Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Drosophila Extracellular Signal-regulated Kinase Involves the Insulin-mediated Proliferation of Schneider Cells

2002; Elsevier BV; Volume: 277; Issue: 17 Linguagem: Inglês

10.1074/jbc.m110366200

ISSN

1083-351X

Autores

Hyung-Bae Kwon, Sun-Hong Kim, Sung‐Eun Kim, In-Hwan Jang, Yong‐Ho Ahn, Won‐Jae Lee, Kang Choi,

Tópico(s)

Protein Tyrosine Phosphatases

Resumo

The Drosophila insulin pathway is involved in the control of the proliferation and size of the cell. The stimulation of Schneider cells with human insulin has been observed to activate Drosophila extracellular signal regulated kinase (DERK). However, the role of DERK in the regulation of proliferation is unknown. In this study, we have identified a role of DERK in the proliferation of Drosophila Schneider cells. The inhibition of DERK activity by the overexpression of DMKP-3, an ERK-specific mitogen-activated protein kinase (MAPK) phosphatase, inhibited G1 to S phase cell cycle progression as well as bromodeoxyuridine (BrdU) incorporation, which were previously increased by human insulin. However, DMKP-3 overexpression did not significantly reduce cell size that was also enlarged by insulin treatment, which suggests the specificity of the ERK pathway in proliferation but not for cell size. G1 to S phase cell cycle progression and BrdU incorporation were also reduced by catalytically inactive DMKP-3 mutant, and they may be acquired by the trapping of DERK into cytosol. The depletion of DERK or DMKP-3 by inhibitory double-stranded RNA decreased and increased BrdU incorporation, respectively. Thus, we propose that DERK is involved in the proliferation of Schneider cells via the insulin pathway. The Drosophila insulin pathway is involved in the control of the proliferation and size of the cell. The stimulation of Schneider cells with human insulin has been observed to activate Drosophila extracellular signal regulated kinase (DERK). However, the role of DERK in the regulation of proliferation is unknown. In this study, we have identified a role of DERK in the proliferation of Drosophila Schneider cells. The inhibition of DERK activity by the overexpression of DMKP-3, an ERK-specific mitogen-activated protein kinase (MAPK) phosphatase, inhibited G1 to S phase cell cycle progression as well as bromodeoxyuridine (BrdU) incorporation, which were previously increased by human insulin. However, DMKP-3 overexpression did not significantly reduce cell size that was also enlarged by insulin treatment, which suggests the specificity of the ERK pathway in proliferation but not for cell size. G1 to S phase cell cycle progression and BrdU incorporation were also reduced by catalytically inactive DMKP-3 mutant, and they may be acquired by the trapping of DERK into cytosol. The depletion of DERK or DMKP-3 by inhibitory double-stranded RNA decreased and increased BrdU incorporation, respectively. Thus, we propose that DERK is involved in the proliferation of Schneider cells via the insulin pathway. The Drosophila extracellular signal-regulated kinase (DERK) 1The abbreviations used are: DERKDrosophila extracellular signal-regulated kinaseMAPKmitogen-activated protein kinaseMKP-3MAPK phosphatase-3ERKextracellular signal-regulated kinaseDMKP-3MAPK phosphatase-3MEKmitogen-activated protein kinase/extracellular signal-regulated kinase kinaseFBSfetal bovine serumBrdUbromodeoxyuridinePBSphosphate-buffered salineDAPI4′,6′-diamidine-2-phenylindole dihydrochlorideFACSfluorescence-activated cell sorterRNAidouble-stranded RNA-mediated interferencedsRNAdouble-stranded RNADJNKDrosophila c-Jun N-terminal kinaseDPI3KDrosophila phosphatidylinositol 3-kinaseDMKP-3-CADMKP-3 Cys-302 → AlaDMKP-3-RRDMKP-3 Arg-56 → Ala Arg-57 → AlaDAKTDrosophila AKT encoded by the rolled locus is involved in a number of developmental events (1.Diaz-Benjumea F.J. Hafen E. Development. 1994; 120: 569-578PubMed Google Scholar, 2.Biggs III, W.H. Zavitz K.H. Dickson B. van der Straten A. Brunner D. Hafen E. Zipursky S.L. EMBO J. 1994; 13: 1628-1635Crossref PubMed Scopus (182) Google Scholar). A gain-of-function mutation in rolled (rl)/DERK called sevenmaker, rlSem, was identified based on its ability to trigger R7 photoreceptor differentiation in the absence of upstream signaling events (3.Brunner D. Oellers N. Szabad J. Biggs W.H. Zipursky S.L. Hafen E. Cell. 1994; 76: 875-888Abstract Full Text PDF PubMed Scopus (381) Google Scholar). The role of DERK in the eye development ofDrosophila was further confirmed by the identification for the need of DERK-activated Ets-related transcription factors during eye development (4.O'Neill E.M. Rebay I. Tjian R. Rubin G.M. Cell. 1994; 78: 137-147Abstract Full Text PDF PubMed Scopus (589) Google Scholar). The Drosophila ERK MAPK pathway uses the receptor tyrosine kinase Ras-ERK cascade as seen in mammals (5.Duffy J.B. Perrimon N. Curr. Opin. Cell Biol. 1996; 8: 231-238Crossref PubMed Scopus (32) Google Scholar), and the roles of Drosophila endothelial growth factor receptor and Ras in the proliferation of cells also have been elucidated (6.Baker N.E. Rubin G.M. Dev. Biol. 1992; 150: 381-396Crossref PubMed Scopus (114) Google Scholar, 7.Karim F.D. Rubin G.M. Development. 