Detection of Oligomerization and Conformational Changes in the Na+/H+ Antiporter from Helicobacter pylori by Fluorescence Resonance Energy Transfer
2005; Elsevier BV; Volume: 280; Issue: 51 Linguagem: Inglês
10.1074/jbc.m510795200
ISSN1083-351X
AutoresAkira Karasawa, Yumi Tsuboi, Hiroki Inoue, Rie Kinoshita, Norihiro Nakamura, Hiroshi Kanazawa,
Tópico(s)Microbial Metabolites in Food Biotechnology
ResumoOligomerization and conformational changes in the Na+/H+ antiporter from Helicobacter pylori (HPNhaA) were studied by means of fluorescence resonance energy transfer (FRET) analysis. Na+/H+ antiporter-deficient Escherichia coli cells expressing C-terminal fusions of HPNhaA to green fluorescent protein (GFP) variants exhibited wild-type levels of antiporter activity in their everted membrane vesicles. Vesicles containing both HPNhaA-CFP and HPNhaA-YFP or HPNhaA-Venus exhibited FRET from CFP (donor) to YFP or Venus (acceptor), suggesting that HPNhaA forms an oligomer. Co-precipitation of HPNhaA tagged by Venus and FLAG sequences confirmed oligomerization. FRET decreased extensively after treatment of the vesicles with proteinase K, which released GFP variants from the fusion proteins. FRET was not observed by merely mixing vesicles expressing the donor or acceptor fusion alone. Fluorescence of Venus is less sensitive to anions and stronger than that of anion-sensitive YFP. Using HPNhaA-Venus as the acceptor, Li+ was found to cause a significant decrease in FRET regardless of the presence or absence of ΔpH across the membranes, whereas Na+ caused a much weaker effect. This Li+ effect was minimal in vesicles prepared from cells expressing HPNhaA containing an Asp141 to Asn mutation, which results in defective Li+/H+ antiporter activity, possibly Li+ binding. These results demonstrate that monomer interactions within the HPNhaA oligomer are weakened possibly by Li+ binding. Dynamic interactions between HPNhaA monomers were detectable in membranes by FRET analysis, thus providing a new approach to study dynamic conformational changes in NhaA during antiport activity. Oligomerization and conformational changes in the Na+/H+ antiporter from Helicobacter pylori (HPNhaA) were studied by means of fluorescence resonance energy transfer (FRET) analysis. Na+/H+ antiporter-deficient Escherichia coli cells expressing C-terminal fusions of HPNhaA to green fluorescent protein (GFP) variants exhibited wild-type levels of antiporter activity in their everted membrane vesicles. Vesicles containing both HPNhaA-CFP and HPNhaA-YFP or HPNhaA-Venus exhibited FRET from CFP (donor) to YFP or Venus (acceptor), suggesting that HPNhaA forms an oligomer. Co-precipitation of HPNhaA tagged by Venus and FLAG sequences confirmed oligomerization. FRET decreased extensively after treatment of the vesicles with proteinase K, which released GFP variants from the fusion proteins. FRET was not observed by merely mixing vesicles expressing the donor or acceptor fusion alone. Fluorescence of Venus is less sensitive to anions and stronger than that of anion-sensitive YFP. Using HPNhaA-Venus as the acceptor, Li+ was found to cause a significant decrease in FRET regardless of the presence or absence of ΔpH across the membranes, whereas Na+ caused a much weaker effect. This Li+ effect was minimal in vesicles prepared from cells expressing HPNhaA containing an Asp141 to Asn mutation, which results in defective Li+/H+ antiporter activity, possibly Li+ binding. These results demonstrate that monomer interactions within the HPNhaA oligomer are weakened possibly by Li+ binding. Dynamic interactions between HPNhaA monomers were detectable in membranes by FRET analysis, thus