A cluster of eight hydroxysteroid dehydrogenase genes belonging to the aldo-keto reductase supergene family on mouse chromosome 13
2003; Elsevier BV; Volume: 44; Issue: 3 Linguagem: Inglês
10.1194/jlr.m200399-jlr200
ISSN1539-7262
AutoresLaurent Vergnes, Jack Phan, Andrew Stolz, Karen Reue,
Tópico(s)Plant Toxicity and Pharmacological Properties
ResumoA subclass of hydroxysteroid dehydrogenases (HSD) are NADP(H)-dependent oxidoreductases that belong to the aldo-keto reductase (AKR) superfamily. They are involved in prereceptor or intracrine steroid modulation, and also act as bile acid-binding proteins. The HSD family members characterized thus far in human and rat have a high degree of protein sequence similarity but exhibit distinct substrate specificity. Here we report the identification of nine murine AKR genes in a cluster on chromosome 13 by a combination of molecular cloning and in silico analysis of this region. These include four previously isolated mouse HSD genes (Akr1c18, Akr1c6, Akr1c12, Akr1c13), the more distantly related Akr1e1, and four novel HSD genes. These genes exhibit highly conserved exon/intron organization and protein sequence predictions indicate 75% amino acid similarity. The previously identified AKR protein active site residues are invariant among all nine proteins, but differences are observed in regions that have been implicated in determining substrate specificity. Differences also occur in tissue expression patterns, with expression of some genes restricted to specific tissues and others expressed at high levels in multiple tissues.Our findings dramatically expand the repertoire of AKR genes and identify unrecognized family members with potential roles in the regulation of steroid metabolism. A subclass of hydroxysteroid dehydrogenases (HSD) are NADP(H)-dependent oxidoreductases that belong to the aldo-keto reductase (AKR) superfamily. They are involved in prereceptor or intracrine steroid modulation, and also act as bile acid-binding proteins. The HSD family members characterized thus far in human and rat have a high degree of protein sequence similarity but exhibit distinct substrate specificity. Here we report the identification of nine murine AKR genes in a cluster on chromosome 13 by a combination of molecular cloning and in silico analysis of this region. These include four previously isolated mouse HSD genes (Akr1c18, Akr1c6, Akr1c12, Akr1c13), the more distantly related Akr1e1, and four novel HSD genes. These genes exhibit highly conserved exon/intron organization and protein sequence predictions indicate 75% amino acid similarity. The previously identified AKR protein active site residues are invariant among all nine proteins, but differences are observed in regions that have been implicated in determining substrate specificity. Differences also occur in tissue expression patterns, with expression of some genes restricted to specific tissues and others expressed at high levels in multiple tissues. Our findings dramatically expand the repertoire of AKR genes and identify unrecognized family members with potential roles in the regulation of steroid metabolism. Aldo-keto reductases (AKRs) represent a superfamily of monomeric oxidoreductases that catalyze the NADP(H)-dependent reduction of a wide variety of substrates (1Penning T.M. Molecular endocrinology of hydroxysteroid dehydrogenases.Endocr. Rev. 1997; 18: 281-305Google Scholar, 2Jez J.M. Flynn T.G. Penning T.M. A new nomenclature for the aldo-keto reductase superfamily.Biochem. Pharmacol. 