1998; 125: 1-9PubMed Google Scholar, 8.Prober D.A. Edgar B.A. Cell. 2000; 100: 435-446Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). However, the role of downstream DERK in the proliferation of cells inDrosophila is not known, although ERK is known to be an important factor for the proliferation in mammals. Drosophila extracellular signal-regulated kinase mitogen-activated protein kinase MAPK phosphatase-3 extracellular signal-regulated kinase MAPK phosphatase-3 mitogen-activated protein kinase/extracellular signal-regulated kinase kinase fetal bovine serum bromodeoxyuridine phosphate-buffered saline 4′,6′-diamidine-2-phenylindole dihydrochloride fluorescence-activated cell sorter double-stranded RNA-mediated interference double-stranded RNA Drosophila c-Jun N-terminal kinase Drosophila phosphatidylinositol 3-kinase DMKP-3 Cys-302 → Ala DMKP-3 Arg-56 → Ala Arg-57 → Ala Drosophila AKT Recent studies (9.Bohni R. Riesgo-Escovar J. Oldham S. Brogiolo W. Stocker H. Andruss B.F. Beckingham K. Hafen E. Cell. 1999; 97: 865-875Abstract Full Text Full Text PDF PubMed Scopus (684) Google Scholar, 10.Montagne J. Stewart M.J. Stocker H. Hafen E. Kozma S.C. Thomas G. Science. 1999; 285: 2126-2129Crossref PubMed Scopus (624) Google Scholar, 11.Gao X. Neufeld T.P. Pan D. Dev. Biol. 2000; 221: 404-418Crossref PubMed Scopus (220) Google Scholar, 12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar) in Drosophila have shown that the insulin pathway is involved in the proliferation of cells as well as organ and cell-size increases. The insulin pathway transmits its signal from the insulin receptor through Chico, a Drosophilahomologue of insulin-receptor substrates, Drosophilaphosphatidylinositol kinase (DPI3K), and Drosophila AKT (also known as protein kinase B) (13.Edgar B.A. Nat. Cell Biol. 1999; 1: E191-E193Crossref PubMed Scopus (62) Google Scholar). However, the overexpression of downstream DAKT leads to increased cell size without affecting proliferation rates, which suggests that the proliferation of cells by insulin signaling could be acquired through a mechanism independent of DAKT (12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar). A recent study (14.Clemens J.C. Worby C.A. Simonson-Leff N. Muda M. Maehama T. Hemmings B.A. Dixon J.E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6499-6503Crossref PubMed Scopus (708) Google Scholar) showed that human insulin stimulates DSOR1, a Drosophila homologue of MEK, and DERK as well as components of the DPI3K-Akt cascade in DrosophilaSchneider cells. However, no role of DERK activation especially related with cell proliferation was illustrated. Recently, we identified aDrosophila homologue of mammalian MKP-3, DMKP-3, which has a high substrate specificity toward DERK (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). When overexpressed in Schneider cells, DMKP-3 specifically inhibited DERK activity without noticeable effects toward DJNK and Drosophila p38. DMKP-3 also specifically interacted with DERK at its N-terminal docking site motif (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). In this study, we investigated the role of DERK in Schneider cell proliferation by modulating ERK activity using both overexpression and partial knock-out methodologies. By overexpressing DMKP-3 within Schneider cells, we identified the role of DERK in cell proliferation. This finding was detected by inhibition profiles of the G1to S cell cycle progression and by BrdU incorporation. The role of DERK in Schneider cell proliferation was further confirmed by double-stranded RNA (dsRNA)-mediated interference (RNAi) of DERK and DMKP-3 (14.Clemens J.C. Worby C.A. Simonson-Leff N. Muda M. Maehama T. Hemmings B.A. Dixon J.E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6499-6503Crossref PubMed Scopus (708) Google Scholar, 16.Caplen N.J. Fleenor J. Fire A. Morgan R.A. Gene (Amst.). 