The Human WASP-interacting Protein, WIP, Activates the Cell Polarity Pathway in Yeast
1999; Elsevier BV; Volume: 274; Issue: 24 Linguagem: Inglês
10.1074/jbc.274.24.17103
ISSN1083-351X
AutoresGabriela Vaduva, Narcisa Martı́nez-Quiles, Inés M. Antón, Nancy Martín, Raif S. Geha, Anita K. Hopper, Narayanaswamy Ramesh,
Tópico(s)Advanced Fluorescence Microscopy Techniques
ResumoWIP, the Wiskott-Aldrich syndrome protein-interacting protein, is a human protein involved in actin polymerization and redistribution in lymphoid cells. The mechanism by which WIP reorganizes actin cytoskeleton is unknown. WIP is similar to yeast verprolin, an actin- and myosin-interacting protein required for polarized morphogenesis. To determine whether WIP and verprolin are functional homologues, we analyzed the function of WIP in yeast. WIP suppresses the growth defects of VRP1missense and null mutations as well as the defects in cytoskeletal organization and endocytosis observed in vrp1–1 cells. The ability of WIP to replace verprolin is dependent on its WH2 actin binding domain and a putative profilin binding domain. Immunofluorescence localization of WIP in yeast cells reveals a pattern consistent with its function at the cortical sites of growth. Thus, like verprolin, WIP functions in yeast to link the polarity development pathway and the actin cytoskeleton to generate cytoskeletal asymmetry. A role for WIP in cell polarity provides a framework for unifying, under a common paradigm, distinct molecular defects associated with immunodeficiencies like Wiskott-Aldrich syndrome. WIP, the Wiskott-Aldrich syndrome protein-interacting protein, is a human protein involved in actin polymerization and redistribution in lymphoid cells. The mechanism by which WIP reorganizes actin cytoskeleton is unknown. WIP is similar to yeast verprolin, an actin- and myosin-interacting protein required for polarized morphogenesis. To determine whether WIP and verprolin are functional homologues, we analyzed the function of WIP in yeast. WIP suppresses the growth defects of VRP1missense and null mutations as well as the defects in cytoskeletal organization and endocytosis observed in vrp1–1 cells. The ability of WIP to replace verprolin is dependent on its WH2 actin binding domain and a putative profilin binding domain. Immunofluorescence localization of WIP in yeast cells reveals a pattern consistent with its function at the cortical sites of growth. Thus, like verprolin, WIP functions in yeast to link the polarity development pathway and the actin cytoskeleton to generate cytoskeletal asymmetry. A role for WIP in cell polarity provides a framework for unifying, under a common paradigm, distinct molecular defects associated with immunodeficiencies like Wiskott-Aldrich syndrome. Wiskott-Aldrich syndrome (WAS) 1The abbreviations used are: WAS, Wiskott-Aldrich syndrome; WASP, WAS protein is an inherited immune deficiency characterized by eczema, bleeding, and recurrent infections. A deficiency in both cellular and humoral immunity is common among all WAS patients (1Remold-O'Donnell E. Rosen F.S. Immunodeficiencies. Harwood Academic Publishers Gmbh, Chur, Switzerland1993: 225-241Google Scholar, 2Nonoyama S. Ochs H.D. Curr. Opin. Immunol. 1998; 10: 407-412Crossref PubMed Scopus (28) Google Scholar, 3Ochs H.D. Springer Semin. Immunopathol. 1998; 19: 435-458Crossref PubMed Scopus (31) Google Scholar). Lymphocytes and platelets from WAS patients show cytoskeletal abnormalities, and T lymphocytes of WAS patients show diminished proliferative response to stimulation through the T cell receptor-CD3 complex (4Molina I.J. Sancho J. Terhorst C. Rosen F.S. Remold-O'Donnell E. J. Immunol. 