Ligand-induced Dynamic Membrane Changes and Cell Deletion Conferred by Vanilloid Receptor 1
2001; Elsevier BV; Volume: 276; Issue: 14 Linguagem: Inglês
10.1074/jbc.m008392200
ISSN1083-351X
AutoresZoltán Oláh, Tamás Szabó, Laszlo Karai, Chris Hough, R. Douglas Fields, Robert M. Caudle, Peter M. Blumberg, Michael J. Iadarola,
Tópico(s)Ion channel regulation and function
ResumoThe real time dynamics of vanilloid-induced cytotoxicity and the specific deletion of nociceptive neurons expressing the wild-type vanilloid receptor (VR1) were investigated. VR1 was C-terminally tagged with either the 27-kDa enhanced green fluorescent protein (eGFP) or a 12-amino acid ε-epitope. Upon exposure to resiniferatoxin, VR1eGFP- or VR1ε-expressing cells exhibited pharmacological responses similar to those of cells expressing the untagged VR1. Within seconds of vanilloid exposure, the intracellular free calcium ([Ca2+]i) was elevated in cells expressing VR1. A functional pool of VR1 also was localized to the endoplasmic reticulum that, in the absence of extracellular calcium, also was capable of releasing calcium upon agonist treatment. Confocal imaging disclosed that resiniferatoxin treatment induced vesiculation of the mitochondria and the endoplasmic reticulum (∼1 min), nuclear membrane disruption (5–10 min), and cell lysis (1–2 h). Nociceptive primary sensory neurons endogenously express VR1, and resiniferatoxin treatment induced a sudden increase in [Ca2+]i and mitochondrial disruption which was cell-selective, as glia and non-VR1-expressing neurons were unaffected. Early hallmarks of cytotoxicity were followed by specific deletion of VR1-expressing cells. These data demonstrate that vanilloids disrupt vital organelles within the cell body and, if administered to sensory ganglia, may be employed to rapidly and selectively delete nociceptive neurons. The real time dynamics of vanilloid-induced cytotoxicity and the specific deletion of nociceptive neurons expressing the wild-type vanilloid receptor (VR1) were investigated. VR1 was C-terminally tagged with either the 27-kDa enhanced green fluorescent protein (eGFP) or a 12-amino acid ε-epitope. Upon exposure to resiniferatoxin, VR1eGFP- or VR1ε-expressing cells exhibited pharmacological responses similar to those of cells expressing the untagged VR1. Within seconds of vanilloid exposure, the intracellular free calcium ([Ca2+]i) was elevated in cells expressing VR1. A functional pool of VR1 also was localized to the endoplasmic reticulum that, in the absence of extracellular calcium, also was capable of releasing calcium upon agonist treatment. Confocal imaging disclosed that resiniferatoxin treatment induced vesiculation of the mitochondria and the endoplasmic reticulum (∼1 min), nuclear membrane disruption (5–10 min), and cell lysis (1–2 h). Nociceptive primary sensory neurons endogenously express VR1, and resiniferatoxin treatment induced a sudden increase in [Ca2+]i and mitochondrial disruption which was cell-selective, as glia and non-VR1-expressing neurons were unaffected. Early hallmarks of cytotoxicity were followed by specific deletion of VR1-expressing cells. These data demonstrate that vanilloids disrupt vital organelles within the cell body and, if administered to sensory ganglia, may be employed to rapidly and selectively delete nociceptive neurons. capsaicin capsazepine olvanil resiniferatoxin vanilloid receptor Ca2+ store-dependent channel dorsal root ganglion enhanced green fluorescent protein C-terminally eGFP-tagged vanilloid receptor C-terminally ε-tagged vanilloid receptor endoplasmic reticulum intracellular free calcium neuronal growth factor 5-fluoro-2′-deoxyuridine Dulbecco's modified Eagle's medium reverse transcriptase-polymerase chain reaction propidium iodide metallothionein Capsaicin (CAP),1 a well characterized membrane-permeable vanilloid agonist, has potent stimulatory actions on nociceptive neurons and causes loss of unmyelinated "C"-type sensory afferents when administered to newborn animals (1Hylden J.L. Noguchi K. Ruda M.A. J. Neurosci. 