2000; 252: 95-105Crossref PubMed Scopus (198) Google Scholar). To the best our knowledge, our study demonstrates for the first time evidence for the role of DERK in Drosophilacell proliferation. The Drosophila DMKP-3 expression vector, pPacPL-DMKP-3, was generated by PCR (primers 5′-GGAATTCGGCTCTAGACCATGGCAGAAACGGAGCACGA-3′ and 5′-GGCAACGGCGATGTGGCGGCCGCTGCAAATGGGATCTC-3′) and template pOT2-DMKP-3 (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar) followed by subcloning of the fragment at theXbaI-NotI site of pPacPL (17.Han S.J. Choi K.Y. Brey P.T. Lee W.J. J. Biol. Chem. 1998; 273: 369-374Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). The pPacPL-DMKP-3-Myc vector derived by inserting SmaI andNotI cleaved a 1.4-kbp PCR product (primers 5′-CAGGAATTCGCCCGGGGAAAATGCCAGAAACGGAG-3′ and 5′-GGCAACGGCGATGTGGCGGCCGCTGCAAATGGGATCTC-3′) and template pOT2-DMKP-3-Myc (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar) into the EcoRV-NotI site of pPacPL. pPacPL-DMKP-3-CA-Myc and pPacPL-DMKP-3-RR-Myc were generated by site-directed mutagenesis of pPacPL-DMKP-3-Myc using previously described primers (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). pPacPL-DMKP-3-CA/pPacPL-DMKP-3-RR were generated by site-directed mutagenesis of pPacPL-DMKP-3, and pPacPL-DMKP-3-CA-RR was generated by site-directed mutagenesis of pPacPL-DMKP-3-RR by using primers used for generating DMKP-3-CA and DMKP-3-RR (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). Copper-inducible pMT/V5-DMKP-3 and pMT/V5-DMKP-3-CA vectors have also been described in a previous study (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). TheSmaI-XhoI fragment from pOT2-DMKP-3-R56A/R57A (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar) was subcloned into pMT/V5 vector under the control of copper-inducible promoter (Invitrogen) to generate the pMT/V5-DMKP3-RR mutant. The BamHI-PvuI fragment of pOT2-DMKP-3-R56A/R57A was removed and exchanged with theBamHI-PvuI fragment of pPacPL-DMKP-3-CA-RR-Myc. The SmaI-XhoI fragment of this recombinant vector was subsequently subcloned into theEcoRV-XhoI sites of pMT/V5 to generate pMT/V5-DMKP-3-CA-RR double mutant. Stable Schneider cells containing a copper-inducible DMKP-3 or DMKP-3-CA were described in a previous study (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). Cells stably expressing DMKP3-RR or DMKP3-CA-RR mutant were generated as described previously (18.Lee W.J. Kim S.H. Kim Y.S. Han S.J. Park K.S. Ryu J.H. Hur M.W. Choi K.Y. Biochem. J. 2000; 349: 821-828Crossref PubMed Scopus (17) Google Scholar). Schneider cells were maintained in Schneider's insect medium (Sigma), and the induction of DMKP-3 proteins was performed as described by Kim et al. (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). The activation of DERK was performed by treatment with 10 μg/ml human insulin for 5 min (14.Clemens J.C. Worby C.A. Simonson-Leff N. Muda M. Maehama T. Hemmings B.A. Dixon J.E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6499-6503Crossref PubMed Scopus (708) Google Scholar). The cell extracts were made using a lysis buffer as described previously (18.Lee W.J. Kim S.H. Kim Y.S. Han S.J. Park K.S. Ryu J.H. Hur M.W. Choi K.Y. Biochem. J. 2000; 349: 821-828Crossref PubMed Scopus (17) Google Scholar). Samples were quantitated and immediately used for assay or stored at −70 °C. 50–100 μg of protein from whole cell extracts was separated by 8–10% SDS-PAGE, and Western blot analysis performed as described previously (18.Lee W.J. Kim S.H. Kim Y.S. Han S.J. Park K.S. Ryu J.H. Hur M.W. Choi K.Y. Biochem. J. 2000; 349: 821-828Crossref PubMed Scopus (17) Google Scholar). The activation of endogenous DERK was determined by using phospho-specific anti-ERK antibody (New England Bio Labs). DMKP-3 proteins were detected by purified anti-DMKP-3 rabbit polyclonal antibody (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). α-Tubulin was also detected as a control by using anti-α-tubulin antibody (Calbiochem). Blots were probed with horseradish peroxidase-conjugated goat anti-mouse IgG (Bio-Rad) and goat anti-rabbit IgG (Promega) secondary antibodies and visualized by enhanced chemiluminescence (Genepia). The Schneider cell line, DMKP-3, and DMKP-3-CA stable cell lines were grown to 50% confluence in Schneider medium containing 10% FBS. The cells were then treated with 1 mm CuSO4 for DMKP-3 or DMKP-3-CA induction and grown for 69 h before harvesting cells for fluorescent-activating cell sorting (FACS) analysis. In some cases, the cells were treated with human insulin (10 μg/ml) for 24 h before harvesting. Cells collected from 6-well plates were rinsed twice with PBS and fixed by adding 70% cold ethanol. The cells were washed with PBS containing 1% horse serum. Subsequently, the DNA was stained with 100 μg/ml propidium iodide for 30 min at 4 °C. The cell cycle profile and forward scatter were determined using a Becton Dickinson FACS Caliber, and data were analyzed using the ModFit LT 2.0 (Verity Software House, Inc.) and WinMDI 2.8 (created by Joseph Trotter, Scripps Research Institute, La Jolla, CA). For DERK localization