair sequences; Tm; annealing temperature used for PCR. Open table in a new tab To examine the effect of length of sequences for gap repair on fidelity of the recombination, we added three sized gap-repair parts (18 bases, forward 5′-AAA TTA ATA ATG ACC GGC-3′, reverse 5′-TGT TCT AGA ATC CAT GGC-3′; 24 bases, forward 5′-CAC ACT AAA TTA ATA ATG ACC GGC-3′, reverse 5′-ACC AAC TGT TCT AGA ATC CAT GGC-3′; and 30 bases, forward 5′-AAT ACA CAC ACT AAA TTA ATA ATG ACC GGC-3′, reverse 5′-TAA TAT ACC AAC TGT TCT AGA ATC CAT GGC-3′) to the 5′ end of respective forward and reverse BRCA1-specific parts (5′-(ATG) AGA AAT CTA AGC CCA CCT AAT-3′ and 5′-AGT AAT GAG TCC AGT TTC GTT-3′), and named g18BR1EX11F2 (total length, 42 bases) and g18BR1EX11R2 (39 bases), g(24)BR1EX11F2 (48 bases), and g(24)BR1EX11R2 (45 bases), and g30BR1EX11F2 (54 bases) and g30BR1EX11R2 (51 bases), respectively. Seven breast cancer cell lines (MCF-7, T-47-D, MDA-MB-435s, MDA-MB-231, ZR-75–1, MDA-MB-436, BT549, SKBr-3) and seven colon cancer cell lines (HCT116, HT29, HCT15/DLD1, HCC2998, KM12, SW480, COLO201) were used in this study. Cells were cultured in 10-cm dishes, and genomic DNA and total RNA were extracted with the use of DNAzol and Trizol reagents (Gibco-BRL) according to the manufacturer's instructions. Three colon cancer tissues and 10 cervical cancer tissues resected by the standard surgical procedure at the First Department of Surgery, Hokkaido University Hospital and the Gynecology Department, University of Indonesia, were snap-frozen in liquid nitrogen and served for nucleic acid extraction. For RNA, cDNA synthesis was done at 37°C for 60 minutes in a 20-μl reaction mixture containing 1 μg RNA, 1× reverse transcriptase (RT) buffer, 7.5 mmol/L dithiothreitol, 2.0 mmol/L MgCl2, 0.5 mmol/L each dNTP, 10 ng/μl random pdN6 primer, and 10 U/μl Moloney murine leukemia virus-reverse transcriptase (Gibco-BRL). Amplification of the target gene with addition of sequences for gap repair was done in a nested PCR procedure using Pfu TURBO polymerase (Stratagene, La Jolla, CA) on a Thermal Cycler 2400 (Perkin Elmer, Chiba, Japan). The first PCR was done on 100 ng of genomic DNA or 2 μl of RT product (cDNA) in a 25-μl reaction mixture containing 1× cloned Pfu buffer, 0.05 U/μl Pfu TURBO polymerase, 0.2 mmol/L each dNTP, and 0.4 μmol/L each external primer. PCR cycles consisted of a 40-second initial denaturation at 95°C (hot start), and then 10 cycles of denaturation at 95°C for 40 seconds, annealing at an indicated temperature (Table 1) for 40 seconds, and extension at 78°C for an extension time (2.0 minutes/kb target size); and after-extension at 78°C for 7 minutes. The second PCR was done with 2 μl of the 100-fold diluted first PCR product and an internal primer pair, in 35 cycles at the annealing temperature indicated in Table 1. Satisfactory amplification was verified by electrophoresis in a 1% agarose gel and visualization by ethidium bromide staining under UV light. The yeast strain yPH857 [MAT a ura3–53 lys2–801 ade2–101 his3-Δ200 trp1-Δ63 leu2-Δ1 cyh2 R] was transformed with crude PCR product (1 to 5 μl) and the linearized vector (50 ng) by a lithium acetate/heat-shock method as described previously.4Andreutti-Zaugg C Scott RJ Iggo R Inhibition of nonsense-mediated messenger RNA decay in clinical samples facilitates detection of human MSH2 mutations with an in vivo fusion protein assay and conventional techniques.Cancer Res. 1997; 57: 3288-3293PubMed Google Scholar Yeast were then plated and grown at 30°C for 2 to 3 days on a synthetic medium CAu10 (SD; ura−; 0.67% yeast nitrogen base, 2% glucose, 1% casamino acids, 20 mg/Ll-tryptophane, 10 mg/L adenine, and 2.5% agar). After color intensification by incubating the culture plate at 4°C, formed white and red colonies were counted. Assay results were expressed as percentages of red colonies in more than 200 colonies per plate. Yeast were digested for 1 hour with zymolyase 100T (Seikagaku-Kogyo, Tokyo, Japan) and plasmids were then recovered by an alkaline lysis procedure (QIAprep plasmid kit; Qiagen GmbH, Hilden, Germany) and introduced into XL-1blue E. coli cells by electroporation. The presence of a gap-repaired insert of the expected size was confirmed by enzyme digestion with Sph I and Eco RV. Plasmids were sequenced with a DyeDeoxy terminator kit (Perkin-Elmer) on an