1992; 12: 1716-1725Crossref PubMed Google Scholar, 2Jancso G. Kiraly E. Jancso-Gabor A. Nature. 1977; 270: 741-743Crossref PubMed Scopus (1086) Google Scholar). Similarly, resiniferatoxin (RTX), an ultrapotent capsaicin analogue, can deplete [3H]RTX-binding sites from the brain stem, the sensory ganglia (dorsal root and trigeminal), and the spinal cord with a mechanism that has not been fully elucidated (3Szallasi A. Nilsson S. Farkas-Szallasi T. Blumberg P.M. Hokfelt T. Lundberg J.M. Brain Res. 1995; 703: 175-183Crossref PubMed Scopus (183) Google Scholar, 4Farkas-Szallasi T. Bennett G.J. Blumberg P.M. Hokfelt T. Lundberg J.M. Szallasi A. Brain Res. 1996; 719: 213-218Crossref PubMed Scopus (15) Google Scholar). Both systemic and epidural administration of RTX to adult rats produce analgesia to subsequent noxious thermal stimulation (5Szabo T. Olah Z. Iadarola M.J. Blumberg P.M. Brain Res. 1999; 840: 92-98Crossref PubMed Scopus (38) Google Scholar). Depending on concentration, duration of exposure, and route of administration, vanilloid ligands may either desensitize the nociceptive primary afferent nerve ending or completely delete the neuron itself (6Yaksh T.L. Farb D.H. Leeman S.E. Jessell T.M. Science. 1979; 206: 481-483Crossref PubMed Scopus (262) Google Scholar, 7Winter J. Dray A. Wood J.N. Yeats J.C. Bevan S. Brain Res. 1990; 520: 131-140Crossref PubMed Scopus (127) Google Scholar, 8Jancso G. Lawson S.N. Neuroscience. 1990; 39: 501-511Crossref PubMed Scopus (67) Google Scholar). Previous studies investigating the processes of desensitization and cell loss mainly examined whole animals or primary cultures of dorsal root ganglia, where nociceptive neuronal cell bodies are located. The cloning of the first isotype of the vanilloid receptor (VR1) provides a means to investigate more fully the molecular and cell biological mechanisms of pain signal transduction and the processes underlying susceptibility of VR1-expressing cells to impairment upon exposure to vanilloid agonists (9Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar). The VR1 has been characterized as a Ca2+ ionophore (9Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar,10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar); thus, it also provides a very specific molecule with which to investigate the role of ligand-activated transmembrane calcium fluxes in cellular toxicity. The VR1 exhibits homology to Ca2+store-dependent TRP channels. In contrast to TRPs, which regulate intracellular calcium stores, VR1 confers two pivotal sensory functions. VR1 transduces chemical (vanilloids and pH) and physical (heat) stimuli at the molecular level, generating action potentials in nociceptive nerve endings, and ultimately leading to sensations of heat, thermal pain, and inflammatory pain (10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar, 11Davis J.B. Gray J. Gunthorpe M.J. Hatcher J.P. Davey P.T. Overend P. Harries M.H. Latcham J. Clapham C. Atkinson K. Hughes S.A. Rance K. Grau E. Harper A.J. Pugh P.L. Rogers D.C. Bingham S. Randall A. Sheardown S.A. Nature. 