Fetal asphyxia induces acute and persisting changes in the ceramide metabolism in rat brain
2013; Elsevier BV; Volume: 54; Issue: 7 Linguagem: Inglês
10.1194/jlr.m034447
ISSN1539-7262
AutoresEvi Vlassaks, Chiara Mencarelli, Maria Nikiforou, Eveline Strackx, Maria J. Ferraz, Johannes M. F. G. Aerts, Marc H. De Baets, Pilar Martínez‐Martínez, Antonio W. D. Gavilanes,
Tópico(s)Neonatal and fetal brain pathology
ResumoFetal asphyctic preconditioning, induced by a brief episode of experimental hypoxia-ischemia, offers neuroprotection to a subsequent more severe asphyctic insult at birth. Extensive cell stress and apoptosis are important contributing factors of damage in the asphyctic neonatal brain. Because ceramide acts as a second messenger for multiple apoptotic stimuli, including hypoxia/ischemia, we sought to investigate the possible involvement of the ceramide pathway in endogenous neuroprotection induced by fetal asphyctic preconditioning. Global fetal asphyxia was induced in rats by clamping both uterine and ovarian vasculature for 30 min. Fetal asphyxia resulted in acute changes in brain ceramide/sphingomyelin metabolic enzymes, ceramide synthase 1, 2, and 5, acid sphingomyelinase, sphingosine-1-phosphate phosphatase, and the ceramide transporter. This observation correlated with an increase in neuronal apoptosis and in astrocyte number. After birth, ceramide and sphingomyelin levels remained high in fetal asphyxia brains, suggesting that a long-term regulation of the ceramide pathway may be involved in the mechanism of tolerance to a subsequent, otherwise lethal, asphyctic event. Fetal asphyctic preconditioning, induced by a brief episode of experimental hypoxia-ischemia, offers neuroprotection to a subsequent more severe asphyctic insult at birth. Extensive cell stress and apoptosis are important contributing factors of damage in the asphyctic neonatal brain. Because ceramide acts as a second messenger for multiple apoptotic stimuli, including hypoxia/ischemia, we sought to investigate the possible involvement of the ceramide pathway in endogenous neuroprotection induced by fetal asphyctic preconditioning. Global fetal asphyxia was induced in rats by clamping both uterine and ovarian vasculature for 30 min. Fetal asphyxia resulted in acute changes in brain ceramide/sphingomyelin metabolic enzymes, ceramide synthase 1, 2, and 5, acid sphingomyelinase, sphingosine-1-phosphate phosphatase, and the ceramide transporter. This observation correlated with an increase in neuronal apoptosis and in astrocyte number. After birth, ceramide and sphingomyelin levels remained high in fetal asphyxia brains, suggesting that a long-term regulation of the ceramide pathway may be involved in the mechanism of tolerance to a subsequent, otherwise lethal, asphyctic event. Perinatal asphyxia (PA) (hypoxia/ischemia) is one of the most common causes contributing to neonatal morbidity and mortality (1Lawn J.E. Kerber K. Enweronu-Laryea C. Cousens S. 3.6 million neonatal deaths–what is progressing and what is not?.Semin. Perinatol. 2010; 34: 371-386Crossref PubMed Scopus (312) Google Scholar, 2World Health Organization. 2005. The World Health Report: Make every mother and child count. World Health Organization.Google Scholar). During periods of asphyxia, impaired gas exchange between mother and fetus occurs, leading to changes in blood gases and pH (3Low J.A. Intrapartum fetal asphyxia: definition, diagnosis, and classification.Am. J. Obstet. Gynecol. 