providing a new approach to study dynamic conformational changes in NhaA during antiport activity. Na+/H+ antiporters are ubiquitous membrane proteins found in cytoplasmic and organelle membranes of most organisms, from bacteria to human. The gradient of H+ or Na+ across biomembranes for bacteria and yeast or for mammals, respectively, drives the secondary transport of the counterions by Na+/H+ antiporters. The antiporters play a major role in pH and Na+ homeostasis of cells (1Padan E. Schuldiner S. Bakker E. Alkali Cation Transport System in Procaryotes. CRC Press, Inc., Boca Raton, FL1992: 3-24Google Scholar, 2Padan E. Schuldiner S. Biochim. Biophys. Acta. 1994; 1185: 129-151Crossref PubMed Scopus (143) Google Scholar, 3Schuldiner S. Padan E. Bakker E. Alkali Cation Transport Systems in Procaryotes. CRC Press, Inc., Boca Raton, FL1992: 25-51Google Scholar, 4Padan E. Oren A. Microbiology and Biochemistry of Hypersaline Environments. CRC Press, Inc., Boca Raton, FL1998: 163-175Google Scholar, 5Karpel R. Olami Y. Taglicht D. Schuldiner S. Padan E J. Biol. Chem. 1988; 263: 10408-10414Abstract Full Text PDF PubMed Google Scholar). NhaA 2The abbreviations used are: NhaANa+/H+ antiporterECNhaAE. coli NhaAHPNhaAH. pylori NhaAGFPgreen fluorescent proteinCFPcyan fluorescence proteinTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineYFPyellow fluorescent proteinTMtransmembraneACMA9-amino-6-chloro-2-methoxyacridineFRETfluorescence resonance energy transfer.2The abbreviations used are: NhaANa+/H+ antiporterECNhaAE. coli NhaAHPNhaAH. pylori NhaAGFPgreen fluorescent proteinCFPcyan fluorescence proteinTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineYFPyellow fluorescent proteinTMtransmembraneACMA9-amino-6-chloro-2-methoxyacridineFRETfluorescence resonance energy transfer. (ECNhaA), one of three Na+/H+ antiporters in Escherichia coli, plays a major role in the regulation of intracellular pH and cellular Na+ concentrations in bacteria (6Pinner E. Padan E. Schuldiner S. J. Biol. Chem. 1992; 267: 11064-11068Abstract Full Text PDF PubMed Google Scholar, 7Ivey D.M. Guffanti A.A. Zemsky J. Pinner E. Karpel R. Padan E. Schuldiner S. Krulwich T.A. J. Biol. Chem. 1993; 268: 11296-11303Abstract Full Text PDF PubMed Google Scholar, 8Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar, 9Pinner E. Padan E. Schuldiner S. J. Biol. Chem. 1994; 269: 26274-26279Abstract Full Text PDF PubMed Google Scholar). NhaA has a highly conserved primary structure among various bacteria including Helicobacter pylori and is estimated to have 12 transmembrane domains (4Padan E. Oren A. Microbiology and Biochemistry of Hypersaline Environments. CRC Press, Inc., Boca Raton, FL1998: 163-175Google Scholar). The intra- and extramembrane domains have also been determined by phoA fusion analyses (10Rothman A. Padan E. Schuldiner S. J. Biol. Chem. 1996; 271: 32288-32292Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Three Asp residues essential for ion transport, as well as several other functionally important residues, have been identified for ECNhaA (11Inoue H. Noumi T. Sakurai T. Tsuchiya T. Kanazawa H. FEBS Lett. 1995; 363: 264-268Crossref PubMed Scopus (114) Google Scholar) and H. pylori NhaA (HPNhaA) (12Tsuboi Y. Inoue H. Nakamura N. Kanazawa H. J. Biol. Chem. 2003; 278: 21467-21473Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). These residues are clustered in transmembrane domains (TM) 4, 5, 10, and 11 in both HPNhaA (12Tsuboi Y. Inoue H. Nakamura N. Kanazawa H. J. Biol. Chem. 2003; 278: 21467-21473Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) and ECNhaA (11Inoue H. Noumi T. Sakurai T. Tsuchiya T. Kanazawa H. FEBS