1993; 151: 4383-4390PubMed Google Scholar). Molecular analyses of the WAS gene (5Derry J.M.J. Ochs H.D. Francke U. Cell. 1994; 78: 635-644Abstract Full Text PDF PubMed Scopus (844) Google Scholar) have provided insights into the roles of Wiskott-Aldrich syndrome protein (WASP) in the actin cytoskeleton function and in cell proliferation. WASP binds via its GTPase binding domain to CDC42Hs and weakly to Rac but not to Rho (6Symons M. Derry J.M. Karlak B. Jiang S. Lemahieu V. Mccormick F. Francke U. Abo A. Cell. 1996; 84: 723-734Abstract Full Text Full Text PDF PubMed Scopus (749) Google Scholar). Overexpression of WASP induces formation of actin-containing clusters, indicating a role for WASP in actin polymerization (6Symons M. Derry J.M. Karlak B. Jiang S. Lemahieu V. Mccormick F. Francke U. Abo A. Cell. 1996; 84: 723-734Abstract Full Text Full Text PDF PubMed Scopus (749) Google Scholar). These findings suggest that WASP may provide a connection between CDC42Hs, Rac, and the actin cytoskeleton. One possible link between the actin cytoskeleton and WASP is the recently identified WASP-interacting protein WIP (7Ramesh N. Anton I.M. Hartwig J.H. Geha R.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14671-14676Crossref PubMed Scopus (309) Google Scholar). Transfection of WIP into BJAB cells induced actin-containing cerebriform projections beneath the cell membrane, suggesting that WIP may be involved in regulating the dynamics of the actin cytoskeleton. WIP has sequence similarity to Saccharomyces cerevisiaeverprolin, encoded by the VRP1 gene (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). Verprolin interacts directly with the yeast WASP, Las17p (9Naqvi S.N. Zahn R. Mitchell D.A. Stevenson B.J. Munn A.L. Curr. Biol. 1998; 8: 959-962Abstract Full Text Full Text PDF PubMed Google Scholar). This prompted us to determine whether WIP and verprolin are functional homologues. If the human protein is a homologue of the yeast protein, then the genetic and cell biology data available for verprolin should prove useful for learning more about the function of WIP in human cells. In wild-type yeast cells, the actin cytoskeleton is polarized along the mother-daughter axis (10Adams A.E. Pringle J.R. J. Cell Biol. 1984; 98: 934-945Crossref PubMed Scopus (599) Google Scholar). When the function of verprolin is impaired (in vrp1–1) or absent (in vrp1 null), the asymmetry of actin cytoskeleton along the mother-bud axis is lost, actin cables are faint or absent, and cytoskeleton-associated functions like endocytosis are compromised (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar, 11Zoladek T. Vaduva G. Hunter L.A. Boguta M. Go B.D. Martin N.C. Hopper A.K. Mol. Cell. Biol. 1995; 15: 6884-6894Crossref PubMed Scopus (70) Google Scholar, 12Donnelly S.F. Pocklington M.J. Pallotta D. Orr E. Mol. Microbiol. 1993; 10: 585-596Crossref PubMed Scopus (86) Google Scholar, 13Munn A.L. Stevenson B.J. Geli M.I. Riezman H. Mol. Biol. Cell. 1995; 6: 1721-1742Crossref PubMed Scopus (281) Google Scholar). In addition,vrp1–1 or vrp1 null cells cannot grow at 37 °C (11Zoladek T. Vaduva G. Hunter L.A. Boguta M. Go B.D. Martin N.C. Hopper A.K. Mol. Cell. Biol. 1995; 15: 6884-6894Crossref PubMed Scopus (70) Google Scholar). WIP suppresses the growth defects of VRP1missense and null mutations as well as the cytoskeletal and endocytosis defects of vrp1–1 cells. Mutations in conserved domains of WIP impair its ability to suppress vrp1 mutations. Furthermore, WIP has a polarized intracellular localization that often coincides to that of actin. The data support the hypothesis that WIP and verprolin are functional homologues and provide new ways to understand the molecular defects associated with the Wiskott-Aldrich syndrome. Yeast media was prepared using standard methods (14Sherman F. Methods Enzymol. 1991; 194: 3-21Crossref PubMed Scopus (2553) Google Scholar). Yeast cells were transformed by the one step method (15Chen D.-C Yang B.-C. Kuo T.-T Curr. Genet. 