1997; 176: 957-959Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). As a consequence, asphyctic newborns develop multi-organ dysfunction (4Tarcan A. Tiker F. Guvenir H. Gurakan B. Hepatic involvement in perinatal asphyxia.J. Matern. Fetal Neonatal Med. 2007; 20: 407-410Crossref PubMed Scopus (22) Google Scholar); with the brain as one of the most affected organs reflecting severe and long-term cognitive and motor deficits (5Jensen A. Garnier Y. Middelanis J. Berger R. Perinatal brain damage–from pathophysiology to prevention.Eur. J. Obstet. Gynecol. Reprod. Biol. 2003; 110: S70-S79Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 6Low J.A. Determining the contribution of asphyxia to brain damage in the neonate.J. Obstet. Gynaecol. Res. 2004; 30: 276-286Crossref PubMed Scopus (123) Google Scholar). Yet, no effective therapies are available, except for hypothermia in term neonates suffering from moderate encephalopathy (7Perlman J.M. Intervention strategies for neonatal hypoxic-ischemic cerebral injury.Clin. Ther. 2006; 28: 1353-1365Abstract Full Text PDF PubMed Scopus (209) Google Scholar). There is, however, evidence that molecular mechanisms of organ preconditioning result in tissue tolerance to a following more severe insult that would otherwise be lethal (8Hagberg H. Dammann O. Mallard C. Leviton A. Preconditioning and the developing brain.Semin. Perinatol. 2004; 28: 389-395Crossref PubMed Scopus (49) Google Scholar). Previously, we have shown in a rat model that fetal asphyxia, induced at embryonic day 17 (E17) by clamping the uterine vasculature for 30 min, induces brain tolerance to a stronger PA insult (9Strackx E. Van den Hove D.L. Prickaerts J. Zimmermann L. Steinbusch H.W. Blanco C.E. Gavilanes A.W. Vles J.S. Fetal asphyctic preconditioning protects against perinatal asphyxia-induced behavioral consequences in adulthood.Behav. Brain Res. 2010; 208: 343-351Crossref PubMed Scopus (32) Google Scholar, 10Strackx E. Zoer B. Van den Hove D. Steinbusch H. Blanco C. Vles J.S. Villamor E. Gavilanes A.W. Brain apoptosis and carotid artery reactivity in fetal asphyctic preconditioning.Front. Biosci. (Schol. Ed.). 2010; 2: 781-790Crossref PubMed Scopus (17) Google Scholar). Moreover, less apoptotic cell death was seen in brains of Fetal asphyctic preconditioned animals compared with nonpreconditioned animals subjected to PA (10Strackx E. Zoer B. Van den Hove D. Steinbusch H. Blanco C. Vles J.S. Villamor E. Gavilanes A.W. Brain apoptosis and carotid artery reactivity in fetal asphyctic preconditioning.Front. Biosci. (Schol. Ed.). 2010; 2: 781-790Crossref PubMed Scopus (17) Google Scholar). Hence, the identification of the signaling pathways and effectors involved in brain tolerance is of primary importance for the development of new neuroprotective therapies. Important mechanisms may involve changes in ceramide levels which have been reported in various models of hypoxia/ischemia (11Novgorodov S.A. Gudz T.I. Ceramide and mitochondria in ischemia/reperfusion.J. Cardiovasc. Pharmacol. 2009; 53: 198-208Crossref PubMed Scopus (72) Google Scholar, 12Bhuiyan M.I. Islam M.N. Jung S.Y. Yoo H.H. Lee Y.S. Jin C. Involvement of ceramide in ischemic tolerance induced by preconditioning with sublethal oxygen-glucose deprivation in primary cultured cortical neurons of rats.Biol. Pharm. Bull. 2010; 33: 11-17Crossref PubMed Scopus (18) Google Scholar). Ceramide is the backbone of complex sphingolipids and is a very active metabolite (11Novgorodov S.A. Gudz T.I. Ceramide and mitochondria in ischemia/reperfusion.J. Cardiovasc. Pharmacol. 2009; 53: 198-208Crossref PubMed Scopus (72) Google Scholar). Increased ceramide synthesis in response to short periods of hypoxia induces DNA fragmentation and cell death (11Novgorodov S.A. Gudz T.I. Ceramide and mitochondria in ischemia/reperfusion.J. Cardiovasc. Pharmacol. 