1997; 54: 639-647Google Scholar). These include simple carbohydrates, steroid hormones, endogenous prostaglandins, and other aliphatic aldehydes and ketones, as well as many xenobiotic compounds. The identification of AKRs in vertebrates, plants, protozoa, fungi, eubacteria, and archaebacteria suggests that this is an ancient superfamily of enzymes (3Seery L.T. Nestor P.V. Fitzgerald G.A. Molecular evolution of the aldo-keto reductase gene superfamily.J. Mol. Evol. 1998; 46: 139-146Google Scholar). Currently there are more than a hundred known AKR proteins classified into 12 families (4Jez J.M. Penning T.M. The aldo-keto reductase (AKR) superfamily: an update.Chem. Biol. Interact. 2001; 130–132: 499-525Google Scholar) (www.med.upenn.edu/akr). The largest family, AKR1, can be broadly subdivided into the aldose reductase, aldehyde reductase, and hydroxysteroid dehydrogenase (HSD) subfamilies. The aldehyde reductase and aldose reductase subfamilies have been studied most extensively, with aldose reductase proteins being implicated in ocular lens development (5Van Boekel M.A. Van Aalten D.M. Caspers G.J. Roll B. De Jong W.W. Evolution of the aldose reductase-related gecko eye lens protein rhoB-crystallin: a sheep in wolf's clothing.J. Mol. Evol. 2001; 52: 239-248Google Scholar) and in the neurological complications of diabetes (6Yabe-Nishimura C. Aldose reductase in glucose toxicity: a potential target for the prevention of diabetic complications.Pharmacol. Rev. 1998; 50: 21-33Google Scholar). Recent attention, however, has focused on the HSD subfamily members (AKR1C) because of their selective metabolism of essential steroid hormones as well as their implicated role in xenobiotic metabolism (1Penning T.M. Molecular endocrinology of hydroxysteroid dehydrogenases.Endocr. Rev. 1997; 18: 281-305Google Scholar, 2Jez J.M. Flynn T.G. Penning T.M. A new nomenclature for the aldo-keto reductase superfamily.Biochem. Pharmacol. 1997; 54: 639-647Google Scholar). Notable examples include the 3α-HSD isoenzymes, 20α-HSD, and 17β-HSD type V. 3α-HSD catalyses the inactivation of androgens by converting 5α-dihydrotestosterone to 3α-androstanediol, where excess 5α-dihydrotestosterone has been implicated in prostate disease (1Penning T.M. Molecular endocrinology of hydroxysteroid dehydrogenases.Endocr. Rev. 1997; 18: 281-305Google Scholar, 7Lin H.K. Jez J.M. Schlegel B.P. Peehl D.M. Pachter J.A. Penning T.M. Expression and characterization of recombinant type 2 3 α-hydroxysteroid dehydrogenase (HSD) from human prostate: demonstration of bifunctional 3 α/17 β-HSD activity and cellular distribution.Mol. Endocrinol. 1997; 11: 1971-1984Google Scholar, 8Ross R.K. Pike M.C. Coetzee G.A. Reichardt J.K. Yu M.C. Feigelson H. Stanczyk F.Z. Kolonel L.N. Henderson B.E. Androgen metabolism and prostate cancer: establishing a model of genetic susceptibility.Cancer Res. 1998; 58: 4497-4504Google Scholar). 20α-HSD catalyses the reduction of progesterone to its inactive metabolite 20α-hydroxyprogesterone and plays an important role in the termination of pregnancy and initiation of parturition by reduction of progesterone levels in the serum and placenta (1Penning T.M. Molecular endocrinology of hydroxysteroid dehydrogenases.Endocr. Rev. 1997; 18: 281-305Google Scholar, 9Lenton E.A. Woodward A.J. The endocrinology of conception cycles and implantation in women.J. Reprod. Fertil. Suppl. 1988; 36: 1-15Google Scholar, 10Mao J. Duan R.W. Zhong L. Gibori G. Azhar S. Expression, purification and characterization of the rat luteal 20 alpha-hydroxysteroid dehydrogenase.Endocrinology. 1997; 138: 182-190Google Scholar). 