Lett. 1995; 363: 264-268Crossref PubMed Scopus (114) Google Scholar). Several primary missense mutations defective in antiport activity have been identified in these TMs, and suppressor mutations were mapped to these same TMs and flanking regions, suggesting mutual association of these TMs (12Tsuboi Y. Inoue H. Nakamura N. Kanazawa H. J. Biol. Chem. 2003; 278: 21467-21473Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). This was directly shown by cross-linking of ECNhaA TM4 and TM11 (13Galili L. Herz K. Dym O. Padan E. J. Biol. Chem. 2004; 279: 23104-23113Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar).An apparent pH-dependent antiport activity has been characterized for ECNhaA, in which the antiport activity is 2,000-fold higher at pH 8.5 than that at pH 7.0 (8Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar). In sharp contrast, HPNhaA exhibits consistently high activity from pH 6.5 to 8.5 (14Inoue H. Sakurai T. Ujike S. Tsuchiya T. Murakami H. Kanazawa H. FEBS Lett. 1999; 443: 11-16Crossref PubMed Scopus (26) Google Scholar). We have shown for HPNhaA that the enhancement of activity at alkaline pH is associated with Loop 7 and TM8, whereas the high activity at acidic pH is caused by a structure formed by TM4 and TM10 (12Tsuboi Y. Inoue H. Nakamura N. Kanazawa H. J. Biol. Chem. 2003; 278: 21467-21473Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). A chimeric NhaA composed of the N- and C-terminal halves of ECNhaA and HPNhaA, respectively, showed maximum antiporter activity in the intermediate pH range, providing additional evidence for functional interactions between the N- and C-terminal halves of the protein (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar). Recently, the topology of HPN-haA TM4 was analyzed by cysteine-scanning mutagenesis and N-ethyl maleimide probing of Cys residue accessibility (16Kuwabara N. Inoue H. Tsuboi Y. Nakamura N. Kanazawa H. J. Biol. Chem. 2004; 279: 40567-40575Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Part of TM4 was shown to face a water-filled channel-like structure. Asp141 and Thr140 in TM4 could be the binding site for transporting ions (16Kuwabara N. Inoue H. Tsuboi Y. Nakamura N. Kanazawa H. J. Biol. Chem. 2004; 279: 40567-40575Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar).Recent studies on the crystallographic structures of the lac permease (17Abramson J. Smirnova I. Kasho V. Verner G. Kaback H.R. Iwata S. Science. 2003; 301: 610-615Crossref PubMed Scopus (1216) Google Scholar) and glycerol 3-phosphate transporter (18Huang Y. Lemieux M.J. Song J. Auger M. Wang D.N. Science. 2003; 301: 616-620Crossref PubMed Scopus (847) Google Scholar) have predicted that a dynamic conformational change coincides with the operation of these transporters. A crystallographic structure of ECNhaA at 7.0 Å has been reported and shows clustering of α-helical transmembrane domains (19Williams K.A. Nature. 2000; 403: 112-115Crossref PubMed Scopus (201) Google Scholar). It may be too early to predict a dynamic conformational change for NhaA; however, pH-dependent conformational changes in ECNhaA have been detected by means of trypsin susceptibility (20Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14572-14576Crossref PubMed Scopus (37) Google Scholar). This implies that a pH-dependent conformational change during antiport is quite possible. It is important to establish a procedure to detect this putative conformational change during operation of the Na+/H+ antiport in real time to understand the energy coupling mechanisms. Therefore, in this study we developed methods to use fluorescence resonance energy transfer (FRET) between two green