2009; 53: 198-208Crossref PubMed Scopus (72) Google Scholar, 13Ueda N. Kaushal G.P. Hong X. Shah S.V. Role of enhanced ceramide generation in DNA damage and cell death in chemical hypoxic injury to LLC-PK1 cells.Kidney Int. 1998; 54: 399-406Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Conversely, chronic exposure to hypoxia is characterized by the lack of ceramide accumulation (14Bitar F.F. Mroueh S. El Khatib M. Bitar H. Tarrabain M. El Sabban M. Obeid M. Nasser M. Dbaibo G.S. Tissue-specific ceramide response in the chronically hypoxic rat model mimicking cyanotic heart disease.Prostaglandins Other Lipid Mediat. 2003; 72: 155-163Crossref PubMed Scopus (3) Google Scholar) suggesting that a protective adaptive response to chronic hypoxia may exist. Because ceramide acts as a second messenger in apoptosis (15Ohtani R. Tomimoto H. Kondo T. Wakita H. Akiguchi I. Shibasaki H. Okazaki T. Upregulation of ceramide and its regulating mechanism in a rat model of chronic cerebral ischemia.Brain Res. 2004; 1023: 31-40Crossref PubMed Scopus (59) Google Scholar), its production is highly regulated and its levels inside the cell depend on the activity of several enzymes that participate in its synthesis and catabolism (11Novgorodov S.A. Gudz T.I. Ceramide and mitochondria in ischemia/reperfusion.J. Cardiovasc. Pharmacol. 2009; 53: 198-208Crossref PubMed Scopus (72) Google Scholar, 16Hanada K. Kumagai K. Yasuda S. Miura Y. Kawano M. Fukasawa M. Nishijima M. Molecular machinery for non-vesicular trafficking of ceramide.Nature. 2003; 426: 803-809Crossref PubMed Scopus (823) Google Scholar, 17Mencarelli C. Losen M. Hammels C. De Vry J. Hesselink M.K. Steinbusch H.W. De Baets M.H. Martinez-Martinez P. The ceramide transporter and the Goodpasture antigen binding protein: one protein–one function?.J. Neurochem. 2010; 113: 1369-1386PubMed Google Scholar). In this study, we aim to investigate acute changes occurring in the sphingomyelin/ceramide pathway after a sublethal fetal asphyctic insult to identify molecules important in brain tolerance. Moreover, we study the crosstalk between ceramide metabolism and the brain apoptotic response. Better understanding of these mechanisms may allow the development of new neuroprotective therapies. All experiments were approved by the Animal Ethics Board of Maastricht University on animal welfare according to Dutch governmental regulations. Timed-pregnant Sprague-Dawley rats (E14; Charles River, France) were kept under standard laboratory conditions (food and water given ad libitum, 21 ± 2°C environment temperature, and a 12 h light/dark schedule). Unsexed fetuses and male neonates were used within this study. Fetal asphyxia was induced as previously described by Strackx et al. (9Strackx E. Van den Hove D.L. Prickaerts J. Zimmermann L. Steinbusch H.W. Blanco C.E. Gavilanes A.W. Vles J.S. Fetal asphyctic preconditioning protects against perinatal asphyxia-induced behavioral consequences in adulthood.Behav. Brain Res. 2010; 208: 343-351Crossref PubMed Scopus (32) Google Scholar). Briefly, at E17 fetal asphyxia was induced by clamping both uterine and ovarian arteries with removable clamps for 30 min (Fig. 1A). All pups were born by caesarean section (CS). Animals were sacrificed directly after CS performed at 6, 12, and 72 h after the fetal asphyctic insult. Alternatively, CS was performed at birth (E21) and animals were sacrificed at 2 h, 6 h, and 7 days after CS (n = 6 for each group at every time point) (Fig. 1B). Control pups were born at the same time points by CS from untreated mothers. Pups belonging to the prenatal experimental groups were littermates from the same mother. The postnatal pups were born from at least two mothers. Total brain hemispheres of fetal and neonatal pups were collected and snap-frozen. All samples were stored at −80°C prior to further analysis. Total brain hemispheres were collected at 6 and 12 h after the fetal asphyctic insult and 2 h, 6 h and 7 days after