2000; 405: 183-187Crossref PubMed Scopus (1498) Google Scholar). Loss of moderately noxious heat and vanilloid-stimulated sensory functions has been verified in animals lacking VR1 (11Davis J.B. Gray J. Gunthorpe M.J. Hatcher J.P. Davey P.T. Overend P. Harries M.H. Latcham J. Clapham C. Atkinson K. Hughes S.A. Rance K. Grau E. Harper A.J. Pugh P.L. Rogers D.C. Bingham S. Randall A. Sheardown S.A. Nature. 2000; 405: 183-187Crossref PubMed Scopus (1498) Google Scholar, 12Caterina M.J. Leffler A. Malmberg A.B. Martin W.J. Trafton J. Petersen-Zeitz K.R. Koltzenburg M. Basbaum A.I. Julius D. Science. 2000; 288: 306-313Crossref PubMed Scopus (2933) Google Scholar). VR1 mRNA is expressed with remarkable cell and tissue specificity in the DRG. Immunocytochemistry demonstrates VR1 throughout the peripheral endings, cell body, and presynaptic terminals of small size dorsal root ganglion (DRG) neurons (10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar, 13Guo A. Vulchanova L. Wang J. Li X. Elde R. Eur. J. Neurosci. 1999; 11: 946-958Crossref PubMed Scopus (774) Google Scholar). These sites coincide well with regional localization of [3H]RTX binding (3Szallasi A. Nilsson S. Farkas-Szallasi T. Blumberg P.M. Hokfelt T. Lundberg J.M. Brain Res. 1995; 703: 175-183Crossref PubMed Scopus (183) Google Scholar, 4Farkas-Szallasi T. Bennett G.J. Blumberg P.M. Hokfelt T. Lundberg J.M. Szallasi A. Brain Res. 1996; 719: 213-218Crossref PubMed Scopus (15) Google Scholar). The ability of CAP and RTX to displace [3H]RTX binding in the spinal cord and DRG as well as similarities in [3H]RTX binding studies with recombinantly expressed VR1 suggest that both vanilloids act on the same receptors (14Szallasi A. Blumberg P.M. Annicelli L.L. Krause J.E. Cortright D.N. Mol. Pharmacol. 1999; 56: 581-587Crossref PubMed Scopus (122) Google Scholar). Previous studies with vanilloids have shown that vanilloid administration can lead to cell type-specific membrane damage. Long term exposure to vanilloids causes profound ultrastructural changes in DRG neurons (15Jancso G. Karcsu S. Kiraly E. Szebeni A. Toth L. Bacsy E. Joo F. Parducz A. Brain Res. 1984; 295: 211-216Crossref PubMed Scopus (137) Google Scholar, 16Kiraly E. Jancso G. Hajos M. Brain Res. 1991; 540: 279-282Crossref PubMed Scopus (21) Google Scholar). VR1-specific antibodies have been used in intracellular localization by light and electron microscopy, but the functional relationship of these morphological observations to the observed cell damage has not been explored (10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar, 13Guo A. Vulchanova L. Wang J. Li X. Elde R. Eur. J. Neurosci. 1999; 11: 946-958Crossref PubMed Scopus (774) Google Scholar). Immunostaining of fixed cells often limits detailed visual observation of rapid intracellular processes. In the present paper, we used fluorescence confocal microscopy and real time imaging of enhanced green fluorescent protein (eGFP)-tagged VR1 (VR1eGFP) to examine simultaneously both the morphological and functional molecular processes underlying the immediate effects of vanilloid exposure on the perikarya of cells and neurons with high temporal and spatial resolution. Biochemical functions in the plasma membrane (membrane potential changes, calcium uptake, and [3H]RTX binding) similar to wild-type VR1 were readily observed with the chimeric VR1eGFP. In addition, another active pool of VR1 was located at the endoplasmic reticulum (ER), which also reacted within seconds to vanilloid treatment. Exposure of VR1-expressing cells to vanilloids produced a rapidly evolving cytotoxicity. This commenced with a rise in [Ca2+]i, which quickly surpassed the Ca2+ tolerance or sequestration capacity of the mitochondria. Subsequently, nuclear envelope shrinkage and