17β-HSD type V catalyses the conversion of 4-androstenedione into testosterone (1Penning T.M. Molecular endocrinology of hydroxysteroid dehydrogenases.Endocr. Rev. 1997; 18: 281-305Google Scholar, 11Rheault P. Charbonneau A. Luu-The V. Structure and activity of the murine type 5 17beta-hydroxysteroid dehydrogenase gene(1).Biochim. Biophys. Acta. 1999; 1447: 17-24Google Scholar). Thus, HSDs may regulate intracellular levels of steroid hormones, and are potential therapeutic targets for modulating the activation of steroid-hormone receptors. Currently, there are four recognized human HSD proteins and one known rat 3α-HSD, all of which have been classified in the AKR1C family. These five AKR1C members possess 3α-HSD activity but also exhibit distinct specificity toward other substrates (1Penning T.M. Molecular endocrinology of hydroxysteroid dehydrogenases.Endocr. Rev. 1997; 18: 281-305Google Scholar, 12Penning T.M. Burczynski M.E. Jez J.M. Hung C.F. Lin H.K. Ma H. Moore M. Palackal N. Ratnam K. Human 3α-hydroxysteroid dehydrogenase isoforms (AKR1C1–AKR1C4) of the aldo-keto reductase superfamily: functional plasticity and tissue distribution reveals roles in the inactivation and formation of male and female sex hormones.Biochem. J. 2000; 351: 67-77Google Scholar, 13Dufort I. Labrie F. Luu-The V. Human types 1 and 3 3 α-hydroxysteroid dehydrogenases: differential lability and tissue distribution.J. Clin. Endocrinol. Metab. 2001; 86: 841-846Google Scholar, 14Hara A. Taniguchi H. Nakayama T. Sawada H. Purification and properties of multiple forms of dihydrodiol dehydrogenase from human liver.J. Biochem. (Tokyo). 1990; 108: 250-254Google Scholar). Human AKR1C1 (20α-HSD) (13Dufort I. Labrie F. Luu-The V. Human types 1 and 3 3 α-hydroxysteroid dehydrogenases: differential lability and tissue distribution.J. Clin. Endocrinol. Metab. 2001; 86: 841-846Google Scholar), AKR1C2 (3α-HSD type III, also known as human bile acid binding protein) (15Dufort I. Soucy P. Labrie F. Luu-The V. Molecular cloning of human type 3 3 α-hydroxysteroid dehydrogenase that differs from 20 α-hydroxysteroid dehydrogenase by seven amino acids.Biochem. Biophys. Res. Commun. 1996; 228: 474-479Google Scholar, 16Stolz A. Sugiyama Y. Kuhlenkamp J. Kaplowitz N. Identification and purification of a 36 kDa bile acid binder in human hepatic cytosol.FEBS Lett. 1984; 177: 31-35Google Scholar), AKR1C3 (17β-HSD type V, also recognized as prostaglandin D2 11-ketoreductase) (17Matsuura K. Shiraishi H. Hara A. Sato K. Deyashiki Y. Ninomiya M. Sakai S. Identification of a principal mRNA species for human 3α-hydroxysteroid dehydrogenase isoform (AKR1C3) that exhibits high prostaglandin D2 11-ketoreductase activity.J. Biochem. (Tokyo). 1998; 124: 940-946Google Scholar), and AKR1C4 (3α-HSD type I, also referred to as dihydrodiol dehydrogenase 4) share more than 83% DNA sequence homology and are clustered on chromosome 10p15 (18Lou H. Hammond L. Sharma V. Sparkes R.S. Lusis A.J. Stolz A. Genomic organization and chromosomal localization of a novel human hepatic dihydrodiol dehydrogenase with high affinity bile acid binding.J. Biol. Chem. 1994; 269: 8416-8422Google Scholar, 19Stolz A. Hammond L. Lou H. Takikawa H. Ronk M. Shively J.E. cDNA cloning and expression of the human hepatic bile acid-binding protein. A member of the monomeric reductase gene family.J. Biol. Chem. 1993; 268: 10448-10457Google Scholar, 20Khanna M. Qin K.N. Klisak I. Belkin S. Sparkes R.S. Cheng K.C. Localization of multiple human dihydrodiol dehydrogenase (DDH1 and DDH2) and chlordecone reductase (CHDR) genes in chromosome 10 by the polymerase chain reaction and fluorescence in situ hybridization.Genomics. 1995; 25: 588-590Google Scholar, 21Nishizawa M. Nakajima T. Yasuda K. Kanzaki H. Sasaguri Y. Watanabe K. Ito S. Close kinship of human 20α-hydroxysteroid dehydrogenase gene with three aldo-keto reductase genes.Genes Cells. 