ABI 377 automated sequencer (Perkin Elmer/Applied Biosystems). Primers used for sequencing were VF-1, 5′-CTTCTATAGACACGCAAACAC-3′ and VR-1, 5′-CAATCATACGTCCCAATTGTC-3, which anneal the vector outside the gap, and primers specific to each gene. The assay was performed for APC gene (codons 1113 to 1493) on genomic DNA extracted from three colon cancer cell lines (COLO201, DLD1, SW480) and three colon cancer tissues (I, H, M). The assay results were compared to those of the yeast color assay specific to APC gene (Furuuchi and colleagues5Furuuchi K Tada M Yamada H Kataoka A Furuuchi N Hamada J Takahashi M Todo S Moriuchi T Somatic mutations of the APC gene in primary breast cancers.Am J Pathol. 2000; 156: 1997-2005Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). A part of hMSH6 cDNA (codons 170 to 402) was amplified with nested PCR from RT products of five colon cancer cell lines (HCT15/DLD1, HCT116, HT29, HCC2998, and KM12) using primers shown in Table 1. yPH857 was transformed with each crude PCR product and linearized assay vector and cultured as described above. The entire coding region of E-cadherin cDNA consists of 2649 bp (882 amino acids). We divided the region into three parts to amplify 804-, 732-, and 1209-bp fragments for respective codons 8 to 275, 231 to 474, and 464 to 866 in nested PCR procedures. The assay of each part was performed in 10 cases of cervical cancer. For the first part assay, adenine concentration was increased from 10 to 12.5 or 15 μg/ml enough to supplement the partial ADE2 activity observed as pink colonies. Yeast strain yPH857 was transformed with 50 ng of Bam HI-linearized pLS381 (original vector) or Sfo I-linearized pMT18 (new vector) in duplicate independent procedures, and resultant yeast colonies were counted for assessment of self-circularization of the vectors with cohesive versus smooth ends in yeast. Bam HI-linearized pLS381 yielded 77 and 72 colonies, whereas Sfo I-linearized pMT18 gave 1 and 0 colony only. In the initial stage of the present study, we observed incorporation of a primer dimer or PCR products with artificial mutations into the vector. To solve the problem, we introduced the following modifications into PCR amplification of gene fragments: 1) to avoid primer duplexing, which may result in formation of a short fragment flanked by recombinable sequences at the both ends, we designed primers to anneal each other with no more than 3 bases; and 2) to minimize base-misincorporation, we changed polymerase from Taq to Pfu TURBO, which has a proofreading function. We also reduced the amplicon size to below 2.5 kb. In some cases of PCR amplification, we had difficulty in obtaining a good amplification of GOI fragment, probably because of the addition of a long gap repair part to the primers. And in such cases, we often observed incorporation of nonspecific PCR product into the vector. We therefore used nested PCR, to maximize the efficiency and specificity of PCR amplification. Applying these strategies, we amplified middle 1/3 (1.0 kb), upper 2/3 (2.2 kb), and lower 2/3 (2.2 kb) parts of BRCA1 exon 11 with the primer sets shown in Table 1, and tested the assay. Consequently, we observed reduction in percentages of red colonies respectively to 4.0 to 10.7% (n = 10; mean, 8.1%), 3.8 to 7.3% (n = 6; mean, 5.5%), and 10.3 to 16.0% (n = 6; mean, 13.3%). Sequence analysis of the plasmids recovered from white colonies demonstrated that all of the plasmids were incorporated with right gene fragments. Further to see whether length of sequences used in homologous recombination could affect the fidelity of recombination, we amplified middle 1/3 of BRCA1 exon 11 using a primer set (gBREX11F2 and gBREX11R2) with additional 18-, 24-, 30-, or 39-base recombination sequences at the 5′-termini, from DNA of cell lines MCF-7 and ZR-75–1, and tested the products in the assay. For each cell line, percentages of the background red colonies were respectively 4.8%, 7.9% (18 bases); 9.8%, 7.2% (24 bases); 11.1%, 12.7% (30 bases); and 7.7%, 8.5% (39 bases). We then examined the presence of the insert in the recovered plasmids by Sph I and Eco RV digestion. Expected sized inserts were confirmed in 20 of 20 white colonies for the 18-base recombination sequences (95% confidence interval 0.832 to 1.000), 40/40 for 24 bases (0.911 to 1.000), 20/20 for 30 bases (0.832 to 1.000), and 18/20 for 39 bases (0.683 to 0.988). Sequence of the plasmids with inserts verified precise recombination of the insert to the expected place without frameshift or mutation. From these data and the consistent data given by Hua and colleagues9Hua SB Qiu M Chan E Zhu L Luo Y Minimum length of sequence homology required for in vivo cloning by homologous recombination in yeast.Plasmid. 