studies, Schneider cells were co-transfected with DMKP-3 expression vector (pPacPL-DMKP-3-Myc, pPacPL-DMKP-3-CA-Myc, or pPacPL-DMKP-3-R56A/R57A-Myc) and pPacPL-DERK-His in a 5:1 ratio using the calcium phosphate precipitation method as described previously (17.Han S.J. Choi K.Y. Brey P.T. Lee W.J. J. Biol. Chem. 1998; 273: 369-374Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar) and further grown for 36 h posttransfection. The cells were then fixed and permeabilized with 100% methanol at −20 °C for 15 min and blocked by incubating with PBS containing 1% bovine serum albumin and 5% goat serum for 30 min at room temperature. The coverslips were incubated with appropriately diluted DMKP-3, anti-rabbit-c-Myc (1:100, Santa Cruz Biotechnology), or anti-mouse-RGS·His antibody (1:100, Qiagen) in the blocking solution for 2 h, and then washed three times with PBS. Secondary antibody reaction was performed for 1 h in 50% glycerol solution containing goat anti-rabbit Rhodamine Red™ X-conjugated IgG secondary antibody (1:100 diluted, Jackson Immuno Research Laboratories, Inc., West Grove, PA) for detecting DMKP-3, goat anti-mouse-Cy2-conjugated secondary antibody at 1:100 dilution for His-DERK, or goat anti-rabbit-rhodamine-conjugated secondary antibody at a 1:100 for detecting DMKP-3-Myc proteins. DAPI was then treated at a final concentration of 1 μm in PBS for 10 min, and the cells were extensively washed with PBS and mounted for photography using a Radiance 2000/MP, multiphoton imaging system (Bio-Rad). For the BrdU incorporation studies, Schneider cells were grown at 23 °C to 60% confluence on coverslips in 6-well plates. They were then transfected with calcium phosphate as described previously (17.Han S.J. Choi K.Y. Brey P.T. Lee W.J. J. Biol. Chem. 1998; 273: 369-374Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar) with 7 μg of pPacPL vector, pPacPL-DMKP-3, pPacPL-DMKP-3-CA, pPacPL-DMKP-3-RR, or pPacPL-DMKP-3-CA-RR. After 24 h, the cells were washed with fresh medium containing 10% FBS and allowed to grow for 24 h with media and with or without 10 μg/ml human insulin. BrdU labeling was performed over the last 4 h, and the cells were fixed with methanol/formaldehyde (99:1) for 15 min at −20 °C and permeabilized with 0.2% Triton X-100 in PBS for 5 min at room temperature. The slips were then incubated with anti-DMKP-3 antibody (1:100) prior to incubating with rhodamine-conjugated anti-rabbit secondary antibody (1:100). The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, washed in PBS, and treated with HCl (2 m) for 30 min for BrdU antibody. Cells were washed with PBS for five times, blocked in PBS containing 1% bovine serum albumin and 5% goat serum, and incubated with anti-BrdU monoclonal antibody (Jackson Immuno Research) in the blocking solution, which was followed by incubation in a mixture of Cy2-conjugated anti-mouse secondary antibody (Jackson Immuno Research). For DNA staining, fixed cells were incubated with 1 μg/ml DAPI (Roche Molecular Biochemicals). Each experiment was performed at least three times. DERK and DMKP-3 dsRNAs were made as described previously (14.Clemens J.C. Worby C.A. Simonson-Leff N. Muda M. Maehama T. Hemmings B.A. Dixon J.E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6499-6503Crossref PubMed Scopus (708) Google Scholar), and dsDNA was made before in vitro transcription. DERK dsRNA was obtained by PCR (GenBank™ accession number M95126) against nucleotides 306–325 (sense primer) and 1066–1084 (antisense primers) using pBluescript-DERK (kindly provided by Dr. Ernst Hafen, Universitat Zurich, Switzerland). DMKP-3 dsRNA was also made by PCR of pOT2-DMKP-3 (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar) against nucleotides 81–97 (sense primer) and 775–793 (antisense primer). Each primer was designed to contain a T7 RNA polymerase binding site (GAATTAATACGACTCACTATAGGGAGA) at its 5′ end. Each dsRNA was synthesized using a MEGAscript T7 transcription kit (Ambion). All dsRNAs were extracted by phenol/chloroform extraction followed by ethanol precipitation and resuspension in water. The treatment of Schneider cells with human insulin activates DERK by phosphorylation within 5 min (Fig. 1 A) (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). Simultaneously, the phospho-DERK proteins are significantly translocated into nuclei of the cells (Fig. 1 A). To understand the role of DERK activation in Schneider cell proliferation, we monitored the progression of the cell cycle by analyzing the proportion of cells progressing from the G1 to S phase following the treatment of the cells with insulin and checked the effects of DMKP-3 overexpression (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). The human insulin stimulated