fluorescent protein (GFP) variants fused to HPNhaA.FRET can occur between donor and acceptor chromophores when they are located within 100 Å of each other and arranged properly in terms of their transition dipole moments (21Lakowicz J.R. Principles of Fluorescence Spectroscopy. Kluwer Academic/Plenum, New York1999: 368-391Google Scholar). The ECNhaA dimer is reported to occupy 48 × 90.5 Å based on two-dimensional crystal data (25Williams K.A. Geldmacher-Kaufer U. Padan E. Schuldiner S. Kuhlbrandt W. EMBO J. 1999; 18: 3558-3563Crossref PubMed Scopus (110) Google Scholar). Therefore, it is reasonable to expect that FRET could be used to detect oligomerization of HPNhaA containing suitable chromophores. Here, we used HPNhaA and GFP fusion proteins, in which GFP variants serve as the chromophores for FRET analyses. GFP variants like CFP, YFP, and Venus (32Nagai T. Ibata K. Park E.S. Kubota M. Mikoshiba K. Miyawaki A. Nat. Biotechol. 2002; 20: 87-90Crossref PubMed Scopus (2155) Google Scholar) are suitable as donor and acceptor chromophores. Because FRET efficiency depends on the orientation factor of the transition dipole moment of the donor and acceptor chromophores (22Forster T. Ann. Phys. 1948; 2: 55-75Crossref Scopus (4838) Google Scholar), as well as their distance, FRET can detect conformational changes between the chromophore-tagged proteins. We expected that this would enable us to detect the conformational changes in HPNhaA-GFP variant fusions (23Tsien R.Y. Bacskai B.J. Adams S.R. Trends Cell Biol. 1993; 3: 242-245Abstract Full Text PDF PubMed Scopus (82) Google Scholar) occurring during antiport activity, including the ion binding step. Because pH changes affect the conformation of ECNhaA, such changes might be detectable by a change in FRET with HPNhaA-GFP variant fusions. In addition, a GFP-based FRET analysis could be used to study oligomerization or conformational changes in HPNhaA in intact membranes or living cells. Therefore, we used a GFP-based FRET analysis to study oligomerization and conformational changes of HPNhaA.ECNhaA is known to form an oligomer, possibly a dimer, as shown by cross-linking experiments and analyses of the two dimensional crystal structure (24Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (77) Google Scholar, 25Williams K.A. Geldmacher-Kaufer U. Padan E. Schuldiner S. Kuhlbrandt W. EMBO J. 1999; 18: 3558-3563Crossref PubMed Scopus (110) Google Scholar). However, dimerization has neither been shown to occur under native conditions in membranes, nor in intact cells. Here, we detected oligomerization between two HPNhaAs fused to different GFP variants (CFP, YFP, or Venus) by FRET in the same E. coli cell. We established a FRET system for HPNhaA and detected oligomerization in intact membranes and cells. Further, through FRET, we detected conformational changes in HPNhaA during changes in pH and during Li+/H+ antiport, possibly as a result of Li+ binding.MATERIALS AND METHODSBacteria Strains and Culture Conditions—E. coli strains HITΔAB– (ΔlacY, ΔnhaA, nhaB–) (26Thelen P. Tsuchiya T. Goldberg E.B. J. Bacteriol. 1991; 173: 6553-6557Crossref PubMed Google Scholar) and JM109 (27Messing J. Vieira J. Gene (Amst.). 1982; 19: 269-276Crossref PubMed Scopus (1717) Google Scholar) were used for the expression of HPNhaA fused to GFP variants and for the construction of various plasmids, respectively. Cells were cultured in L broth (LB) (28Kanazawa H. Miki T. Tamura F. Yura T. Futai M. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 1126-1130Crossref PubMed Scopus (73) Google Scholar) containing 87 mm KCl instead of NaCl (LBK). For growth on solid plates, agar (1.5%, w/v) was added to the medium. Transformants were selected using an appropriate antibiotic. For analysis of salt resistance of HITΔAB– transformed with various plasmids, additional amounts of NaCl or LiCl were added to LB plates. The plates and liquid cultures were incubated at 37 °C.Construction of Expression Plasmids Encoding Fusion Protein Genes—Construction of HPNhaA expression plasmids derived from pBR322 (pBR-HP) has been described previously (14Inoue H. Sakurai T. Ujike S. Tsuchiya T. Murakami H. Kanazawa H. FEBS Lett. 1999; 443: 11-16Crossref PubMed Scopus (26) Google Scholar). The HindIII/SalI fragment including the entire coding region of HPNhaA was excised from pBR-HP and inserted into the pACYC184 plasmid (24Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Crossref PubMed Scopus (77) Google Scholar), and named pACYC-HP. CFP and YFP were joined to the C or N terminus of HPNhaA in pBR-HP or in pACYC-HP. For the C terminus fusion, CFP and YFP were amplified by PCR from the pECFP or pEYFP vector (Clontech, Palo Alto, CA) using the primer sequences: ACATGCATGCCCATGGTGAGCAAGGGCGAGG and CCGTCGACTTACTTGTACAGCTCGTCC, which include SalI or SphI restriction sites. The PCR products were ligated to the SalI/SphI fragment of pBR-HP or pACYC-HP, creating the HPNhaA-CFP and HPNh-aA-YFP plasmids, respectively. For the N terminus fusion, a two-step PCR was used to create a linker sequence (Gly-Gly-Ser-Gly-Gly) to link the C terminus of CFP or YFP and the N terminus of HPNhaA with the primer sequences: CCGGAATTCGAAAGAGAAATAAAAAATGGTGAGCAAGGGCGAG and ATTTCCTCCACTTCCTCCCTTGTACAGCTCGTCCAT, for CFP and YFP, and GGAGGAAGTGGAGGAAATCTCAAAAAAACAGAAAACGCGCTCAGT and GGAAACAGCTATGACCAT, for HPNhaA. Then the primer sequences AATTAACCCTCACTAAAGGG and CCGGAATTCGAAAGAGAAATAAAAAATGGTGAGCAAGGGCGAG (29Inoue H. Noumi T. Shimomura T. Takimoto N. Tsuchiya T. Kanazawa H. Biol. Pharm. Bull. 1998; 21: 1128-1133Crossref PubMed Scopus (8) Google Scholar), were used to amplify the fused sequences and create the restriction sequences to ligate the fragments into the appropriate plasmids to create CFP-HPNhaA and YFP-HPNhaA or CFP-HPNhaA-YFP and YFP-HPNhaA-CFP. The plasmid expressing an HPNhaA-Venus fusion was constructed by essentially the same method as described above using the Venus/pCS2 plasmid (RIKEN, Wako City, Japan) instead of the vector plasmid for pEYFP.To create Loop 8 fusions, CFP or Venus were inserted into the Loop 8 of HPNhaA as follows. A BanIII restriction site between amino acid residues 286 and 287 of HPNhaA was created by two-step PCR (29Inoue H. Noumi T. Shimomura T. Takimoto N. Tsuchiya T. Kanazawa H. Biol. Pharm. Bull. 1998; 21: 1128-1133Crossref PubMed Scopus (8) Google Scholar) with the primer sequences: GTAAAACGACGGCCAGT and TTTTCATCGATTTCAATAGAATGCAAGATTT, and TTGAAATCGATGAAAAAGCGAGCGCC and GGAAACAGCTATGACCAT using pBR-HP as the template creating the plasmid pBR-HP-BanIII. The coding sequences of CFP or Venus were amplified by PCR using the primers sequences: CCCCATCGATGGAGGAGGAGGAGGAATGGTGAGCAAGGGCGAGGAG and CCCCATCGATCCTCCTCCTCCTCCTCTTGTACAGCTCGTCCATGC, which include the BanIII site and the linker sequence Gly-Gly-Gly-Gly-Gly. The PCR products were ligated into the BanIII fragment of pBR-HP-BanIII, creating HPNhaA(Loop8-CFP)-FLAG or HPNhaA(Loop8-Venus)-FLAG. Venus was fused to the C terminus of HPNhaA in the resultant plasmids by ligating the fragment into the SalI/SphI restriction site, as described above, creating HPNhaA(Loop8 CFP)-Venus. The EcoRI/SphI fragments of these plasmids were inserted into the pACYC vector encoding HPNhaA fused to CFP or Venus. A fusion gene with mutant HPNhaA and GFP variants was created as described