2000; 5: 111-125Google Scholar). AKR1C4 may be particularly important in steroid catabolism due to its selective expression in the liver and its kinetic features (12Penning T.M. Burczynski M.E. Jez J.M. Hung C.F. Lin H.K. Ma H. Moore M. Palackal N. Ratnam K. Human 3α-hydroxysteroid dehydrogenase isoforms (AKR1C1–AKR1C4) of the aldo-keto reductase superfamily: functional plasticity and tissue distribution reveals roles in the inactivation and formation of male and female sex hormones.Biochem. J. 2000; 351: 67-77Google Scholar, 13Dufort I. Labrie F. Luu-The V. Human types 1 and 3 3 α-hydroxysteroid dehydrogenases: differential lability and tissue distribution.J. Clin. Endocrinol. Metab. 2001; 86: 841-846Google Scholar), whereas the other members are widely expressed in other tissues. AKR1C2 may have two distinct functions, depending on its site of expression. In the liver, its distinct, high affinity bile acid binding affinity suggests a role in bile acid transport along with steroid metabolism, while in other tissues it may modulate androgen activity. In rat liver, a single rat 3α-HSD (AKR1C9) is expressed, which has a role in synthesis of primary bile acids from cholesterol as well as sequestration of bile acids within the cytosol (22Sugiyama Y. Yamada T. Kaplowitz N. Newly identified bile acid binders in rat liver cytosol. Purification and comparison with glutathione S-transferases.J. Biol. Chem. 1983; 258: 3602-3607Google Scholar, 23Stolz A. Hammond L. Lou H. Rat and human bile acid binders are members of the monomeric reductase gene family.Adv. Exp. Med. Biol. 1995; 372: 269-280Google Scholar, 24Stolz A. Takikawa H. Sugiyama Y. Kuhlenkamp J. Kaplowitz N. 3 α-hydroxysteroid dehydrogenase activity of the Y' bile acid binders in rat liver cytosol. Identification, kinetics, and physiologic significance.J. Clin. Invest. 1987; 79: 427-434Google Scholar, 25Takikawa H. Stolz A. Kuroki S. Kaplowitz N. Oxidation and reduction of bile acid precursors by rat hepatic 3 alpha-hydroxysteroid dehydrogenase and inhibition by bile acids and indomethacin.Biochim. Biophys. Acta. 1990; 1043: 153-156Google Scholar). Structural analysis of these mammalian HSDs has revealed highly conserved amino acid sequences and a three-dimensional structure consisting of an 8-chain α/β barrel (26Nahoum V. Gangloff A. Legrand P. Zhu D.W. Cantin L. Zhorov B. Luu-The V. Labrie F. Breton R. Lin S.X. Structure of the human 3α-HSD type 3 in complex with testosterone and NADP at 1.25 A resolution.J. Biol. Chem. 2001; 276: 42091-42098Google Scholar, 27Bennett M.J. Albert R.H. Jez J.M. Ma H. Penning T.M. Lewis M. Steroid recognition and regulation of hormone action: crystal structure of testosterone and NADP+ bound to 3 α-hydroxysteroid/dihydrodiol dehydrogenase.Structure. 1997; 5: 799-812Google Scholar). However, significant amino acid sequence divergence does occur in the carboxyl terminus of the specific HSD proteins, which is responsible, in part, for the observed differences in substrate specificity. In mouse, four distinct HSDs belonging to the AKR1C protein subfamily have been identified: 20α-HSD (AKR1C18) (28Ishida M. Chang K.T. Hirabayashi I. Nishihara M. Tkahashi M. Cloning of mouse 20α−Hydroxysteroid Dehydrogenase cDNA and its mRNA localization during pregnancy.J. Reprod. Dev. 1999; 45: 321-329Google Scholar), 17β-HSD type V (AKR1C6) (29Deyashiki Y. Ohshima K. Nakanishi M. Sato K. Matsuura K. Hara A. Molecular cloning and characterization of mouse estradiol 17 β-dehydrogenase (A-specific), a member of the aldoketoreductase family.J. Biol. Chem. 1995; 270: 10461-10467Google Scholar), AKRa (AKR1C12), and AKR1C13 (30Du Y. Tsai S. Keller J.R. Williams S.C. Identification of an interleukin-3-regulated aldoketo reductase gene in myeloid cells which may function in autocrine regulation of myelopoiesis.J. Biol. Chem. 2000; 275: 6724-6732Google Scholar, 31Ikeda S. Okuda-Ashitaka E. Masu Y. Suzuki T. Watanabe K. Nakao M. Shingu K. Ito S. Cloning and