the G1 to S phase cell cycle progression of Schneider cells, therefore, the fraction of cells in G0/G1 was decreased, and the relative portion of cells in the S phase was increased (Fig. 1 B). The G1 to S phase cell cycle progression by insulin was significantly blocked by the induction of DMKP-3 with CuSO4, therefore, the fraction of cells in the S phase was decreased from 52 to 33% (Fig. 1 B). Although the catalytically inactive mutant, DMKP-3-CA, lost most of its phosphatase activity (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar), it significantly retained the capacity to inhibit G1 to S progression (Fig. 1 B). Therefore, the percentage of cells in the S phase was reduced from 47 to 37% by the induction of DMKP-3-CA in the cells treated with insulin (Fig. 1 B). The retention of the inhibitory effect on G1 to S phase progression of the catalytic mutant DMKP-3-CA suggests that CuSO4, which is used to induce the proteins, contributes partly to the inhibition of the G1 to S phase progression, or alternatively that the DMKP-3-CA mutant retains some cell cycle inhibitory function. Actually, the CuSO4 itself contributed somewhat to the inhibition of the G1 to S phase cell cycle progression, which was made evident by a control experiment using Schneider cells without a CuSO4-inducibleDMKP-3 gene (Fig. 1 B). However, the percentage of cells in the S phase, which decreased by CuSO4 treatment, was greater in DMKP-3-CA stable cells from 47% to 37% compared with that observed in Schneider cells (37% to 32%). Therefore, the DMKP-3-CA mutant partly retains the ability to inhibit G1 to S phase cell cycle progression. To confirm the role of DMKP-3 and to exclude the effect of CuSO4 on the regulation of G1 to S cell cycle progression, we expressed the DMKP-3 protein by transient transfection and monitored DNA synthesis by BrdU incorporation (19.Brunet A. Roux D. Lenormand P. Dowd S. Keyse S. Pouyssegur J. EMBO J. 1999; 18: 664-674Crossref PubMed Scopus (517) Google Scholar). Under the cell growth condition used, ∼33% of cells actively incorporated BrdU, and the percentage of cells incorporating BrdU was increased ∼2.5-fold with the insulin treatment (Fig. 2), which demonstrates that insulin has a strong positive effect on DNA synthesis. BrdU incorporation was almost blocked in cells expressing DMKP-3, and only 6 and 15% of the cells expressing DMKP-3 incorporated BrdU in the absence or presence of insulin, respectively (Fig. 2, representative cells are shown in lower panel). Upon expressing the DMKP-3-CA catalytic mutant, the percentage of cells incorporating BrdU, which was increased by insulin treatment, was decreased to the uninduced level (i.e. from 83 to 35%) in cells treated with insulin (Fig. 2, upper panel). However, the percentage of cells incorporating BrdU was not reduced by DMKP-3-CA overexpression when the cells were grown in medium that was not treated with insulin (Fig. 2, upper panel). Therefore, the catalytic mutant DMKP-3-CA may retain an inhibitory role in G1 to S progression, especially in cells stimulated with insulin. To determine the role of the DERK binding ability of DMKP-3 in the inhibition of G1 to S phase progression, we also measured BrdU incorporation in cells expressing DMKP-3-RR (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar), the DERK binding mutant. The induction of DMKP-3-RR and of the DMKP-3-CA-RR double mutant did not markedly reduce the phospho-DERK levels under various expression levels. 2H.-B. Kwon and K.-Y. Choi, unpublished results. In addition, neither DMKP-3-RR nor DMKP-3-CA-RR significantly reduced the percentage of cells incorporating BrdU (Fig. 2, upper panel). Therefore, the DERK binding ability of DMKP-3 is essential for the regulation of the G1 to S phase cell cycle progression of Schneider cells. To understand the role of DERK in the control of cell size, we used data obtained from FACS analysis as forward scatter value comparisons (8.Prober D.A. Edgar B.A. Cell. 2000; 100: 435-446Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar, 12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar). We found that human insulin also stimulates an increase in the size of Schneider cells as well as promotes the G1 to S cell cycle transition. However, the cell size increase caused by insulin stimulation was not significantly blocked by the induction of either DMKP-3 or DMKP-3-CA by CuSO4 as the control Schneider cells were treated with CuSO4 (Fig. 3, compare upper three panelswith middle three panels). The inhibition of G1 to S phase cell cycle progression by catalytically inactive DMKP-3-CA mutant suggested that the DMKP-3 protein can regulate DERK activity by mechanism(s) other than catalysis. It is known that several MAPK phosphatases