above, using a plasmid encoding a mutant HPNhaA (12Tsuboi Y. Inoue H. Nakamura N. Kanazawa H. J. Biol. Chem. 2003; 278: 21467-21473Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) as the template.The gene for the b subunit of the F1Fo ATPase (Fob) was amplified by PCR with the JM109 E. coli genome as the template and the primer sequences: CCGGAATTCGAAAGAGAAATAAAAAGTGAATCTTAACGCAACAAT and ACATGCATGCGCAGTTCAGCGACAAGTTTAT, which cover the coding sequence of the gene and include an EcoRI and a SphI restriction site, respectively. After digestion by EcoRI and SphI, the PCR products were ligated to the EcoRI/SphI fragment of the pBR-HPNhaA-Venus vector to construct a plasmid expressing a Fob-Venus fusion protein. The LacY and TetAB genes were amplified by PCR from the E. coli genome with the primer sequences: CCGGAATTCGAAAGAGAAATAAAAAATGTACTATTTAAAAAACAC and ACATGCATGCGAGCGACTTCATTCACCTGAC for LacY, and CCGGAATTCGAAAGAGAAATAAAAAATGAATAGTTCGACAAAGA and ACATGCATGCGAGCACTTGTCTCCTGTTTAC for TetAB, which included EcoRI and SphI restriction sites, respectively. After digestion with EcoRI and SphI, the PCR products were ligated into the EcoRI/SphI site of the pBR-HPNhaA-Venus vector, resulting in plasmids expressing LacY-Venus or TetAB-Venus.Preparation of Membrane Vesicles and Measurement of Na+/H+ Antiporter Activities—Everted membrane vesicles from E. coli cells transformed with various plasmids were prepared as described previously (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar). After centrifugation of E. coli cells disrupted with a French press, the collected membrane vesicles (100 μg) were resuspended in 2 ml of assay buffer (10 mm Tricine and 140 mm KCl, adjusted to the desired pH with KOH), as described previously (11Inoue H. Noumi T. Sakurai T. Tsuchiya T. Kanazawa H. FEBS Lett. 1995; 363: 264-268Crossref PubMed Scopus (114) Google Scholar). Proton flow was measured by monitoring 9-amino-6-chloro-2-methoxyacridine (ACMA) fluorescence quenching after addition of potassium lactate (5 mm, pH 7.0) as a substrate of the electron transport respiratory chain (30Nozaki K. Inaba K. Kuroda T. Tsuda M. Tsuchiya T. Biochem. Biophys. Res. Commun. 1996; 222: 774-779Crossref PubMed Scopus (75) Google Scholar). Fluorescence quenching, as a measure of the antiporter activity, was monitored with a fluorospectrophotometer (JASCO FP-750, Jasco Ltd., Tokyo, Japan) after adding 5 mm NaCl or LiCl.Detection of Dimerization by Coprecipitation—Membrane vesicles from E. coli HITΔAB-cells transformed with various expression plasmids were prepared as described previously (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar). Membrane vesicles (0.25 mg of protein) were suspended in 300 μl of 10 mm sodium phosphate buffer (pH 7.4) containing 0.1 m NaCl and 1% Triton X-100. The suspension was centrifuged at 178,000 × g for 30 min with an Airfuge (Beckman Coulter, Fullerton, CA) to remove insoluble materials. The resultant supernatant was subjected to immunoprecipitation with an anti-FLAG M2-agarose affinity gel (Sigma-Aldrich). Immunoprecipitates were solubilized in 0.125 m Tris-HC1 buffer (pH 6.8) containing 4% SDS, 20% glycerol, and 0.004% bromphenol blue. The proteins were detected by Western blot analysis after separation on SDS-PAGE, as described previously (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar). The antibodies used were anti-FLAG M2 monoclonal antibodies (Sigma-Aldrich) and anti-GFP antibodies (Molecular Probes, Eugene, OR). Horseradish peroxidase-conjugated secondary antibodies against mouse and rabbit IgG were purchased from Jackson ImmunoResearch (West Grove, PA) and Vector Labs (Burlingame, CA), respectively.Fluorescence