characterization of two novel aldo-keto reductases (AKR1C12 and AKR1C13) from mouse stomach.FEBS Lett. 1999; 459: 433-437Google Scholar). An additional member of the AKR superfamily, AKR1E1, has also been previously identified in mouse (32Bohren K.M. Barski O.A. Gabbay K.H. Characterization of a novel murine aldo-keto reductase.Adv. Exp. Med. Biol. 1997; 414: 455-464Google Scholar). The genomic clustering of the four human HSDs suggests that these genes arose from ancient duplication events followed by divergence, and predicts that a similar genomic organization may also be present in mouse. Furthermore, the high sequence similarity among known AKR family members raises the possibility that additional, unidentified family members may also exist. Using a combination of molecular cloning and bioinformatic analysis of available mouse genome sequence, we identified a total of nine mouse AKR gene family members in a cluster on chromosome 13. These include the four previously identified mouse HSD genes described above, four novel HSD genes, and the previously identified murine aldose reductase gene, Akr1e1. Gene structure is highly conserved among family members, and protein sequence predictions indicate ∼75% amino acid similarity. Gene specific expression studies in a panel of mouse tissues revealed that some members are highly tissue specific, while others are expressed in a wide range of tissues. These results indicate that the murine HSD family has at least twice as many genes as previously thought, and the observed differences in tissue distribution and protein sequences imply that members have diverged to catalyze discrete biochemical and metabolic functions. All chemicals were of molecular biology grade or higher and were purchased from Sigma (St. Louis, MO) unless otherwise stated. Molecular biology reagents were purchased from Promega (Madison, WI), Roche Molecular Biochemicals (Indianapolis, IN), and Life Technologies (Gaithersburg, MD). Strategene® Mouse liver cDNA ZAP library # 935302 B6CBA (C57BL/6 × CBA) constructed from a 6 to 8 weeks old female liver was screened at reduced stringency with 32P random labeled partial cDNA from either rat 3α-HSD (AKR1C9) or human 20α-HSD (AKR1C1) as described, and individual clones purified to homogeneity by sequential library screening (19Stolz A. Hammond L. Lou H. Takikawa H. Ronk M. Shively J.E. cDNA cloning and expression of the human hepatic bile acid-binding protein. A member of the monomeric reductase gene family.J. Biol. Chem. 1993; 268: 10448-10457Google Scholar, 33Stolz A. Rahimi-Kiani M. Ameis D. Chan E. Ronk M. Shively J.E. Molecular structure of rat hepatic 3 α-hydroxysteroid dehydrogenase. A member of the oxidoreductase gene family.J. Biol. Chem. 1991; 266: 15253-15257Google Scholar). Each clone was sequenced in both orientations and analyzed using MacVector 6.1. For clones lacking the complete coding region, amplification of the missing 5′ region was performed by RACE and multiple clones were analyzed to verify the sequence (34Skinner T.L. Kerns R.T. Bender P.K. Three different calmodulin-encoding cDNAs isolated by a modified 5′-RACE using degenerate oligodeoxyribonucleotides.Gene. 1994; 151: 247-251Google Scholar). The genes later identified as AKR1C13, AKR1C14, and AKR1C19 were mapped in a mouse-hamster radiation hybrid panel (Research Genetics, Huntsville, AL) via PCR using oligonucleotide primers derived from unique sequences within the 3′ portion of the cDNA sequence. Primers were as follows: Akr1c19-f 5′-GAGACCTGTGTCATGACTTCTAC-3′, Akr1c19-r 5′-GACTGGTGGACACAGCTCTGG-3′; Akr1c13-f 5′-TGCTGACCACCCAGAGTATCCA-3′, Akr1c13-r 5′-GTCACATCACCAGCATTATGG-3′; Akr1c14-f 5′-GATGACCATCCCAATCATCCA-3′, Akr1c14-r 5′-GGATGTGTTCAGTCACCAGT-3′. Touchdown temperature cycling was used (35Don R.H. Cox P.T. Wainwright B.J. Baker K. Mattick J.S. 