1992; 21: 83-84Crossref PubMed Scopus (591) Google Scholar). Yeast strains used were TZ33 (MATα SUP11 ade2–1 mod5–1 ura3–1 lys2–1 leu2–3, 112 his4–519 vrp1–1)and T65–1D (MATα ade1 ura3–52 leu2–3, 112 ile MEL1 vrp1::LEU2) (11Zoladek T. Vaduva G. Hunter L.A. Boguta M. Go B.D. Martin N.C. Hopper A.K. Mol. Cell. Biol. 1995; 15: 6884-6894Crossref PubMed Scopus (70) Google Scholar). Standard recombinant DNA techniques (16Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and DH5α and RR1 bacterial strains were used. Restriction endonucleases and modifying enzymes were obtained from New England Biolabs (Beverly, MA) or from Promega (Madison, WI). Genomic DNA from TZ33 was prepared (17Adams A. Gottschling D.E. Kaiser C.A. Stearns T. Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1997: 109Google Scholar), and the vrp1–1 gene was polymerase chain reaction-amplified using the following primers: 5′-caatgttcggtttgtccgctacattgctg and 5′-gcctcaatattctgcagctgtggactggc. The polymerase chain reaction products from several independent reactions were cloned into pGEM-T vector and subjected to automated sequencing. WIP cDNA or WIP 2 (amino-terminal 116-amino acid truncation of WIP, (7Ramesh N. Anton I.M. Hartwig J.H. Geha R.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14671-14676Crossref PubMed Scopus (309) Google Scholar)) cloned in pUC18 were digested with EcoRI, filled in, and redigested with PstI, and the insert was then ligated toSmaI-PstI-digested pEMBLyex4, a pEMBLy (18Baldari C. Cesarini G. Gene. 1985; 35: 27-32Crossref PubMed Scopus (104) Google Scholar)-based vector (the vector was a kind gift of Dr. E. Orr, University of Leicester, UK). An artificial initiation codon (ATG) was introduced in WIP2 as follows: 5′ region of WIP was amplified using the oligonucleotide pair: 5′-tagagctccatggactacaaggacgacgatgacaagagggataatgattctggaggaagccga and 5′-ctgtctactccactcctgga. WIP2 in pEMBLyex4 was digested withSacI, and the 370-base pair fragment was exchanged withSacI-digested polymerase chain reaction product. WIP-Lys mutant has lysines 47 and 48 changed to alanines. In the WIP-Pro construct, three proline residues within the consensus profilin binding motif 427APPPPPP433, prolines 429, 431, and 433, were mutated to alanines. Both WIP-Lys and WIP-Pro were constructed by mutagenesis using a site-directed mutagenesis kit (Quickchange, Stratagene) and appropriate oligonucleotides as given below (the mutated bases designated by uppercase). For WIP-Lys the oligo was 5′-gggaagaaactaGCgGCgacggtcaccaatgac, and for WIP-Pro the oligo was 5′-ggggcacctGccccaGctccaGcatcaacatctattattagaaatggc. The region containing the WIP-Lys mutation was excised byEcoRI-BstEII digestion and ligated to WIP cDNA digested with EcoRI-BstEII to generate WIP-Lys. The WIP-Lys,Pro double mutant was constructed by exchanging aSfiI-BamHI fragment of WIP containing the WIP-Pro mutation with the corresponding fragment of the WIP-Lys mutant. All constructs were verified by DNA sequence analysis. Anti-Nsp1 antibody was used at 1:20,000 dilution as described (20Tolerico H.L. Benko A.L. Aris J.P. Stanford D.R. Martin N.C. Hopper A.K. Genetics. 1999; 151: 57-75PubMed Google Scholar). Expression of WIP was analyzed with the 1:1,200-diluted anti-WIP antiserum (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) used for the immunofluorescence studies mentioned below. Immunofluorescence of WIP and phalloidin co-staining of actin in the same cells was carried out in solution as described (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). Briefly, yeast cells were grown on media containing galactose to early logarithmic phase, fixed, digested, (19Pringle J.R. Adams A.E.M. Drubin D.G. Haarer B.K. Methods Enzymol. 