birth. Total RNA was extracted from frozen tissue by homogenization of the samples with TRIzol reagent (Invitrogen, Breda, The Netherlands) according to the manufacturer's guidelines. Quality and quantity of the RNA were determined using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, MA). RNA integrity number values were determined using the Agilent 2100 Bioanalyzer (Agilent Technologies, Amstelveen, The Netherlands) and RNA samples with RNA integrity number > 8 were included. cDNA was synthesized by using the RevertAid First Strand cDNA synthesis kit (Fermentas, St. Leon Rot, Germany) according to the manufacturer's protocol. The samples were diluted 1 to 20 with DEPC-treated sterilized water and stored at −80°C prior to quantitative PCR analysis. Primers were designed using Primer3plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi, Boston, MA) for the ceramide transporter protein (CERT), Goodpasture antigen-binding protein (GPBP), LAG1 homolog ceramide synthase (Lass)1 to Lass6, neutral sphingomyelinase 1 and 2 (nSMase1-2), acid sphingomyelinase (aSMase), sphingomyelin synthase 1 and 2 (SMS1-2), sphingosine kinase 1 (SphK1), sphingosine-1-phosphate phosphatase (Sph1PP), and oxysterol-binding protein 1 (OSBP1) (Table 1). All samples were analyzed in duplicate using the LightCycler 480 SYBR Green I Master kit (Roche, Almere, The Netherlands). Samples negative for RevertAid Reverse Transcriptase were used as control to ensure specific amplification. The real-time PCR was performed on a LightCycler 480 system (Roche) with 45 cycles: 20 s at 95°C, 15 s at 60°C, 15 s at 72°C. To standardize for the amount of cDNA, the geometric mean of three reference genes, β-actin, hypoxanthine-guanine phosphoribosyltransferase (HPRT), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Table 1), was used. Quantification cycle values were analyzed with the Lightcycler 480 software (Conversion LC 480 and LingRegPCR version 9.19β) and calculated based on the cycle threshold (Ct) values.TABLE 1Primer sequences for the selected genes of interest for quantitative PCR analysisGeneAccession numberForward sequence (5′-3′)Reverse sequence (5′-3′)β-actinNM_031144.3TTGCTGACAGGATGCAGAAGTGATCCACATCTGCTGGAAGGAPDHNM_017008.4CTCCCATTCTTCCACCTTTGATGTAGGCCATGAGGTCCACHPRTNM_012583.2TTGCTGGTGAAAAGGACCTCTCCACTTTCGCTGATGACACCERTNM_005713.2ATAGAGGAACAGTCACAGAGTGCTGTACCATCTCTTCAACCTTTTGGPBPNM_005713.2ATGTCCACAGATTCAGCTCCCCTTCTTCTACAACCAGCTGCCLass1NM_001044230.2CTTCTTCAACACTCTGCTGCTGTCTTCCAGTTCACGCATCTCGLass2NM_001033700GCCTTTGACTCCCTGACTTCAGGGGTAGGGTGAGGGCATGTALass3NM_001127561CTGGCTTCCTCCGACAATAAAGGTGTGGCAACAAACTTTTCAAALass4NM_001107117GTGGCTGTGGCAGGAGACATAGCAAGGCCACGAATCTCTCAALass5NM_001108993GGATGCTGTTCGAGCGATTTACATCCCAGTCCAGTTGCTTTGALass6XM_345363CAGCGACACAGGAGTGGACAACGCACCATGAAGATGCAGAAnSMase1NM_031360.2TCAGGAAGACCCTTGCTCTGGACAGCCCCAAAATCATCACnSMase2NM_053605TGAAAACATTATTGAGCCTTGCCTTTGCCACAGCCAATGTCaSMaseNM_001006997.1TGACTCTAAGGGATGGAAGCCAAAAGAGGGTGGAGAAGGGGSMS1NM_181386.2GGTATCACACGATGGCCAATGATCGAGGTACAATCCCTTGGSMS2DQ071571ACATCCAGATTTCCATGCCCAAGAGAGCGTACACAAAGGCSphK1NM_001270811.1AAACCCCTATGTAGCCTCCCTAGTGACCTGCTCGTGCCSph1PPNM_001191811.1CACGTTACCCTTAGCTATCCCCAACATCCCTATGACGACCC Open table in a new tab Frozen brain hemispheres were collected at 6 and 12 h after the fetal asphyctic insult and 2 h, 6 h, and 7 days after birth and homogenized in CelLytic MT Mammalian Tissue Lysis/Extraction reagent (Sigma-Aldrich, St. Louis, MO). The samples were then centrifuged at 15,000 g for 10 min. The protein-containing supernatants were collected and the concentration of total protein was measured by Bradford, using BSA as a standard (18Xu S.S. Yan C.L. Liu L.M. Zeng Q.L. Effects of different cell lysis buffers on protein quantification.Zhejiang