1997; 38: 91-96Crossref PubMed Scopus (92) Google Scholar on the efficiency of homologous recombination in yeast, we determined to add 24-base sequences to the gene-specific part of internal primers for homologous recombination in our system thereafter. Assays for BRCA1 exon 11 in two parts were performed in seven breast cancer cell lines. Obtained percentages of red colonies for upper 2/3 (codons 224 to 967) and lower 2/3 parts (codons 629 to 1366) were, respectively, as follows: 5.5 and 5.9% (T-47-D); 5.4 and 10.4% (MDA-MB435s); 4.3 and 12.4% (MDA-MB-231); 5.0 and 15.4% (ZR-75–1); 6.2 and 11.6% (MDA-MB-436); 8.2 and 11.1% (BT549); and 8.2 and 18.1% (SKBr-3). Sequence analysis of the plasmids recovered from red colonies denied the presence of clonal mutation. These results showed that mutation was absent in this region of BRCA1 gene in all of the samples tested, and that the false-positive levels (background red colonies) were GG), 99.5% for SW480 (codon 1338 CAG>TAG), 44.6% for tumor sample I (codon 1450 CGA>TGA), 42.3% for tumor sample H (codon 1465 AGT>T, Figure 2b), and 44.6% for tumor sample M (codons 1309 to 1311 GAAAAGA>GA). These results were consistent with the results by Furuuchi and colleagues5Furuuchi K Tada M Yamada H Kataoka A Furuuchi N Hamada J Takahashi M Todo S Moriuchi T Somatic mutations of the APC gene in primary breast cancers.Am J Pathol. 2000; 156: 1997-2005Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar (respectively, 4.9%, 97.7%, 99.3%, 56.3%, 33.7%, and 32.7%). Assay for hMSH6 (codons 170 to 402) was performed on five colon cancer cell lines. RNA was extracted from these cells, and subjected to RT-PCR amplification of cDNA using the external and internal primer sets shown in Table 1. The assay gave red colonies of 55.9% for HCT15, 8.9% for HCT116, 10.1% for HT29, 7.6% for HCC2998, and 9.8% for KM12. Sequence analysis of the recovered plasmids from red colonies for HCT15 revealed one base deletion of codon 289/299 (GGCCTG→GGCTG; Figure 2c). Assay for E-cadherin gene was done by dividing the entire coding region of 2649 bp into overlapping three parts (first part, codons 8 to 275; second part, codons 231 to 474; third part, codons 464 to 866) as shown in Table 1. A total of 10 tumors of uterine cervix were subjected to the study. On testing the first part, wild-type cDNA gave pink colonies, making discrimination from red colonies difficult. Computer analysis of the protein secondary structure revealed a massive cluster of β-sheet structures in this region (data not shown), suggesting a stiff structure of the protein that might have interfered with ADE2 enzymatic activity by concealing the catalytic site. This problem was overcome by using a medium with an increased amount of adenine (12.5 or 15 μg/ml) and a molecular spacer (FLAG sequence) between E-cadherin cDNA and ADE2 cDNA (pMT18flag). Of 10 cases of cervical cancer, two cases showed red colonies of >20% in the third part: 52.0% in case 2 and 65.8% in case 6 (Figure 2d). Sequence analysis of the plasmids recovered from red colonies demonstrated one base deletion (GATTTT→GATTT) at codon 552/553 in case 2 and 146-bp deletion (whole exon 11 skipping) in case 6. Homologous recombination is a useful property of yeast. It permits highly efficient cloning of DNA fragments into plasmid vectors10Ma H Kunes S Schatz PJ Botstein D Plasmid construction by homologous recombination in yeast.Gene. 1987; 58: 201-216Crossref PubMed Scopus (429) Google Scholar, 11Degryse E Dumas B Dietrich M Laruelle L Achstetter T In vivo cloning by homologous recombination in yeast using a two-plasmid-based system.Yeast. 1995; 11: 629-640Crossref PubMed Scopus (26) Google Scholar, 12Prado F Aguilera A New in-vivo cloning methods by homologous recombination in yeast.Curr Genet. 