including mammalian MKP-3, can regulate MAPK by substrate trapping (19.Brunet A. Roux D. Lenormand P. Dowd S. Keyse S. Pouyssegur J. EMBO J. 1999; 18: 664-674Crossref PubMed Scopus (517) Google Scholar, 20.Mattison C.P. Ota I.M. Genes Dev. 2000; 14: 1229-1235PubMed Google Scholar). Therefore, we tested whether DMKP-3 can trap DERK within the cytoplasm of Schneider cells. In this case, we co-transfected plasmids for Myc-tagged DMKP-3 (DMKP-3-Myc) and His-tagged DERK (DERK-His) proteins and immunocytochemically localized the proteins. DERK-His proteins were found to be significantly localized in the cytoplasm when co-expressed with DMKP-3-Myc. The cytosolic localization of DERK-His was even more significant when cells were co-expressed together with the catalytically inactive DMKP-3-CA-Myc (Fig. 4). However, DERK proteins were significantly localized at the nuclei of cells by co-transfection with DMKP-3-RR-Myc, which had substantially lost its DERK binding capacity (Fig. 4) (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). To identify the role of DERK in the proliferation of Schneider cells more directly, we depleted DERK or DMKP-3 protein by RNAi (14.Clemens J.C. Worby C.A. Simonson-Leff N. Muda M. Maehama T. Hemmings B.A. Dixon J.E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6499-6503Crossref PubMed Scopus (708) Google Scholar). The DERK protein levels were significantly lowered by DERK RNAi, and DERK activities, which were determined by phospho-ERK levels, were also subsequently lowered (Fig. 5 A). The insulin dependence of the activation of DERK activity was similarly observed in cells depleted in DERK (Fig. 5 A). Interestingly, the insulin dependence on the activation of DERK was almost abolished in cells treated with DMKP-3 dsRNA, and therefore, the phospho-ERK level was high even without insulin stimulation (Fig. 5 A). Because of limitation in the detection of endogenous DMKP-3 within Schneider cells (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar), the effectiveness of DMKP-3 RNAi was proven by monitoring the level of transiently expressed DMKP-3-Myc both by Western blot and immunocytochemical analyses. These findings showed complete depletion of DMKP-3-Myc (Fig. 5 B). The treatment of DERK dsRNA caused percentages of cells incorporating BrdU to be reduced in both cells treated or not treated with insulinversus the control cells (Fig. 6). On the other hand, BrdU-positive cells were increased 69% by DMKP-3 RNAi in cells not treated with insulin. However, the percentage of BrdU-positive cells was not increased by DMKP-3 RNAi in cells stimulated with insulin (Fig. 6). Actually, the percentage of BrdU-positive cells was high without insulin treatment, and this was not increased further by DMKP-3 RNAi (Fig. 6). In addition, these results correlated with the phospho-DERK levels (Fig. 5). The ERK pathway is an important signaling pathway for the proliferation and differentiation of cells, and aberrant regulation of the pathway often results in cancers in mammals and abnormal development in Drosophila (1.Diaz-Benjumea F.J. Hafen E. Development. 1994; 120: 569-578PubMed Google Scholar, 3.Brunner D. Oellers N. Szabad J. Biggs W.H. Zipursky S.L. Hafen E. Cell. 1994; 76: 875-888Abstract Full Text PDF PubMed Scopus (381) Google Scholar, 6.Baker N.E. Rubin G.M. Dev. Biol. 1992; 150: 381-396Crossref PubMed Scopus (114) Google Scholar, 21.Joneson T. Bar-Sagi D. J. Mol. Med. 1997; 75: 587-593Crossref PubMed Scopus (146) Google Scholar, 22.Mansour S.J. Matten W.T. Hermann A.S. Candia J.M. Rong S. Fukasawa K. Vande Woude G.F. Ahn N.G. Science. 1994; 265: 966-970Crossref PubMed Scopus (1260) Google Scholar, 23.Baker N.E. Rubin G.M. Nature. 1989; 340: 150-153Crossref PubMed Scopus (172) Google Scholar). The role of the ERK pathway in the proliferation of cells is well characterized in mammals and is mediated by the activation of the cell cycle machinery, which regulates G1 to S phase progression (24.Kerkhoff E. Rapp U.R. Oncogene. 1998; 17: 1457-1462Crossref PubMed Scopus (225) Google Scholar, 25.Pages G. Lenormand P. L'Allemain G. Chambard J.C. Meloche S. Pouyssegur J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8319-8323Crossref PubMed Scopus (925) Google Scholar). InDrosophila, the ERK pathway has been mainly studied with respect to several developmental processes including eye development and the specification of terminal structures in the embryo (1.Diaz-Benjumea F.J. Hafen E. Development. 