Da Xue Xue Bao Yi Xue Ban. 2008; 37: 45-50PubMed Google Scholar). Equal amounts of total protein (30 μg) from each sample were separated using 10% SDS-PAGE gels and transferred onto a nitrocellulose membrane (Millipore, Amsterdam, The Netherlands). Blocking was performed with 5% BSA. Next, the membranes were incubated overnight at 4°C using rabbit polyclonal anti-GPBP/CERT (1:5,000 dilution, epitope 1-50 of human GPBP; Bethyl Laboratories, Montgomery, TX) (19Mencarelli C. Hammels C. Van Den Broeck J. Losen M. Steinbusch H. Revert F. Saus J. Hopkins D.A. De Baets M.H. Steinbusch H.W. et al.The expression of the Goodpasture antigen-binding protein (ceramide transporter) in adult rat brain.J. Chem. Neuroanat. 2009; 38: 97-105Crossref PubMed Scopus (9) Google Scholar) and with monoclonal mouse anti-rabbit GAPDH (1:2,000,000 dilution; Fitzgerald Industries, Concord, MA) as a loading control. After PBS washes, membranes were incubated with goat anti-rabbit-Alexa IRDye800CW (1:10,000 dilution; LI-COR Biosciences, Lincoln, NE) and donkey anti-mouse IRDye680DX conjugated (1:10,000 dilution; Rockland Immunochemicals, Gilbertsville, PA) for 1 h at room temperature. Targeted proteins were analyzed using the LICOR Odyssey scanner (Li-Cor Bioscience, Westburg, Leusden, The Netherlands) and ImageJ software (National Institutes of Health, Bethesda, MD). Sphingolipid levels were determined at 6 and 12 h after the fetal asphyctic insult and 2 h, 6 h, and 7 days after birth. Brain pieces were homogenized using a Zymo Research bead beater for 2 × 20 s at 6 m/s in water yielding a 250 mg/ml tissue homogenate. Glycosphingolipid content was determined as previously described (20Groener J.E. Poorthuis B.J. Kuiper S. Helmond M.T. Hollak C.E. Aerts J.M. HPLC for simultaneous quantification of total ceramide, glucosylceramide, and ceramide trihexoside concentrations in plasma.Clin. Chem. 2007; 53: 742-747Crossref PubMed Scopus (88) Google Scholar) with slight modifications. Briefly, 50 μl of brain homogenate was extracted with 600 μl of CHCl3/methanol 1/2 (v/v). The extract was centrifuged for 10 min at 13,200 rpm and the pellet discarded. Five hundred and ten microliters of CHCl3/MQ-H2O 1/1.3 (v/v) was added, mixed, and centrifuged for 3 min at 13,200 rpm to separate the phases. The lower phase was collected and the upper phase reextracted with 400 μl of CHCl3. The combined lower phases were dried under N2 flow, taken up in 500 μl of freshly prepared 0.1 M NaOH in methanol, and deacylated in a microwave (SAM-155, CEM Corp.) for 60 min. Fifty microliters of this solution was derivatized with 25 μl ortho-phthalaldehyde (OPA) reagent. The OPA-derivatized lipids were separated by HPLC and quantified as previously described, using C17 sphinganine as an internal standard (Avanti Polar Lipids, Alabaster, AL) (20Groener J.E. Poorthuis B.J. Kuiper S. Helmond M.T. Hollak C.E. Aerts J.M. HPLC for simultaneous quantification of total ceramide, glucosylceramide, and ceramide trihexoside concentrations in plasma.Clin. Chem. 2007; 53: 742-747Crossref PubMed Scopus (88) Google Scholar). Sphingomyelin content was determined by incubating the samples with 125 mU of sphingomyelinase from Bacillus cereus (Sigma-Aldrich, St. Louis, MO) for 1 h at 37°C. The samples were then extracted as previously described (20), glycosphingolipids and sphingomyelin levels where calculated by subtracting the ceramide levels from treated and nontreated samples. At 72 h after fetal asphyxia, brains were collected for fluorescence-activated cell sorting (FACS) analysis. Total brains were placed in ice-cold plating medium consisting of DMEM supplemented with 10% fetal bovine serum (FBS), penicilline/streptavidine, and glutamate. The tissue was mechanically disrupted using a glass