1991; 194: 565-602Crossref PubMed Scopus (602) Google Scholar) and incubated for 1 h with rabbit antiWIP antiserum (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) diluted 1:20. Cells were then washed, incubated for 1 h with anti-rabbit fluorescein-conjugated secondary antibody (1:500), and, after a second round of washes, stained with rhodamine phalloidin (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). Lucifer yellow endocytosis and Oregon green phalloidin staining were performed as described (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). A Nikon Microphot-FX equipped with a B-1E filter cube, a 420–490 excitation filter, and a 515F barrier filter was used. Images were acquired and digitized with a Sensys (Photometrics Ltd., Tucson, AZ) CCD camera, and image processing was done using QED software running on a 6500/225 Power Macintosh. Files were processed using Adobe Photoshop 5. Although verprolin is 314-amino acids longer, WIP and verprolin share significant sequence similarity throughout their length, and, more importantly, among defined domains involved in actin, profilin, or WASP interaction (Fig. 1). The WH2 (WASP homology 2) domain of WIP is 44% identical to the actin-interacting WH2 domain of verprolin (Fig. 1). The next highest segment of sequence similarity between WIP and verprolin (43% identity) spans the first 116 amino acids of WIP (Fig.1). The middle portions of WIP and verprolin contain 10 and 11, respectively, potential SH3 binding domains. In WIP, amino acids 321–415 of this region interact with Nck (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar). In verprolin, multiple sites in the SH3 binding domains region interact with the SH3 domain of Myo5p (22Anderson B.L. Boldogh I. Evangelista M. Boone C. Greene L.A. Pon L.A. J. Cell Biol. 1998; 141: 1357-1370Crossref PubMed Scopus (107) Google Scholar). At the carboxyl terminus, WIP contains a 72-amino acid-long WASP-interacting domain (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) (Fig. 1). The carboxyl-terminal 337 amino acids of verprolin, containing a conserved version of the WASP-binding domain of WIP, binds to yeast WASP, Las17p (9Naqvi S.N. Zahn R. Mitchell D.A. Stevenson B.J. Munn A.L. Curr. Biol. 1998; 8: 959-962Abstract Full Text Full Text PDF PubMed Google Scholar). Although verprolin interacts with Las17p (9Naqvi S.N. Zahn R. Mitchell D.A. Stevenson B.J. Munn A.L. Curr. Biol. 1998; 8: 959-962Abstract Full Text Full Text PDF PubMed Google Scholar), verprolin failed to bind human WASP by two-hybrid analysis (data not shown), suggesting that the conservation of the WASP binding region alone may not be sufficient for human WASP-Vrp1p interaction. WIP also interacts with profilin (7Ramesh N. Anton I.M. Hartwig J.H. Geha R.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14671-14676Crossref PubMed Scopus (309) Google Scholar) and contains two putative profilin binding sequences between amino acids 8–13 and 427–433. The latter is conserved in verprolin, but interaction between verprolin and profilin was not detected by two-hybrid analysis (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). Sequence conservation predicts WIP might be a functional homologue of verprolin.vrp1::LEU2 is a null allele (11Zoladek T. Vaduva G. Hunter L.A. Boguta M. Go B.D. Martin N.C. Hopper A.K. Mol. Cell. Biol. 1995; 15: 6884-6894Crossref PubMed Scopus (70) Google Scholar), and thevrp1–1 allele contains a Leu → Pro mutation at amino acid 425, which is part of a proline-rich region homologous to the Nck binding domain (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) of WIP (Fig. 1). Both mutations result in cells unable to grow at 37 °C. WIP cloned in the pEMBLyex4 vector was transfected in vrp1–1 and vrp1 null cells, and its effect on the temperature-sensitive growth defects of these cells was determined. Genes cloned in pEMBLyex4 are expressed from aCYC1 promoter preceded by GAL1–10upstream-activating sequences, resulting in galactose-inducible gene expression. Cells were grown on glucose-selective media, transferred to media containing either glycerol or galactose, and incubated at various temperatures. As