blebbing occurred, followed by cell death. The effect of elevated [Ca2+]i on vital organelles suggests that targeted administration of vanilloid agents to the cell body can rapidly compromise and then eliminate (within hours) VR1-expressing nociceptive neurons. In fact, immunoblot analysis of protein extracts from primary DRG cultures showed that treatment with any of several vanilloid agonists eliminated cells expressing the VR1. To obtain VR1-specific mRNA, 100 DRGs were rapidly removed from 12 adult Harlan Sprague-Dawley rats. Total RNA was isolated with the TRI REAGENT (Molecular Research Center Inc., Cincinnati, OH). A fragment, comprising the sequence between the XbaI andAflIII sites of rat VR1, was amplified first by the Access RT-PCR system (Promega) and then cloned into the BlueScript vector (Stratagene). The missing 5′-sequence was added likewise with theSacI and XbaI sites. At the 5′ ends of the N- and C-terminal fragments, the SacI and AflIII sites (underlined) were incorporated with forward primers AGATCTCGAGCTCAAATGGAACAACGGGCTAGCTTAGACTC and CTGTATTCCACATGTCTGGAGCTGTTCAAGTTC, respectively. As reverse primers ACTGAGTCCCGGGCGCTGATGTCTGCAGGCT and CACACAGTCGACTTTCTCCCCTGGGACCATGGAATCCTT were used, in which the XbaI and SalI sites were incorporated, respectively. The SacI-AflIII and the RT-PCR- generated AflIII-SalI fragments were triple-ligated into a SacI and SalI cut pEGFP-N3 vector (CLONTECH). The immediate early promoter of the cytomegalovirus in the pEGFP-N3 vector was employed to produce the full-length VR1 with the eGFP tag. Rat VR1 with the short, 12- amino acid ε-tag (KGFSYFGEDLMP) was constructed in a vector, pεMTH, driven by the metallothionein promoter (17Olah Z. Lehel C. Jakab G. Anderson W.B. Anal. Biochem. 1994; 221: 94-102Crossref PubMed Scopus (65) Google Scholar). Briefly, SalI and MluI restriction endonuclease sites were incorporated into the VR1 PCR fragment amplified using the forward AGTAGTGTCGACGAACAACGGGCTAGCTTAGACTCA and reverse TTGTTGACGCGTTTTCTCCCCTGGGACCATGGAATC primers, respectively. After cutting the PCR fragment with these enzymes the size-separated cDNA insert was ligated in pεMTH at the compatibleXhoI and MluI sites (17Olah Z. Lehel C. Jakab G. Anderson W.B. Anal. Biochem. 1994; 221: 94-102Crossref PubMed Scopus (65) Google Scholar). The chimeric constructs were verified by sequencing and transiently transfected in COS7, HEK293, and NIH 3T3 cells employing the protocol provided for the LipofectAMINE reagent (Life Technologies, Inc.). The basal activity of the pεMTH promoter was used in NIH 3T3 cells to produce VR1ε, yet prevent toxicity from long term, high level expression. For patch clamp studies, VR1eGFP-expressing COS7 and HEK293 cells were voltage-clamped in Krebs buffer containing (in mm) NaCl (124), KCl (4.9), KH2PO4 (1.2), MgSO4 (2.4), CaCl2 (2.5), NaHCO3 (25.6), and glucose (10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar), using an Axopatch 200B amplifier (Axon Instruments, Foster City, CA). Recordings were carried out with patch electrodes (2–10 MΩ) filled with 10 mm HEPES buffer (pH 7.4) containing (in mm) CsCl (120), tetraethylammonium chloride (20Hough C.J. Irwin R.P. Gao X.M. Rogawski M.A. Chuang D.M. J. Pharmacol. Exp. Ther. 1996; 276: 143-149PubMed Google Scholar), CaCl2 (1Hylden J.L. Noguchi K. Ruda M.A. J. Neurosci. 1992; 12: 1716-1725Crossref PubMed Google Scholar), MgCl2 (2Jancso G. Kiraly E. Jancso-Gabor A. Nature. 