homogenizer. The cell suspension was centrifuged and the pellet was resuspended in 5 ml of plating medium. The crude cell suspension was then passed through a 100 μm nylon cell strainer to remove large cell clumps. Next, cells numbers were counted using a Bürker's chamber and divided into different Eppendorf tubes (106 cells/0.5 ml per tube). The viability of the cells was monitored using trypan blue (21Gavilanes A.W. Strackx E. Kramer B.W. Gantert M. Van den Hove D. Steinbusch H. Garnier Y. Cornips E. Steinbusch H. Zimmermann L. et al.Chorioamnionitis induced by intraamniotic lipopolysaccharide resulted in an interval-dependent increase in central nervous system injury in the fetal sheep.. 2009; 200: e1-e8Google Scholar). Apoptotic and necrotic cells were detected with AnnexinV conjugated to FITC and propidium iodide. The staining was executed according to the manufacturer's instructions (AnnexinV-FITC Apoptosis Detection Kit; BD Biosciences Pharmingen, Breda, The Netherlands). To identify different cell types, extracellular staining for OX42 (microglia) and intracellular staining for GFAP (astroglia), CNPase (oligodendrocytes), and NF-200 (neurons) was performed. Shortly, the cells were washed with staining buffer (PBS + 2% FBS). After washing, cells were incubated for 30 min at room temperature with the primary antibody: mouse anti-rat CD11b/c (clone OX42, BD Pharmingen, 1:100 dilution). The cells were washed twice followed by incubation with the secondary antibody (donkey anti-mouse alexa 488, 1:100 dilution). For intracellular staining, cells were fixed with 4% paraformaldehyde in staining buffer for 20 min at room temperature. Permeabilization was done after two more washing steps with permeabilization buffer (0.05% saponin + 2% FBS + PBS) for 10 min at room temperature. The cell suspension was then incubated with the primary antibody for 30 or 45 min at room temperature: mouse anti-ovine CNPase (Clone 11-5B, 1:200 dilution; Sigma-Aldrich), rabbit anti-ovine GFAP (1:200 dilution; DAKO, Heverlee Belgium), and mouse anti-NF-200 (1:100 dilution; Abcam, Cambridge, UK). After two washing steps, the cell suspension was incubated with the secondary antibody (donkey anti-mouse or donkey anti-rabbit alexa 488, 1:100 dilution) for 30 min at room temperature. Finally, all samples were washed and kept at 4°C in the dark until analysis. All samples were measured on a FACScalibur flow cytometry system (BD Biosciences, Breda, The Netherlands) equipped with an argon ion laser (488 nm). Analysis was done using the Cell Quest Pro software (BD Biosciences). Forward and sideward light angle scatters were collected from all samples. Samples were gated (R1) to exclude cell debris and cellular aggregates for further analysis. For each marker, the mean fluorescence intensity and the percentage of positive cells stained above background were measured for a total of 10,000 cells per sample within the gate (R1). The cut off was defined using control tissue negative for the different markers processed and stained alongside the experimental samples. The mean fluorescence intensity was corrected for autofluorescence using the values from cells only incubated with secondary antibody. All results were expressed as mean + SEM. Statistical analyses were conducted using GraphPad Prism software. Normality was tested using the Kolmogorov-Smirnov test. All results were normally distributed. Comparisons between control and fetal asphyctic animals were analyzed using unpaired t-test, one-way ANOVA, or two-way ANOVA with Bonferroni post hoc test. P < 0.05 was considered statistically significant. A global fetal asphyctic preconditioning stimulus induces neuroprotection by lowering the amount of apoptotic cell death in PA animals (10Strackx E. Zoer B. Van den Hove D. Steinbusch H. Blanco C. Vles J.S. Villamor E. Gavilanes A.W. Brain apoptosis and carotid artery reactivity in fetal asphyctic preconditioning.Front. Biosci. (Schol. Ed.). 