Measurements and Microscopic Observation—All fluorescence measurements were performed using an FP-750 fluorometer. E. coli cells (HITΔAB–) expressing fusion protein were grown at 37 °C in LBK medium overnight, washed, resuspended in phosphate-buffered saline, and diluted to an A600 of 1.0. This suspension was used for fluorescence measurements. FRET measurements using everted membrane vesicles from cells expressing fusion proteins were performed in Tricine-KOH buffer (pH 8.5, Tricine, 10 mm; KCl, 140 mm). Proteinase K (50 μm), and NaCl, LiCl, or choline Cl (in various concentrations) were added to the reaction mixture. Cell suspensions (2 ml) from the early logarithmic growth phase or 100 μg of membranes in 2 ml were irradiated at 433 nm to excite CFP and fluorescence emission was recorded at 450–600 nm. For excitation of YFP or Venus, cells or membranes were illuminated at 473 nm, and then fluorescence emission was recorded at 500–600 nm. FRET was determined by subtracting the control emission spectra from the FRET emission spectrum. The control emission was obtained by excitation of two types of control cells or membranes, one expressing only the CFP-tagged protein and the other expressing only the YFP or Venus-tagged protein (31Overton M.C. Blumer K.J. Methods. 2002; 27: 324-332Crossref PubMed Scopus (37) Google Scholar). The apparent efficiency of FRET was calculated by dividing the maximum value of fluorescence intensity of the FRET spectrum by the maximum value of fluorescence intensity obtained upon direct excitation of YFP or Venus.Fluorescence images of cells coexpressing CFP- and Venus-tagged fusion proteins were captured using a CCD camera (ORCA, Hamamatsu Photonics, Shizuoka, Japan) mounted on an Olympus BX51 microscope equipped with a FRET filter set (U-MF2, Olympus, Tokyo, Japan).Immunological Detection—Aliquots of the membrane vesicles prepared from various HPNhaA transformants were subjected to SDS-polyacrylamide gel electrophoresis, as described previously (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar). The separated proteins were blotted onto GVHP filters (Millipore, Billerica, MA), and probed with anti-GFP antibodies (Molecular Probes). Immunoreactive bands were visualized by enhanced chemiluminescence (Amersham Biosciences), as described previously (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar).Gene Manipulation and DNA Sequencing—Preparation of plasmids, digestion of DNA with restriction endonucleases, ligation with T4 DNA ligase, and other techniques for handling DNA were performed according to published procedures (34Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982Google Scholar). The nucleotide sequences of DNA fragments cloned into various expression plasmids in this study were verified using an automated sequencer (PE Biosystems, Foster City, CA).Materials—Restriction endonucleases, T4 DNA ligase, Taq, and KOD DNA polymerases were purchased from Toyobo Co. (Osaka, Japan). Oligonucleotides were synthesized by Invitrogen. Other reagents and materials were of the highest grade commercially available.RESULTSConstruction of Active HPNhaA-GFP Fusion Proteins—To detect interactions between HPNhaA monomers by FRET, we constructed N- or C-terminal fusions of HPNhaA with CFP or YFP (Fig. 1A). We have shown previously that the N- and C-terminal halves of HPNhaA interact functionally with each other based on the analysis of a chimeric NhaA construct of the E. coli and H. pylori proteins (15Inoue H. Tsuboi Y. Kanazawa H. J. Biochem. 