1977; 270: 741-743Crossref PubMed Scopus (1086) Google Scholar), EGTA (10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar), ATP (4Farkas-Szallasi T. Bennett G.J. Blumberg P.M. Hokfelt T. Lundberg J.M. Szallasi A. Brain Res. 1996; 719: 213-218Crossref PubMed Scopus (15) Google Scholar), and GTP (0.5). Cells were transfected at 80‥ confluence in 75-cm2 T-flasks with 20 μg of VR1eGFP or VR1ε plasmids. After 48 h, 5 × 104 cells were detached from the plastic surface by serum-free DMEM containing 1 mm EDTA and then washed two times and resuspended in medium without EDTA. Cell suspensions were incubated in serum-free DMEM containing 1 μCi/ml45Ca2+ and ligands as indicated for 15 min at 35 °C in 96-well filtration plates (MultiScreen-DV, Millipore, Marlborough, MA). Ca2+ uptake was terminated on ice, and samples were processed and analyzed as described (18Acs G. Lee J. Marquez V.E. Blumberg P.M. Brain Res. Mol. Brain Res. 1996; 35: 173-182Crossref PubMed Google Scholar). 48 h after transfection in 75-cm2 T-flasks, cells were detached from the plastic surface by serum-free DMEM containing 1 mm EDTA and then washed and resuspended in 10 mm HEPES (pH 7.4) buffer, containing (in mm) KCl (5Szabo T. Olah Z. Iadarola M.J. Blumberg P.M. Brain Res. 1999; 840: 92-98Crossref PubMed Scopus (38) Google Scholar), NaCl (5.8), MgCl2(2Jancso G. Kiraly E. Jancso-Gabor A. Nature. 1977; 270: 741-743Crossref PubMed Scopus (1086) Google Scholar), CaCl2 (0.75), glucose (12Caterina M.J. Leffler A. Malmberg A.B. Martin W.J. Trafton J. Petersen-Zeitz K.R. Koltzenburg M. Basbaum A.I. Julius D. Science. 2000; 288: 306-313Crossref PubMed Scopus (2933) Google Scholar), and sucrose (137). Intact cells were incubated (105/well) in a filtration plate with 200 pm [3H]RTX for 60 min at 37 °C and then processed as described earlier (5Szabo T. Olah Z. Iadarola M.J. Blumberg P.M. Brain Res. 1999; 840: 92-98Crossref PubMed Scopus (38) Google Scholar). Data were analyzed by computer fit to the Hill equation as noted previously (18Acs G. Lee J. Marquez V.E. Blumberg P.M. Brain Res. Mol. Brain Res. 1996; 35: 173-182Crossref PubMed Google Scholar, 19Endrenyi L. Fajszi C. Kwong F.H. Eur. J. Biochem. 1975; 51: 317-328Crossref PubMed Scopus (65) Google Scholar). COS7, NIH 3T3, and HEK293 cells were seeded on 25-mm coverslips and transfected with 1 μg each of the plasmid constructs, cultured for 24 h post-transfection at 35 °C, then mounted in a 1-ml chamber and examined with a MRC-1024 Bio-Rad confocal microscope. To study the two- and three-dimensional distribution of fluorescent chimeric proteins, each x-yplane was scanned over 1 s and at 0.2-μm increments in the z axis mode. To label different subcellular compartments of live cells fluorescently, the ER marker eGFP-KDEL (CLONTECH) was transiently transfected in COS7 and NIH 3T3 cells. To label mitochondria, MitoTracker (Molecular Probes) dye was incubated for 30 min at a 250 nm concentration; the cells were then washed with Hanks' balanced salt solution supplemented with 1 mm CaCl2 and 0.8 mmMgCl2, buffered with 15 mm HEPES (pH 7.4) (HBSSH). For determination of [Ca2+]i, cells were cultured in glass bottom dishes (MatTek Corp., Ashland, MA) and then transfected with 2 μg of VR1eGFP plasmid. After 24 h in culture, cells were loaded with Fura 2/AM (Molecular Probes, Eugene, OR) for 30 min at 37 °C. Single cells expressing the VR1eGFP construct were identified by eGFP fluorescence and were selected based on visual inspection of fluorescence intensity. In all experiments, cells exhibiting intermediate fluorescence in comparison to other cells in the same dish were picked for analysis. To determine the [Ca2+]i, the excitation ratio of Fura-2 at 340 and 380 nm was recorded photometrically in Krebs' buffer at a 10-Hz sampling rate and integrated over 0.5 s, as described previously (20Hough C.J. Irwin R.P. Gao X.M. Rogawski M.A. Chuang D.M. J. Pharmacol. Exp. Ther. 1996; 276: 143-149PubMed Google Scholar). [Ca2+]i was calculated using the ratio based equation (21Grynkiewicz G. Poenie M. Tsien R.Y. J. Biol. Chem. 1985; 260: 3440-3450Abstract Full Text PDF PubMed Scopus (80) Google Scholar). Cells cultured on poly-d-lysine-coated coverslips were pre-loaded with 5 μm Indo-1 AM dye. After incubation for 30 min at 34 °C, the cells were washed three times in HBSSH to remove excess dye and examined under the confocal microscope. To record in "zero" extracellular Ca2+ cells were washed four times (5 min each) in HBSSH containing no CaCl2 and 1 mmEGTA and imaged in the same medium. Groups of cells expressing VR1eGFP or small size neurons were selected under the microscope. To quantitate the fluorescence ratio, perikarya of the cells were marked with the graphic tools of the LaserSharp software in the field of a × 40 objective of the Bio-Rad confocal system. Ratiometric imaging was performed at 10-s intervals with an UV laser, and the ratio of fluorescence intensity emitted at 405 and 485 was calculated. DRG neuron-enriched cultures were prepared from embryonic rats (E16). Briefly, embryos were removed from the uterus and placed in Petri dishes containing Lebowitz medium (Life Technologies, Inc.). The cords were dissected, and the DRGs were stripped off with the meninges. Cells were digested in 0.125‥ trypsin at 37 °C for 20 min. For plating, dissociated cells were changed into minimal essential medium containing 5‥ horse serum and 50 ng/ml nerve growth factor (NGF). Cells were seeded on 25-mm glass coverslips or on multiwell plates. Surfaces were coated with poly-d-lysine and laminin. DRG cultures were maintained in DMEM containing 20 mm HEPES, 7.5‥ fetal bovine serum, 7.5‥ horse serum, 5 mg/ml uridine supplemented with 2 mg/ml FUDR to inhibit cell division and 50 ng/ml NGF to promote neuronal survival and differentiation. Cultures were selected in this medium for 1 week, at which point well differentiated neurons and nondividing cells dominated the population. Primary DRG cultures in this stage were used in confocal microscopy. Total protein extracts were prepared in denaturing SDS buffer and analyzed for immunoreactivity by Western blotting similar to that described by us previously (17Olah Z. Lehel C. Jakab G. Anderson W.B. Anal. Biochem. 1994; 221: 94-102Crossref PubMed Scopus (65) Google Scholar). VR1-specific antibody was raised in rabbits employing the N-terminal MEQRASLDSEESESPPQE peptide of rat VR1 conjugated to keyhole limpet hemocyanin as immunogen. Immune sera were affinity purified against the peptide used for immobilization. The specific antibody fraction eluted from the affinity column was diluted 1000-fold for further characterization in Western blot and immunocytochemistry experiments. This antibody fraction recognizes the native rat VR1, as illustrated in Fig. 11, and the chimeric VR1eGFP and VR1ε (data not shown). Stripping of nitrocellulose blotting filters (Bio-Rad) was carried out in 200 ml of 50 mm Tris-HCl buffer (pH 7.5) containing 2‥ SDS and 0.1 β-mercaptoethanol at 65 °C for 1 h. Stripped blots were reanalyzed for tagged fusion proteins either with the GFP (CLONTECH) or the εPKC-specific antibodies (Life Technologies, Inc.), prepared in rabbits. To assess equal loading, filters were re-probed with a rat cytochrome c-specific monoclonal antibody (6H2.B4) as suggested by the manufacturer (Transduction Laboratories). Antibodies for Western blotting were used at a 1:1000 dilution. To visualize the interaction with the primary antibodies, enhanced