expected, induction by galactose leads to elevated expression of WIP (Fig.2 A). vrp1–1or vrp1null cells producing WIP are unable to grow at 37 °C on media containing glycerol as the carbon source. These same cells grow on media containing galactose at 37 °C (Table I; Fig.3, compare A withC). Under the same conditions, vrp1–1 orvrp1 null cells with vector alone fail to grow (Fig.3 C). Thus, as with other human cytoskeletal proteins, high levels of protein are necessary for the complementation (23Adams A.E. Shen W. Lin C.S. Leavitt J. Matsudaira P. Mol. Cell. Biol. 1995; 15: 69-75Crossref PubMed Scopus (45) Google Scholar). The suppression by WIP of the growth defects of vrp1 cells, together with the sequence similarity and domain conservation between the two proteins, indicate that WIP is likely the human homologue of verprolin.Table IGrowth of vrp1–1 and vrp1 null (vrp Δ) strains bearing WIP plasmids on glycerol (Gly)- and galactose (Gal)-containing media at 23 and 37 °CStrainGene on plasmidGrowth on GlyGrowth on Gal23 °C37 °C23 °C (GT)37 °Cvrp1–1Vector+−+(17)−vrp1–1VRP1+++(1.5)+vrp1–1WIP+−+(3)+vrp1–1WIP2+−+(17)−vrp1–1WIP-Lys+−+(11.1)+/−vrp1–1WIP-Pro+−+(9)+/−vrp1–1WIP-Lys,Pro+−+(15)+/−vrp1ΔVector+−+−vrp1ΔVRP1++++vrp1ΔWIP+−++vrp1ΔWIP2+−+−vrp1ΔWIP-Lys+−+−vrp1ΔWIP-Pro+−+−/−/+vrp1ΔWIP-Lys,Pro+−+−GT, generation time in hours at 23 °C on galactose-containing media. Open table in a new tab GT, generation time in hours at 23 °C on galactose-containing media. In a population of vrp1–1 cells, only about 20% of small- and medium-budded cells have polarized cytoskeletons (Fig. 4 A). In wild- type cells, under similar conditions, about 80% of cells are polarized (Fig. 4 B). WIP expression in vrp1–1cell increases the proportion of polarized cells to 65% (Fig.4 C). Thus, like verprolin, WIP functionally participates in the mechanism(s) that regulates the polarized distribution of actin patches between the mother and the bud. Defects in fluid-phase endocytosis can be detected in yeast by monitoring the uptake of a fluorescent marker such as lucifer yellow into the vacuole, the equivalent of mammalian lysosomes. Althoughvrp1–1 cells bearing VRP1 on a plasmid internalize lucifer yellow (Fig.5 B), vrp1–1 cells transformed with vector alone are unable to internalize the dye (Fig.5 A). Expression of WIP in vrp1–1 leads to partial suppression of the defect in endocytosis (Fig.5 C). To analyze the requirement for the WH2 domain in WIP function, we generated a truncated version of WIP, WIP2, lacking the first 116 amino acids (Fig. 2 B). WIP2 was cloned in pEMBLyex4 downstream of a translation initiation codon and tested for its ability to rescue the temperature sensitivity of vrp1cells. WIP2 is unable to restore endocytosis (Fig. 5 D) nor to complement the temperature-sensitive growth defect of eithervrp1–1 or the vrp1 null cells on galactose at 37 °C (Fig. 3, compare A with C). However, because Western analysis revealed poor WIP2 expression in yeast (Fig. 2 A), no conclusions can be inferred from this lack of complementation. To address the role of the WH2 domain for WIP function in another way, we generated point mutations in this domain. The sequence KLKK has been shown to be critical for actin binding among several proteins (24Gertler F.B. Niebuhr K. Reinhard M. Wehland J. Soriano P. Cell. 1996; 87: 227-239Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar). Mutation of 45KK46 abolishes the interaction of the WH2 domain of verprolin with actin (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). A mutant WIP, WIP-Lys, was generated that has the two homologous lysines,47KK48, replaced by alanines. WIP-Lys is expressed at levels comparable with wild-type WIP (Fig. 2 A) but is unable to complement the null mutation (Fig.6 D) and poorly suppresses thevrp1–1 mutation (Fig. 6 B). Even at the permissive temperature the generation time of vrp1–1 cells producing WIP-Lys is about 4 times longer than that ofvrp1–1 cells producing WIP (Table I). Therefore, lysines 47 and 48 are important for the biological function of WIP. WIP interacts with profilin (7Ramesh N. Anton I.M. Hartwig J.H. Geha R.