1994; 120: 569-578PubMed Google Scholar, 3.Brunner D. Oellers N. Szabad J. Biggs W.H. Zipursky S.L. Hafen E. Cell. 1994; 76: 875-888Abstract Full Text PDF PubMed Scopus (381) Google Scholar, 4.O'Neill E.M. Rebay I. Tjian R. Rubin G.M. Cell. 1994; 78: 137-147Abstract Full Text PDF PubMed Scopus (589) Google Scholar,6.Baker N.E. Rubin G.M. Dev. Biol. 1992; 150: 381-396Crossref PubMed Scopus (114) Google Scholar). However, the upstream components of the ERK pathway, epidermal growth factor receptor and Drosophila RAS, are known to be involved in Drosophila cell division and growth (6.Baker N.E. Rubin G.M. Dev. Biol. 1992; 150: 381-396Crossref PubMed Scopus (114) Google Scholar, 8.Prober D.A. Edgar B.A. Cell. 2000; 100: 435-446Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar, 23.Baker N.E. Rubin G.M. Nature. 1989; 340: 150-153Crossref PubMed Scopus (172) Google Scholar). Currently, the role of downstream MAPK module kinases (26.Cano E. Mahadevan L.C. Trends Biochem. Sci. 1995; 20: 117-122Abstract Full Text PDF PubMed Scopus (997) Google Scholar) including DERK in the proliferation of cells has not been illustrated in Drosophila. Drosophila insulin receptor also transduces a signal for the positive regulation of growth (27.Fernandez R. Tabarini D. Azpiazu N. Frasch M. Schlessinger J. EMBO J. 1995; 14: 3373-3384Crossref PubMed Scopus (266) Google Scholar, 28.Leevers S.J. Weinkove D. MacDougall L.K. Hafen E. Waterfield M.D. EMBO J. 1996; 15: 6584-6594Crossref PubMed Scopus (417) Google Scholar, 29.Chen C. Jack J. Garofalo R.S. Endocrinology. 1996; 137: 846-856Crossref PubMed Scopus (282) Google Scholar). The DInr, DAkt, Chico, and Dp110 (homologues of mammalian insulin receptors Akt, IRS, and PI3-K, respectively) influence both cell size and numbers in theDrosophila wing (28.Leevers S.J. Weinkove D. MacDougall L.K. Hafen E. Waterfield M.D. EMBO J. 1996; 15: 6584-6594Crossref PubMed Scopus (417) Google Scholar, 30.Weinkove D. Neufeld T.P. Twardzik T. Waterfield M.D. Leevers S.J. Curr. Biol. 1999; 9: 1019-1029Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar), and a reduction in the components resulted in the inhibition of both cell growth and cell size (27.Fernandez R. Tabarini D. Azpiazu N. Frasch M. Schlessinger J. EMBO J. 1995; 14: 3373-3384Crossref PubMed Scopus (266) Google Scholar, 29.Chen C. Jack J. Garofalo R.S. Endocrinology. 1996; 137: 846-856Crossref PubMed Scopus (282) Google Scholar,30.Weinkove D. Neufeld T.P. Twardzik T. Waterfield M.D. Leevers S.J. Curr. Biol. 1999; 9: 1019-1029Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar). On the other hand, the expression of DAKT increased cell size without increasing cell numbers and proliferation rates in imaginal discs (12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar). Therefore, the insulin receptor signaling pathway may regulate cell growth at the upstream of DAKT and be independent of DAKT, which involves size control. However, it is unknown how insulin receptor stimulates the proliferation of Drosophila cells, and it is also not clear whether this is because of direct modulation of the cell cycle machinery or other secondary effects (12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar). The stimulation of Schneider cells with human insulin caused the activation of the components of both DPI3K-DAKT and DSOR1-DERK cascades (14.Clemens J.C. Worby C.A. Simonson-Leff N. Muda M. Maehama T. Hemmings B.A. Dixon J.E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6499-6503Crossref PubMed Scopus (708) Google Scholar). However, the physiological role(s) associated with the activation of the cascade was not characterized. In this study, we found that human insulin promotes cell proliferation through the G1 to S phase transition. G1 to S phase cell cycle progression and BrdU incorporation were significantly inhibited by DMKP-3 overexpression. This result suggests that insulin may stimulate G1 to S phase cell cycle progression through the activation of DERK. Although the DMKP-3-CA catalytic mutant essentially lost its DERK inhibitory function in vitro (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar), it significantly inhibited G1 to S phase cell cycle progression, especially in cells stimulated with insulin (Fig. 2, upper panel). The reduced number of BrdU-positive cells caused by DMKP-3-CA overexpression suggests that other function(s) of DMKP-3 rather than catalysis may be involved in the inhibition of insulin-stimulated cell proliferation. The cytosolic trapping of DERK by DMKP-3 could be an alternative mechanism for the inhibition of cell proliferation, and this was proven by the co-localization of DERK-His and DMKP-3-Myc and the differential localization of DERK-His and the DERK binding mutant, DMKP-3-RR (Fig. 4). DMKP-3-RR, which was defective in DERK binding ability, did not trap DERK in the cytosol, therefore, significant amounts of the DERK proteins were localized into the nuclei. Hence, the DMKP-3-RR and DMKP-3-CA-RR mutants, which did not interact with DERK, could not inhibit BrdU incorporation. Unexpectedly, the expression of the DMKP-3-CA-Myc catalytic mutant caused lower amounts of DERK-His proteins to be localized in the nucleus compared with the cells that co-expressed the wild-type DMKP-3-Myc. These results may attributed to the tighter interaction between DMKP-3-CA catalytic mutant and DERK as compared with the wild-type DMKP-3 (15.Kim S.H. Kwon H.