chemiluminescence technology was employed according to the protocol provided by the manufacturer (New England Biolabs). VR1ε and VR1eGFP plasmid constructs were expressed in COS7, HEK293, and NIH 3T3 cells by transient transfection. Western blot analysis with polyclonal eGFP and ε-tag-specific antibodies demonstrated that the VR1eGFP and VR1ε chimeric proteins expressed in HEK293 and NIH 3T3 cells were of the appropriate sizes, 120 and 93 kDa, respectively (Fig. 1, 1st and3rd lanes). No tag-related immunoreactivity was found in the nontransfected host cells (Fig. 1, 2nd and 4th lanes). Repeated Western analyses with GFP- and ε-tag-specific antibodies showed no proteolytic cleavage of the VR1 chimeric proteins (data not shown). These transiently transfected plasmid constructs expressed proteins that exhibited identical molecular weights after the tag-specific antibodies were removed and the blots re-probed with the N-terminal specific VR1 antibody (data not shown). To study the electrophysiological properties of C-terminally eGFP-tagged VR1, plasmid constructs producing VR1eGFP and eGFP as a control were transiently expressed in HEK293 cells. Green fluorescent cells of medium fluorescence intensity were voltage-clamped, and the holding potential was adjusted to −60 mV. Capsaicin (10 μm) induced a large inward current (Fig.2 a). Similar currents were also evoked by administration of 125 pm RTX to the cells; however, the currents rapidly desensitized to repeated applications (n = 6) (data not shown). Capsaicin was noted to be less effective at inducing desensitization than RTX; therefore, CAP was used in experiments that required repeated application of vanilloid ligands (e.g. Fig. 2). As expected for a functional recombinant, the VR1eGFP-mediated current was attenuated by coincubation of an antagonist, 10 μm capsazepine (CPZ). The current versus voltage relationship demonstrated that the VR1eGFP-mediated current was not particularly voltage-sensitive. The reversal potential was near 0 mV, suggesting mixed cation selectivity for the channel (data not shown). Cells transfected with eGFP did not demonstrate currents when exposed to either CAP or RTX (Fig. 2 b and data not shown). Likewise, nontransfected HEK293 cells did not demonstrate RTX-evoked currents. Overall, the electrophysiological properties of the eGFP-tagged VR1 were very similar to those described for nontagged VR1 (9Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar). In accordance with the electrophysiological data, exposure to RTX induced Ca2+ uptake in VR1eGFP-expressing HEK293 and COS7 cells. This ligand-induced Ca2+ influx (Fig.3 a) further confirms the presence of VR1eGFP at the plasma membrane. RTX induced45Ca2+ uptake with an ED50 = 100 ± 50 pm (n = 3) whereas that for CAP was 0.5 ± 0.15 μm (data not shown). Similar results were obtained for VR1 tagged with the 12-amino acid ε-epitope in place of the eGFP tag. This indicates that a C-terminal tag,per se, does not significantly change Ca2+uptake parameters. In addition, RTX-induced45Ca2+ uptake was completely blocked by 10 μm CPZ in VR1eGFP- (Fig. 3 a) and VR1ε−expressing cells (not shown). The curves in Fig. 3 b demonstrate the quantitative characteristics of [3H]RTX binding to eGFP-tagged and ε-tagged VR1 expressed in COS7 cells. Both tagged recombinants exhibited a high affinity, dose-dependent interaction (Kd ∼ 150 ± 10 pm,n = 6) and cooperativity among the receptors (Hill coefficient = 1.5–2). [3H]RTX binding was almost completely inhibited by coincubation of 10 μm CPZ. No significant [3H]RTX binding was detected in cells transfected with the plasmid expressing