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14671-14676Crossref PubMed Scopus (309) Google Scholar) and has two putative APPPPP profilin binding motifs, homologous to those found in profilin-interacting proteins Mena and VASP (24Gertler F.B. Niebuhr K. Reinhard M. Wehland J. Soriano P. Cell. 1996; 87: 227-239Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar). The second APPPPP motif of WIP is conserved in verprolin (Fig. 1). To test the role of this motif for WIP function, we generated the WIP-Pro mutant (Fig. 2 B) in which three proline residues are mutated to alanine, i.e. 427APPPPPP433 to APAPAPA. The expression of WIP-Pro is comparable with that of wild-type WIP (Fig. 2 A). The generation time of vrp1–1 cells producing WIP-Pro is 3-fold longer than that of WIP producing vrp1–1 cells (Table I); the growth of vrp1 null cells producing WIP-Pro, although not abolished as for WIP-Lys, is much reduced on galactose at 37 °C in comparison with the same cells producing WIP (Fig.6 D). Furthermore, a double mutant, WIP-Lys,Pro, containing both 47KK → AA48 and 427APPPPPP → APAPAPA433 mutations (Fig. 2 B), leads to a further increase in generation time as compared with each mutant alone (Table I). Therefore, the two conserved lysines,47KK48, and the APPPPPP motif contribute to the full activity of WIP in vivo. If WIP performs a conserved function in cell polarity, it should serve as a polarity marker at sites of active cell growth, as does verprolin (8Vaduva G. Martin N.C. Hopper A.K. J. Cell Biol. 1997; 139: 1821-1833Crossref PubMed Scopus (105) Google Scholar). To test this hypothesis, we determined the intracellular localization of WIP in yeast cells by immunofluorescence using anti-WIP antibody (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar). Like verprolin, WIP localizes at regions of active growth in yeast cells in a cell cycle-dependent manner. Although there is WIP staining throughout the cytosol, there are high local concentrations in a punctuated pattern at the site of bud emergence, the tip of the bud, or throughout most of the bud (Fig.7 A, left). The WIP patches often colocalize (Fig. 7 A, left,arrows) with actin patches (Fig. 7 A,right). The patch-like staining is not present in control cells lacking WIP; a very small percentage of these control cells show diffuse cytoplasmic staining, perhaps because of weakly cross-reacting cytoplasmic protein(s) (Fig. 7 B, left). Therefore, it appears that WIP can serve as a polarity marker in yeast, suggesting that the sequence determinants which asymmetrically localize verprolin along the mother-daughter cell axis are conserved in WIP. We show that the WASP-interacting protein WIP is likely the human homologue of yeast cell polarity protein verprolin. The defects in cytoskeletal polarity and endocytosis of vrp1mutant are suppressed by WIP. Therefore, WIP participates in the polarity pathway in yeast and interacts with the yeast cytoskeletal machinery, presumably by providing a function conserved from yeast to humans. WIP is not the only human protein able to supply a cytoskeletal function in yeast. Two isoforms of human fimbrin, T- and L- fimbrins, when expressed from a GAL1 promoter, complement thesac6 null mutant and restore the polarization of the actin cytoskeleton (23Adams A.E. Shen W. Lin C.S. Leavitt J. Matsudaira P. Mol. Cell. Biol. 1995; 15: 69-75Crossref PubMed Scopus (45) Google Scholar). Analogously, the inducible CUP1, but not a constitutive promoter, has proven useful for studies of complementation of the hog1 null mutant by CSBP1 human mitogen-activated protein kinase (25Kumar S. McLaughlin M.M. McDonnell P.C. Lee J.C. Livi G.P. Young P.R. J. Biol. Chem. 1995; 270: 29043-29046Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). It appears that besides the conservation of actin across species (26Ng R. Abelson J. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 3912-3916Crossref PubMed Scopus (349) Google Scholar), there is a remarkable degree of conservation between actin-binding proteins as well, supporting the hypothesis that the machinery responsible for polarized morphogenesis shares conserved elements among eukaryotes. In addition to WIP, two other conserved proteins, CDC42Hs and WASP, emerge as strong candidates for acting in a hierarchical manner to convey polarity signals to the actin cytoskeleton. CDC42Hs human gene complements the yeast cdc42–1 and cdc42–4mutants (27Munemitsu S. Innis M.A. Clark R. McCormick F. Ullrich A. Polakis P. Mol. Cell. Biol. 1990; 10: 5977-5982Crossref PubMed Scopus (136) Google Scholar). Polarization of T cells toward antigen-presenting cells is dependent on CDC42Hs because T cells transfected with CDC42G12V (a mutant locked in the GTP-bound conformation) or CDC42D57Y (a mutant locked in the GDP-bound conformation) are unable to polarize their cytoskeletons toward the antigen (28Stowers L. Yelon D. Berg L.J. Chant J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5027-5031Crossref PubMed Scopus (345) Google Scholar). In yeast, Cdc42p is a major cell polarity establishment protein (29Adams A.E. Johnson D.I. Longnecker R.M. Sloat B.F. Pringle J.R. J. Cell Biol. 1990; 111: 131-142Crossref PubMed Scopus (477) Google Scholar) required for actin nucleation (30Li R. J. Cell Biol. 1997; 136: 649-658Crossref PubMed Scopus (219) Google Scholar). Thus both the yeast and human CDC42 proteins function in cell polarity. A CDC42Hs effector, human WASP, has profound effects on actin polymerization (6Symons M. Derry J.M. Karlak B. Jiang S. Lemahieu V. Mccormick F. Francke U. Abo A. Cell. 1996; 84: 723-734Abstract Full Text Full Text PDF PubMed Scopus (749) Google Scholar). The yeast homologue of WASP, encoded byLAS17/BEE1, binds actin (30Li R. J. Cell Biol. 1997; 136: 649-658Crossref PubMed Scopus (219) Google Scholar) and activates the actin assembly sites in the cortical cytoskeleton (31Lechler T. Li R. J. Cell Biol. 1997; 138: 95-103Crossref PubMed Scopus (51) Google Scholar). Like verprolin, WASP-interacting WIP may perform its function in cytoskeletal organization by localizing to specialized regions of the cell and recruiting additional proteins such as actin to initiate morphogenic changes. Thus, the CDC42Hs-WASP-WIP pathway possibly fulfills the critical function of generating and enforcing cytoskeletal polarity. Other components in the pathway may exist and CDC42Hs, WASP, and WIP may also be involved in other pathways. CDC42Hs is also required for the induction of DNA synthesis upon mitogen activation of the c-Jun NH2-terminal kinase/stress-activated protein kinase (JNK/SAPK) mitogen-activated protein kinase cascade (32Lamarche N. Tapon N. Stowers L. Burbelo P.D. Aspenstrom P. Bridges T. Chant J. Hall A. Cell. 1996; 87: 519-529Abstract Full Text Full Text PDF PubMed Scopus (528) Google Scholar). WASP may act as a molecular switch, because it interacts with a multitude of proteins, including phospholipase C, Tec family members Btk, Itk, Tec, Grb, as well as p59fyn and Nck (33Rivero-Lezcano O.M. Marcilla A. Sameshima J.H. Robbins K.C. Mol. Cell. Biol. 1995; 15: 5725-5731Crossref PubMed Scopus (281) Google Scholar, 34Banin S. Truong O. Katz D.R. Waterfield M.D. Brickell P.M. Gout I. Curr. Biol. 1996; 6: 981-988Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 35Featherstone C. Science. 