2010; 2: 781-790Crossref PubMed Scopus (17) Google Scholar) preserving both locomotor activity and cognitive function (9Strackx E. Van den Hove D.L. Prickaerts J. Zimmermann L. Steinbusch H.W. Blanco C.E. Gavilanes A.W. Vles J.S. Fetal asphyctic preconditioning protects against perinatal asphyxia-induced behavioral consequences in adulthood.Behav. Brain Res. 2010; 208: 343-351Crossref PubMed Scopus (32) Google Scholar). Because ceramide is an important regulator of cell growth and apoptosis (22Mencarelli C. Martinez-Martinez P. Ceramide function in the brain: when a slight tilt is enough.Cell. Mol. Life Sci. 2013; 70: 181-203Crossref PubMed Scopus (153) Google Scholar), we studied the acute effect of fetal asphyxia in the ceramide signaling pathway (Fig. 2) at several prenatal and postnatal time points (Fig. 1B). To investigate whether ceramide metabolism genes change at 6 and 12 h after fetal asphyctic preconditioning, we examined by RT-PCR the expression of several enzymes involved in ceramide metabolism: Lass1 to Lass6, SMS1-2, aSMase, nSMase1-2, SphK1, and Sph1PP. We observed significant mRNA changes in ceramide synthases [the enzymes which convert sphinganine to ceramide (23Perry R.J. Ridgway N.D. Molecular mechanisms and regulation of ceramide transport.Biochim. Biophys. Acta. 2005; 1734: 220-234Crossref PubMed Scopus (86) Google Scholar)], Lass1 (P = 0.021), Lass2 (P = 0.006), and Lass5 (P = 0.016) after fetal asphyxia (Fig. 3). No significant changes were seen in mRNA levels of SMS1 and SMS2, which catalyze the formation of sphingomyelin from ceramide (11Novgorodov S.A. Gudz T.I. Ceramide and mitochondria in ischemia/reperfusion.J. Cardiovasc. Pharmacol. 2009; 53: 198-208Crossref PubMed Scopus (72) Google Scholar), nSMase1 and -2, which break down sphingomyelin to generate ceramide (24Jana A. Hogan E.L. Pahan K. Ceramide and neurodegeneration: susceptibility of neurons and oligodendrocytes to cell damage and death.J. Neurol. Sci. 2009; 278: 5-15Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar), and SphK1, which catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (Fig. 3). On the other hand, aSMase which is localized in lysosomes and regulates cellular membrane turnover (17Mencarelli C. Losen M. Hammels C. De Vry J. Hesselink M.K. Steinbusch H.W. De Baets M.H. Martinez-Martinez P. The ceramide transporter and the Goodpasture antigen binding protein: one protein–one function?.J. Neurochem. 2010; 113: 1369-1386PubMed Google Scholar), and Sph1PP involved in regulating levels of sphingosine-1-phosphate (25Johnson K.R. Johnson K.Y. Becker K.P. Bielawski J. Mao C. Obeid L.M. Role of human sphingosine-1-phosphate phosphatase 1 in the regulation of intra- and extracellular sphingosine-1-phosphate levels and cell viability.J. Biol. Chem. 2003; 278: 34541-34547Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar) were increased after fetal asphyxia compared with untreated controls (aSMase, P = 0.002; Sph1PP, P = 0.039) (Fig. 3). Once generated in the endoplasmatic reticulum (ER), ceramide must be transported by CERT/GPBP to the Golgi apparatus in order to be converted to more complex sphingolipids (17Mencarelli C. Losen M. Hammels C. De Vry J. Hesselink M.K. Steinbusch H.W. De Baets M.H. Martinez-Martinez P. The ceramide transporter and the Goodpasture antigen binding protein: one protein–one function?.J. Neurochem. 