-B. Kim Y.-S. Ryu J.-H. Kim K.-S. Ahn Y. Lee W.-J. Choi K.-Y. Biochem. J. 2002; 361: 143-151Crossref PubMed Scopus (29) Google Scholar). The cytosolic trapping of several MAPKs by specific MKPs was also observed in the mammalian and yeast system (19.Brunet A. Roux D. Lenormand P. Dowd S. Keyse S. Pouyssegur J. EMBO J. 1999; 18: 664-674Crossref PubMed Scopus (517) Google Scholar, 20.Mattison C.P. Ota I.M. Genes Dev. 2000; 14: 1229-1235PubMed Google Scholar). Interestingly, we observed that the inhibition of BrdU incorporation by DMKP-3-CA catalytic mutant only occurs in cells stimulated with insulin (Fig. 2, upper panel). Although less significant, we observed similar DMKP-3-CA effects in terms of the reduced percentage of cells at the S phase by insulin treatment (from 47 to 37%) compared with the reduction observed with no insulin treatment (from 33 to 28%) (Fig. 1 B). To identify the mechanism of DMKP-3-CA action in the inhibition of insulin-stimulated cell proliferation, we also measured BrdU incorporation in cells expressing DERK binding mutants, DMKP-3-RR and DMKP-3-CA-RR. In these experiments, the expression of neither DMKP-3-RR nor DMKP-3-CA-RR significantly lowered the percentage of cells incorporating BrdU even in cells stimulated with insulin (Fig. 2,upper panel). Therefore, the DERK binding ability of DMKP-3, which involved DERK sequestration within the cytosol, is essential to inhibit insulin-stimulated cell proliferation. BrdU incorporation was not significantly reduced by DMKP-3-RR or DMKP-3-CA-RR induction in basal cells not treated with insulin (Fig. 2, upper panel). These results suggest that DERK binding is prerequisite for catalysis and the subsequent inhibition of cell proliferation. The percentage of cells incorporated BrdU was also decreased by wild-type DMKP-3 in cells not treated with insulin. How does the DMKP-3 block basal BrdU incorporation but not DMKP-3-CA? Without insulin treatment, levels of both phospho-ERK and the percentage of cells incorporating BrdU were significantly up-regulated by DMKP-3 RNAi (Figs. 5 A and6 B), and the levels of phospho-ERK and the percentage of cells incorporating BrdU were almost equivalent to those observed in insulin-stimulated cells. These results suggest that DMKP-3 has a catalytic role in the regulation of basal ERK activity and the subsequent inhibition of basal BrdU incorporation. However, the percentage of cells inhibited BrdU incorporation by wild-type DMKP-3 expression in the basal status cells is more significant than the level inhibited by DMKP-3-CA expression (Fig. 2 B). These results further suggest that DMKP-3 may synergistically and subtly regulate cell proliferation through the coordinated dephosphorylation and cytosolic trapping of DERK. The levels of phospho-DERK and percentage of BrdU-incorporating cells were significantly decreased by DERK RNAi in both basal and insulin-stimulated cells, which suggest again the importance of DERK in the regulation of cell proliferation. In conclusion, we have identified the role of DERK in Schneider cell proliferation, which involves insulin signaling. In addition, we suggest that DMKP-3 plays important roles in the regulation of both basal and insulin-stimulated cell proliferation by catalysis and the trapping of DERK, respectively. The size increase of Schneider cells caused by insulin treatment provides evidence of the insulin pathway in the size increase of Schneider cells, and this finding agrees with previous observation in Drosophila imaginal disc or wing (9.Bohni R. Riesgo-Escovar J. Oldham S. Brogiolo W. Stocker H. Andruss B.F. Beckingham K. Hafen E. Cell. 1999; 97: 865-875Abstract Full Text Full Text PDF PubMed Scopus (684) Google Scholar,12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar). Although DERK was activated by insulin treatment in Schneider cells, the DERK activation was not involved in the size increase. The size increase of Schneider cells may be acquired by alternative route(s) such as the DPI3K-DAKT cascade (11.Gao X. Neufeld T.P. Pan D. Dev. Biol. 2000; 221: 404-418Crossref PubMed Scopus (220) Google Scholar, 12.Verdu J. Buratovich M.A. Wilder E.L. Birnbaum M.J. Nat. Cell Biol. 1999; 1: 500-506Crossref PubMed Scopus (314) Google Scholar). We thank Dr. J. E. Dixon for reading manuscript and providing suggestions.

Referência(s)