1997; 275: 27-28Crossref PubMed Scopus (15) Google Scholar). WIP also interacts with Nck (21Anton I.M. Lu W. Mayer B.J. Ramesh N. Geha R.S. J. Biol. Chem. 1998; 273: 20992-20995Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar). Further work is required to fully delineate all pathways in which these proteins are involved. The clinical features of WAS suggest that cytoskeletal polarity defects may be the cause for an altered immune response. Morphological and biochemical studies show that the cytoskeletons of lymphocytes affected by WAS are aberrant (36Kenney D. Cairns L. Remold-O'Donnell E. Peterson J. Rosen F.S. Parkman R. Blood. 1986; 68: 1329-1332Crossref PubMed Google Scholar, 37Gallego M.D. Santamaria M. Pena J. Molina I.J. Blood. 1997; 90: 3089-3097Crossref PubMed Google Scholar) and unable to polarize toward polysaccharide antigen-presenting cells (38Ochs H.D. Slichter S.J. Harker L.A. Von Behrens W.E. Clark R.A. Wedgwood R.J. Blood. 1980; 55: 243-252Crossref PubMed Google Scholar). Recognition of mitogenic stimuli requires cell polarization mediated by cytoskeletal rearrangements (28Stowers L. Yelon D. Berg L.J. Chant J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5027-5031Crossref PubMed Scopus (345) Google Scholar, 39Phatak P.D. Packman C.H. J. Cell. Physiol. 1994; 159: 365-370Crossref PubMed Scopus (19) Google Scholar). WAS lymphocytes are not able to respond to immobilized anti-CD3 antibodies (37Gallego M.D. Santamaria M. Pena J. Molina I.J. Blood. 1997; 90: 3089-3097Crossref PubMed Google Scholar) and have diminished response to chemoattractants and a profound decrease in polarization (40Badolato R. Sozzani S. Malacarne F. Bresciani S. Fiorini M. Borsatti A. Albertini A. Mantovani A. Ugazio A.G. Notarangelo L.D. J. Immunol. 1998; 161: 1026-1033PubMed Google Scholar, 41Zicha D. Allen W.E. Brickell P.M. Kinnon C. Dunn G.A. Jones G.E. Thrasher A.J. Br. J. Haematol. 1998; 101: 659-665Crossref PubMed Scopus (202) Google Scholar). When monocytes are stimulated with chemoattractants, rapid rearrangements of F-actin toward the poles occur. In contrast, actin distribution is uniform in monocytes derived from WAS patients (40Badolato R. Sozzani S. Malacarne F. Bresciani S. Fiorini M. Borsatti A. Albertini A. Mantovani A. Ugazio A.G. Notarangelo L.D. J. Immunol. 1998; 161: 1026-1033PubMed Google Scholar). Because both WIP (7Ramesh N. Anton I.M. Hartwig J.H. Geha R.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14671-14676Crossref PubMed Scopus (309) Google Scholar) and WASP (6Symons M. Derry J.M. Karlak B. Jiang S. Lemahieu V. Mccormick F. Francke U. Abo A. Cell. 1996; 84: 723-734Abstract Full Text Full Text PDF PubMed Scopus (749) Google Scholar) are involved in the redistribution of F-actin and because CDC42Hs is involved in macrophage chemotaxis (42Allen W.E. Zicha D. Ridley A.J. Jones G.E J. Cell Biol. 1998; 141: 1147-1157Crossref PubMed Scopus (446) Google Scholar), these three interacting proteins may act in a hierarchical order to trigger cell polarity. That WIP is able to restore polarity to vrp1–1cells supports this contention. Ligand engagement of the CD3 T cell receptor promotes its endocytosis (43Luton F. Legendre V. Gorvel J.P. Schmitt-Verhulst A.M. Boyer C. J. Immunol. 1997; 158: 3140-3147PubMed Google Scholar), a function dependent on the actin cytoskeleton. Restoration by WIP of the endocytosis defects of vrp1 cells may reflect its ability to perform an analogous function in human cells. Further work is necessary to understand the possible role of WASP and WIP in endocytosis and their relevance in WAS. In conclusion, although different levels of complexity operate in yeast and humans, a model emerges in which the polarity pathway described here has been adapted by various cells to specifically serve their cytoskeletal functions. Further dissection of this pathway in both yeast and metazoans will increase the understanding of its function and its connections with other signaling pathways. We thank David Stanford, James Stanford, Srimonti Sarkar, and Ann Benko for comments on the manuscript and stimulating discussions.
Referência(s)