2010; 113: 1369-1386PubMed Google Scholar). Fetal asphyxia significantly increased CERT/GPBP mRNA synthesis (P = 0.045), however, we found CERT/GPBP protein levels reduced after fetal asphyxia (P = 0.033) (Fig. 3, bottom right). This suggests that the increased mRNA synthesis of CERT/GPBP is a compensatory response caused by a reduction in CERT/GPBP protein levels, probably to increase ceramide transport for the production of sphingomyelin. Using HPLC, we investigated whether the changes in ceramide enzymes lead to changes in ceramide and ceramide metabolite levels. Ceramide and sphingomyelin levels were unaffected shortly after fetal asphyxia (data not shown), suggesting that this phase is mainly characterized by alterations at transcriptional level. We investigated if fetal asphyxia could also acutely affect other genes involved in lipid metabolism. We studied OSBP1, a member of a family of sterol-binding proteins, with structural homology to GPBP/CERT (17Mencarelli C. Losen M. Hammels C. De Vry J. Hesselink M.K. Steinbusch H.W. De Baets M.H. Martinez-Martinez P. The ceramide transporter and the Goodpasture antigen binding protein: one protein–one function?.J. Neurochem. 2010; 113: 1369-1386PubMed Google Scholar). We found a significant increase in OSBP1 mRNA levels 6 h after fetal asphyxia compared with controls (P < 0.001) (Fig. 4). However, there was no significant increase in OSBP1 mRNA levels at 12 h after fetal asphyxia compared with controls (P > 0.05). The on-off effect of fetal asphyxia on OSBP1 mRNA levels is in marked contrast to the long-lasting effects of fetal asphyxia on some ceramide metabolism genes which remained affected 12 h after fetal asphyxia (Fig. 3). Growing evidence indicates a signaling role for ceramide in asphyxia-induced apoptosis (26Chen Y. Ginis I. Hallenbeck J.M. The protective effect of ceramide in immature rat brain hypoxia-ischemia involves up-regulation of bcl-2 and reduction of TUNEL-positive cells.J. Cereb. Blood Flow Metab. 2001; 21: 34-40Crossref PubMed Scopus (63) Google Scholar, 27Feng Y. LeBlanc M.H. N-tosyl-L-phenylalanyl-chloromethyl ketone reduces ceramide during hypoxic-ischemic brain injury in newborn rat.Eur. J. Pharmacol. 2006; 551: 34-40Crossref PubMed Scopus (7) Google Scholar). To determine the effects of ceramide changes on apoptotic levels, we quantified the amount of live apoptotic and necrotic cells in total brain of control versus fetal asphyctic animals by FACS analysis at 72 h post-fetal asphyxia. Figure 5A shows that although approximately 35% of the cells undergo apoptosis (due to normal development and the used methodology), the amount of live cells decreased after fetal asphyxia (unpaired t-test, P < 0.001) due to increased apoptosis (unpaired t-test, P = 0.002) but not necrosis, and that neurons contribute most to this increase in apoptosis (unpaired t-test, P = 0.04) (Fig. 5B). Moreover, the asphyctic brain has larger numbers of astrocytes than the control brain (unpaired t-test, P = 0.005) (Fig. 5B). In conclusion, fetal asphyxia induces increased numbers of apoptotic cells, less neurons, and more astrocytes. To investigate whether the changes in ceramide metabolism after sublethal fetal asphyxia would persist after birth, we assessed ceramide synthesis 2 h, 6 h, and 7 days after birth (Fig. 1B) in fetal asphyxia-subjected animals and controls. At all postnatal time points, ceramide levels were increased after fetal asphyxia (P < 0.0005) (Fig. 6A). Sphingomyelin levels were also increased after fetal asphyxia (P < 0.02) (Fig. 6B). Because the recovered ceramide and sphingomyelin amounts in our rat brain samples were relatively low compared with similar sphingolipids recovered from adult mouse brain (28Lee S. Lee Y.S. Choi K.M. Yoo K.S. Sin D.M. Kim W. Lee Y.M. Hong J.T. Yun Y.P. Yoo H.S. Quantitative analysis of sphingomyelin by high-performance liquid chromatography after enzymatic hydrolysis.Evid. Based Complement. Alternat. Me
Referência(s)