only eGFP (Fig.3 b). Confocal fluorescence microscopy was employed to analyze the intracellular distribution of VR1eGFP. Optical sections taken at the plane of cell attachment to the glass surface show VR1eGFP fluorescence in the plasma membrane, where microvilli were labeled (Fig.4 a, VR1 accumulation also is present at the focal points in this plane, not seen with fluorescent markers of ER). Optical sections taken through the middle of the cell nucleus, disclosed VR1eGFP in intracellular structures consistent with the ER (Fig. 4, b versus d). To confirm ER localization, cells were transfected with an eGFP that was C-terminally tagged with the ER retention signal (i.e. the KDEL motif, Fig. 4 b). Visualization of the transiently expressed eGFP-KDEL chimera protein in COS7 cells verified that VR1eGFP indeed stained the same ER compartment within the cytoplasm and around the nucleus (Fig. 4, b versus d). Furthermore, the same ER colocalization result was obtained when VR1eGFP-expressing cells were costained with the ER-tracker vital dye (Molecular Probes) (not shown). Fig. 4 illustrates localization of VR1 in COS7 cells but a similar ER localization was seen in HEK293 and NIH 3T3 cells, indicating that it is not a cell type-specific anomaly. ER localization was observed over a range of transfection efficiencies, and the distribution between the plasma membrane and ER was similar in cells expressing VR1eGFP at different levels (not shown). The proportionality between plasma membrane and ER also was maintained in a cell line stably expressing relatively lower levels of VR1ε from the noninduced MTH promoter. These data, as well as results from immunocytochemical staining of fixed DRG neurons, which show a high density of staining throughout the neuronal cytoplasm (10Tominaga M. Caterina M.J. Malmberg A.B. Rosen T.A. Gilbert H. Skinner K. Raumann B.E. Basbaum A.I. Julius D. Neuron. 1998; 21: 531-543Abstract Full Text Full Text PDF PubMed Scopus (2597) Google Scholar), suggest the distribution is not simply due to overexpression. Dual wavelength imaging studies demonstrated that the intracellular compartment containing VR1eGFP (green) was distinct from the filamentous mitochondria (red), which were labeled by the red MitoTracker dye and are generally much thicker than the ER (Fig.4 f). Previously it was noted that addition of ionomycin to cells induces intracellular membrane fragmentation due to permeabilization of the plasma membrane to cations (22Subramanian K. Meyer T. Cell. 1997; 89: 963-971Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). This was verified in baseline control studies using the eGFP-KDEL-expressing plasmid, which showed that ionomycin treatment induced membrane fragmentation of the ER (Fig. 4,b versus c). This fragmentation was identical to what occurred with VR1eGFP-expressing cells upon exposure to 1 nm RTX. In these cells a 20-s exposure induced fragmentation of the ER (Fig. 4, d and e) and, simultaneously, a rounding up of the filamentous mitochondria (Fig. 4,f versus g). Testing of a second vanilloid ligand, CAP (1 μm), also demonstrated membrane fragmentation with similar dynamics as noted with RTX (not shown). With the appropriate sets of fluorescence filters, we observed no mixing between the VR1eGFP vesicles (green) and the mitochondrial membranes (red) (data not shown). In cells expressing only eGFP, the structure of the mitochondria and ER did not change upon exposure to vanilloids, indicating the dependence for these effects on the presence of the VR1 receptor. Thus, within the first few seconds after vanilloid exposure, coincident and structu
Referência(s)