'Touchdown' PCR to circumvent spurious priming during gene amplification.Nucleic Acids Res. 1991; 194008Google Scholar), and products were resolved on 4% Metaphor agarose gels. Data were analyzed using Auto-RHMAPPER, available though the Whitehead Institute/MIT Center for Genome Research (genome.wi.mit.edu/mouse_rh/index.html) (36Van Etten W.J. Steen R.G. Nguyen H. Castle A.B. Slonim D.K. Ge B. Nusbaum C. Schuler G.D. Lander E.S. Hudson T.J. Radiation hybrid map of the mouse genome.Nat. Genet. 1999; 22: 384-387Google Scholar). AKR gene sequences were identified by using the NCBI Mouse Genome Assembly (www.ncbi.nlm.nih.gov/genome/guide/mouse) and Celera Discovery System (Celera, Rockville, MD). Specifically, we examined these mouse genome databases in the region of chromosome 13 identified by radiation hybrid mapping as harboring AKR genes. Sequences of genes predicted within a ∼1 Mb region were carefully scrutinized by BLAST analysis against the cloned HSD family member sequences, and a total of nine genes with significant similarity to AKR sequences were detected. All HSD gene sequences were analyzed by BLAST against NCBI UniGene and EST databases to confirm that the novel genes correspond to expressed mRNA sequences. The gene sequences were aligned with corresponding cDNA sequences to determine exon/intron organization. Protein sequence predictions and analyses were performed with the LaserGene software suite (DNAStar, Inc., Madison, WI), including CLUSTALW for protein sequence alignments and MEGALIGN for construction of evolutionary dendrograms. Total RNA was extracted from C57BL/6J mouse tissues with Trizol (Invitrogen). Northern blots were prepared using 5 μg total RNA and probed with fragments of the 3′ UTR from four cloned AKR family members. These sequences had less then 60% sequence homology, allowing for selective hybridization to a single AKR family member. Probes were as follows: Akr1c6, nucleotides 876–1178 of NM_030611, Akr1c13, nucleotides 915–1184 of XM_122492, Akr1c14, nucleotides 896–1919 of XM_ 122485, and Akr1c19, nucleotides 203–422 of BU707256. RT-PCR analyses were performed with RNA extracted from C57BL/6J mouse tissues, as above, with the addition of mouse eye and prostate RNA purchased from Clontech. cDNA was prepared using 2 μg total RNA from each tissue (cDNA cycle kit, Invitrogen). One-twentieth of the resulting cDNA was used for PCR amplification. PCR was performed using a touchdown protocol (35Don R.H. Cox P.T. Wainwright B.J. Baker K. Mattick J.S. 'Touchdown' PCR to circumvent spurious priming during gene amplification.Nucleic Acids Res. 1991; 194008Google Scholar) with an initial annealing temperature of 63°C falling to 53°C over 20 cycles, followed by annealing at 53°C for an additional 8–15 cycles, depending on primer set. PCR primer sequences were derived from the 3′ UTR of each gene in regions of sequence divergence to ensure amplification of the specific AKR family member. Trial amplifications were run at various cycle numbers, and conditions selected to allow detection during the exponential phase. Primer sets are listed below: Tabled 1Gene NameForwardReverseAkr1c14caatactgcgagttattttgggatgtgttcagtcaccagtAkr1c18cggtactttcctgctgatatgagtgattggaggcggtgtgtcAkr1c13cagtgatgctggcaatatgaccttacatttatttgagatcattaatAkr1c19gagacctgtgtcatgacttctacgactggtggacacagctctggAkr1c12cataatgctggtgatgtgactctcctttttcttgaaatcatgaacAkr1c6gatacataagtggttctagctttaatactcttcctatacactcttccaAkr1c20gatacataggtagttctatttctggtatcctttctatacagtcttcccAkr1c21gctacagagaagtggcaagtctatgcgatacatacctgctgcAkr1e1acggacctgaggctgattgtgcatggcagtagggtaggtaggTbp (TATA binding protein)acccttcaccaatgactcctatgatgatgactgcagcaaatcgc Open