1994; 25: 180-183Crossref PubMed Scopus (13) Google Scholar, 13Hudson Jr, JR Dawson EP Rushing KL Jackson CH Lockshon D Conover D Lanciault C Harris JR Simmons SJ Rothstein R Fields S The complete set of predicted genes from Saccharomyces cerevisiae in a readily usable form.Genome Res. 1997; 7: 1169-1173Crossref PubMed Scopus (110) Google Scholar as well as integration/targeting of a gene in yeast genome. Furthermore, it has been successfully used for mutation detection in combination with an appropriate reporter system.3Ishioka C Suzuki T FitzGerald M Krainer M Shimodaira H Shimada A Nomizu T Isselbacher KJ Haber D Kanamaru R Detection of heterozygous truncating mutations in the BRCA1 and APC genes by using a rapid screening assay in yeast.Proc Natl Acad Sci USA. 1997; 94: 2449-2453Crossref PubMed Scopus (42) Google Scholar, 4Andreutti-Zaugg C Scott RJ Iggo R Inhibition of nonsense-mediated messenger RNA decay in clinical samples facilitates detection of human MSH2 mutations with an in vivo fusion protein assay and conventional techniques.Cancer Res. 1997; 57: 3288-3293PubMed Google Scholar, 5Furuuchi K Tada M Yamada H Kataoka A Furuuchi N Hamada J Takahashi M Todo S Moriuchi T Somatic mutations of the APC gene in primary breast cancers.Am J Pathol. 2000; 156: 1997-2005Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 6Zhang C-L Tada M Kobayashi H Nozaki M Moriuchi T Abe H Detection of PTEN nonsense mutation and psiPTEN expression in central nervous system high-grade astrocytic tumors by a yeast-based stop codon assay.Oncogene. 2000; 19: 4346-4353Crossref PubMed Scopus (18) Google Scholar, 14Ishioka C Frebourg T Yan YX Vidal M Friend SH Schmidt S Iggo R Screening patients for heterozygous p53 mutations using a functional assay in yeast.Nat Genet. 1993; 5: 124-129Crossref PubMed Scopus (233) Google Scholar, 15Flaman J-M Frebourg T Moreau V Charbonnier F Martin C Chappuis P Sappino A-P Limacher J-M Brons L Benhattar J Tada M Van Meir EG Estreicher A Iggo RD A simple p53 functional assay for screening cell lines, blood, and tumors.Proc Natl Acad Sci USA. 1995; 92: 3963-3967Crossref PubMed Scopus (429) Google Scholar, 16Balmelli-Gallacchi P Schoumacher F Liu JW Eppenberger U Mueller H Picard D A yeast-based bioassay for the determination of functional and non-functional estrogen receptors.Nucleic Acids Res. 1999; 27: 1875-1881Crossref PubMed Scopus (17) Google Scholar These studies used 100- to 200-bp-long homologous sequences for recombination. The present study demonstrated, however, that 18-bp sequences were sufficient for precise recombination. This enabled us to use short sequences added by PCR to insert any target gene fragments into a common yeast-expression vector in vivo in yeast. It dramatically increased applicability and efficiency of the yeast-based stop codon assay. Because the present assay, namely "universal stop codon assay," reports prevalence of mutant allele in a given sample as percentage of red colonies, false positivity (background red colonies) must be suppressed to a minimum. Considering the clonality of mutant-harboring tumor cells and contamination of normal cells in case of somatic mutation, and unbalanced expression of mutant allele because of nonsense-mediated RNA decay4Andreutti-Zaugg C Scott RJ Iggo R Inhibition of nonsense-mediated messenger RNA decay in clinical samples facilitates detection of human MSH2 mutations with an in vivo fusion protein assay and conventional techniques.Cancer Res. 1997; 57: 3288-3293PubMed Google Scholar, 17Maquat LE When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells.RNA. 1995; 1: 453-465PubMed Google Scholar for both somatic and germline mutation, the background is required to be 50%.8McKusick VA Mendelian inheritance in man.in: ed 12. A Catalog of Human Genes and Genetic Disorders. vols 1–3. The Johns Hopkins University Press, Baltimore1998Google Scholar As this assay itself provides an efficient cloning system of gene fragments spanning up to 2 kb, it facilitates sequence determination of missense mutations from yeast white colonies as well as nonsense mutations from red colonies. In conclusion, the universal stop codon assay provides a powerful means of general utility for diagnosis of genetic diseases caused by germline mutation or somatic mutation of genes. This might bring to a solution, at least in part, for increasing demand of genetic diagnosis in the postgenomic era. We thank Ms. M. Yanome for help in manuscript preparation and Ms. N. Furuuchi for technical help.