2001; 129: 569-576Crossref PubMed Scopus (17) Google Scholar). HPNhaA fused at both its N- and C-terminal ends to GFP variants (CFP-HPNhaA-YFP, YFP-HPNhaA-CFP) was also constructed to detect interactions between its N- and C-terminal halves (Fig. 1A). The antiporter activity of the fusion proteins in E. coli HITΔAB– cells transformed with the fusion genes was analyzed by measuring their ability to grow on medium containing high concentrations of NaCl or LiCl. All of the transformed cells were able to grow on high salt agar plates, suggesting that the fusion proteins exhibited antiporter activity. Whereas cell growth was vigorous for cells transformed with the C-terminal GFP fusion (TABLE ONE), the cell growth in high salt medium was very low for fusions with GFP variants at both their N and C termini (TABLE ONE).TABLE ONECell growth of various transformants of NhaA-GFP variant fusions on the high salinityFusion proteinLocation of GFP variantCell growthNa+Li+HPNhaA-FLAG-++++Vector---CFP-HPNhaA-FLAGN terminus++-YFP-HPNhaA-FLAGN terminus++-HPNhaA-CFPC terminus++++HPNhaA-YFPC terminus++++HPNhaA-VenusC terminus++++CFP-HPNhaA-YFPN/C terminus+-YFP-HPNhaA-CFPN/C terminus+-HPNhaA(Loop8 CFP)-FLAGLoop 8++++HPNhaA(Loop8 Venus)-FLAGLoop 8++++HPNhaA(Loop8 CFP)-VenusLoop 8/C terminus+++ Open table in a new tab The Na+/H+ antiporter activities were directly measured in everted membrane vesicles prepared from transformed cells. Consistent with the results of salt-resistant cell growth, HPNhaA fused at its C terminus to GFP variants showed Na+/H+ and Li+/H+ antiporter activity comparable to that of the wild type (Fig. 1, B and C). However, the other fusions showed much lower activity (data not shown). The expression of the fusion proteins in the membranes was confirmed by Western blot analyses with anti-GFP antibodies (Fig. 2, A and B). The expression levels of HPNhaA-CFP and HPNhaA-YFP were about 20-fold greater than the other fusions (data not shown). Thus, we concluded that the lower antiporter activity of the N-terminal end or both N- and C-terminal end fusion proteins was because of lower levels of expression or integration of the proteins into the membrane.FIGURE 2Expression of HPNhaA-GFP variant fusions in the membrane. A, aliquots of membranes containing different HPNhaA-GFP variant fusions (Fig. 1A) were analyzed by Western blotting using anti-GFP antibodies, and the resulting immunocomplexes were detected as described under “Materials and Methods.” Lane 1, HPNhaA-FLAG; lane 2, HPNhaA-CFP; lane 3, HPNhaA-YFP; lane 4, HPNhaA-Venus; lane 5, HPNhaA(Loop8 CFP)-FLAG; lane 6, HPNhaA(Loop8 Venus)-FLAG; lane 7, HPNhaA(Loop8 CFP)-Venus. 20 μg of protein were loaded in lane 7, 2 μg were loaded in lanes 1, 2, 3, and 5, and 1.5 μg were loaded in lanes 4 and 6. B, band intensities for HPNhaA-GFP variant fusions shown in A were measured with a densitometer together with Scion Image beta 4.02 software (NIH).View Large Image Figure ViewerDownload Hi-res image Download (PPT)In summary, HPNhaA-CFP and HPNhaA-YFP fusions were active Na+/H+ and Li+/H+ antiporters, and exhibited profiles of pH-dependent antiporter activity similar to those of the wild type. These results indicate that the fusion proteins were suitable for FRET analyses.Detection of FRET in Everted Membrane Vesicles Containing Fusion Proteins—To detect interactions between HPNhaA monomers in the membranes by FRET, we introduced both HPNhaA-CFP and HPNhaA-YFP into E. coli HITΔAB–. If HPNhaA-CFP and HPNhaA-YFP interact closely within the membrane vesicles, FRET from CFP to YFP should be observed. The everted membrane vesicles were prepared from the transformants, and then fluorescence was measured.Fluorescence emission profiles for the membranes of E. coli cells expressing HPNhaA-CFP or H
Referência(s)