table in a new tab An alternatively spliced mRNA for Akr1c12 was detected in liver cDNA prepared from C57BL/6ByJ and CAST/EiJ, and PCR amplified as above. Primers used were 5′-CTCAACAAGCCAGGACTGAAG-3′, and 5′-CATGTCCTCAGGGGACAACTG-3′. PCR products were electrophoresed in 2% metaphor agarose (FMC BioProducts, Rockland, Maine) to resolve alternative splice forms of 352 and 242 bp. To identify members of the HSD gene family in mouse, we initially employed a molecular cloning strategy of screening a mouse cDNA library with probes prepared from known AKR genes from rat (AKR1C9, corresponding to rat 3α-HSD) or human (AKR1C1, corresponding to human 20α-HSD). This resulted in the isolation of four different clones (data not shown), two of which corresponded to previously identified mouse genes (Akr1c6 and Akr1c13), and two of which were novel (Akr1c14 and Akr1c19). Akr1c13 and the two novel genes were mapped in a radiation hybrid panel (37Mccarthy L.C. Terrett J. Davis M.E. Knights C.J. Smith A.L. Critcher R. Schmitt K. Hudson J. Spurr N.K. Goodfellow P.N. A first-generation whole genome-radiation hybrid map spanning the mouse genome.Genome Res. 1997; 7: 1153-1161Google Scholar) and found to colocalize to the proximal tip of chromosome 13 (data not shown). This region corresponds to human chromosome 10p15, which harbors the four previously identified human HSD genes, indicating that human and mouse genomes carry syntenic clusters of AKR genes. The radiation hybrid mapping did not allow determination of the order of the mouse AKR genes on chromosome 13, indicating that these genes occur in close proximity. With the subsequent availability of mouse genome sequence, it became possible to examine the physical structure of this region. Using the BLAST tool (38Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. Basic local alignment search tool.J. Mol. Biol. 1990; 215: 403-410Google Scholar), we searched chromosome 13 sequence from the NCBI mouse genome database against the four mouse HSD gene sequences. We identified genomic sequences corresponding to the four clones we had isolated, situated within 300 kb of one another on proximal chromosome 13. Unexpectedly, within this region we detected five additional gene sequences having substantial sequence similarity to these HSD genes (Fig. 1). These genes occur in both orientations, with five genes present on the plus strand and four on the minus strand, and include the previously identified Akr1c12, Akr1c18 (20α-HSD), and Akr1e1 genes, as well as two novel HSD-related genes, provisionally named Akr1c20 and Akr1c21 (Fig. 1). Thus, within a 555 kb region, there were a total of 11 genes: nine putative HSD gene family members and two additional genes, which have no similarity to AKR family (XM_153784 and XM_153785). In addition, BLAST analysis revealed another sequence that is highly similar to HSD genes, but which appears to represent a nonexpressed gene fragment, as it was not detected in EST databases and was therefore not included in further analyses. To confirm that the novel HSD family members represent genuine expressed genes, and to determine mRNA transcript sequences for the nine AKR genes, we searched the GenBank mouse EST and Unigene databases. Unigene entries containing multiple ESTs were identified for each of the nine AKR genes, confirming that these are genuine expressed genes (Table 1). We determined gene structure of the nine AKR family members by alignment of the full length cDNA sequences with genomic sequences. As shown in Fig. 2, the nine genes have highly conserved intron/exon size and organization, although the precise size of some introns is not known due to incomplete genomic sequence in some regions. Seven of the genes consist of nine exons, as has been reported for previously characterized members of the HSD gene family (18Lou H. Hammond L. Sharma V. Sparkes R.S. Lusis A.J. Stolz A. Genomic organization and chromosomal localization of a novel human hepatic dihydrodiol dehydrogenase with high affinity bile acid binding.J. Biol. Chem. 1994; 269: 8416-8422Google Scholar, 21Nishizawa M. Nakajima T. Yasuda K. Kanzaki H. Sasaguri Y. Watanabe K. Ito S. Close kinship of human 20α-hydroxysteroid dehydrogenase gene with three aldo-keto reductase genes.Genes Cells. 2000; 5: 111-125Google Scholar, 39Rheault P. Dufort I. Soucy P. Luu-The V. Assignment of HSD17B5 encoding type 5 17 β-hydroxysteroid dehydrogenase to human chromosome bands 10p15→p14 and mouse chromosome 13 region A2 by in situ hybridization: identification of a new syntenic relationship.Cytogenet Cell Genet. 1999; 84: 241-242Google Scholar). Two of the genes contain 10 exons; Akr1c14 contains an additional 5′ noncoding exon upstream of the position of exon 1 in the other genes, while Akr1e1 has an additional exon resulting from interruption of the prototypical exon 7 to form two exons. The additional 5′ exon and the large 3′ UTR of Akr1c14 are similar to rat 3α-HSD (AKR1C9) (40Usui E. Okuda K. Kato Y. Noshiro M. Rat hepatic 3 alpha-hydroxysteroid dehydrogenase: expression of cDNA and physiological function in bile acid biosynthetic pathway.J. Biochem. (Tokyo). 1994; 115: 230-237Google Scholar). Studies by Usui implicated alternative processing of the 5′ UTR of the gene based on detection of multiple sizes of mRNA in liver as compared with kidney or ovary (40Usui E. Okuda K. Kato Y. Noshiro M. Rat hepatic 3 alpha-hydroxysteroid dehydrogenase: expression of cDNA and physiological function in bile acid biosynthetic pathway.J. Biochem. (Tokyo). 1994; 115: 230-237Google Scholar). Lin et al. characterized the genomic organization and proximal promoter of AKR1C9 and identified two distinct initial exons similar to what we observed for the genomic organization of the Akr1c14 (41Lin H.K. Hung C.F. Moore M. Penning T.M. Genomic structure of rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD, AKR1C9).J. Steroid Biochem. Mol. Biol. 1999; 71: 29-39Google Scholar). The organization of the Akr1e1 gene is similar to the genomic organization of aldose reductase (AKR1B), a subfamily within the AKR family (42Bohren K.M. Bullock B. Wermuth B. Gabbay K.H. The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases.J. Biol. Chem. 1989; 264: 9547-9551Google Scholar, 43Ferraris J.D. Williams C.K. Martin B.M. Burg M.B. Garcia-Perez A. Cloning, genomic organization, and osmotic response of the aldose reductase gene.Proc. Natl. Acad. Sci. USA. 1994; 91: 10742-10746Google Scholar).TABLE 1Nine mouse AKR genes analyzed in this studyTypeNameUnigeneAccession NoAkr1c617β-HSD type 5Mm.196666NM_030611Akr1c12AKRaMm.89993XM_127199Akr1c13Mm.27447XM_122492Akr1c14Mm.26838XM_122485Akr1c1820α-HSDMm.41337XM_122486Akr1c19Mm.22832XM_138403Akr1c20Mm.37605BC021607Akr1c21aProvisional assignment.Mm.27085NM_029901Akr1e1Mm.141365XM_122491a Provisional assignment. Open table in a new tab Protein alignments were produced using the predicted amino acid sequences to identify conserved regions (Fig. 3). The predicted protein sequences for the nine full-length AKR genes were highly conserved and contained stretches of identical residues. Except for AKR1E1, all consist of 323 amino acids, with an overall 75% similarity and 45% identity. Based on the 3-dimensional structure of AKR members, catalytic and substrate-binding sites have been proposed (2Jez J.M. Flynn T.G. Penning T.M. A new nomenclature for the aldo-keto reductase superfamily.Biochem. Pharmacol. 1997; 54: 639-647Google Scholar, 27Bennett M.J. Albert R.H. Jez J.M. Ma
Referência(s)