Membrane Type-1 Matrix Metalloproteinase (MT1-MMP) Exhibits an Important Intracellular Cleavage Function and Causes Chromosome Instability
2005; Elsevier BV; Volume: 280; Issue: 26 Linguagem: Inglês
10.1074/jbc.m502779200
ISSN1083-351X
AutoresVladislav S. Golubkov, Sarah Boyd, Alexei Y. Savinov, Alexei V. Chekanov, Andrei L. Osterman, Albert G. Remacle, Dmitri V. Rozanov, Stephen Doxsey, Alex Y. Strongin,
Tópico(s)Peptidase Inhibition and Analysis
ResumoElevated expression of membrane type-1 matrix metalloproteinase (MT1-MMP) is closely associated with malignancies. There is a consensus among scientists that cell surface-associated MT1-MMP is a key player in pericellular proteolytic events. Now we have identified an intracellular, hitherto unknown, function of MT1-MMP. We demonstrated that MT1-MMP is trafficked along the tubulin cytoskeleton. A fraction of cellular MT1-MMP accumulates in the centrosomal compartment. MT1-MMP targets an integral centrosomal protein, pericentrin. Pericentrin is known to be essential to the normal functioning of centrosomes and to mitotic spindle formation. Expression of MT1-MMP stimulates mitotic spindle aberrations and aneuploidy in non-malignant cells. Volumes of data indicate that chromosome instability is an early event of carcinogenesis. In agreement, the presence of MT1-MMP activity correlates with degraded pericentrin in tumor biopsies, whereas normal tissues exhibit intact pericentrin. We believe that our data show a novel proteolytic pathway to chromatin instability and elucidate the close association of MT1-MMP with malignant transformation. Elevated expression of membrane type-1 matrix metalloproteinase (MT1-MMP) is closely associated with malignancies. There is a consensus among scientists that cell surface-associated MT1-MMP is a key player in pericellular proteolytic events. Now we have identified an intracellular, hitherto unknown, function of MT1-MMP. We demonstrated that MT1-MMP is trafficked along the tubulin cytoskeleton. A fraction of cellular MT1-MMP accumulates in the centrosomal compartment. MT1-MMP targets an integral centrosomal protein, pericentrin. Pericentrin is known to be essential to the normal functioning of centrosomes and to mitotic spindle formation. Expression of MT1-MMP stimulates mitotic spindle aberrations and aneuploidy in non-malignant cells. Volumes of data indicate that chromosome instability is an early event of carcinogenesis. In agreement, the presence of MT1-MMP activity correlates with degraded pericentrin in tumor biopsies, whereas normal tissues exhibit intact pericentrin. We believe that our data show a novel proteolytic pathway to chromatin instability and elucidate the close association of MT1-MMP with malignant transformation. Matrix metalloproteinases (MMP(s)) 1The abbreviations used are: MMP, matrix metalloproteinase; MT1, membrane type-1; CT, cytoplasmic tail; MDCK, Madin-Darby canine kidney; siRNA, small interfering RNA; GFP, green fluorescent protein; PoPS, prediction of protease specificity; PDX, α1-anti-trypsin Portland. 1The abbreviations used are: MMP, matrix metalloproteinase; MT1, membrane type-1; CT, cytoplasmic tail; MDCK, Madin-Darby canine kidney; siRNA, small interfering RNA; GFP, green fluorescent protein; PoPS, prediction of protease specificity; PDX, α1-anti-trypsin Portland. are a comprehensive family of zinc-enzymes that degrade the extracellular matrix and cell surface molecules (1Egeblad M. Werb Z. Nat. Rev. Cancer. 2002; 2: 161-174Crossref PubMed Scopus (5087) Google Scholar). Understanding the function of these enzymes in carcinogenesis is critical for the design of anti-cancer pharmaceuticals (2Overall C.M. Lopez-Otin C. Nat. Rev. Cancer. 2002; 2: 657-672Crossref PubMed Scopus (1129) Google Scholar). MT1-MMP is a prototypic member of the membrane-tethered MMP subfamily (3Zucker S. Pei D. Cao J. Lopez-Otin C. Curr. Top. Dev. Biol. 2003; 54: 1-74Crossref PubMed Google Scholar). A transmembrane domain and a cytoplasmic tail (CT) of MT1-MMP associate this abundant membrane-tethered protease with discrete regions of the plasma membrane and the intracellular milieu, respectively. Although MT1-MMP is present in normal tissues, its enhanced expression, unlike of any other of the 23 known human MMPs, is closely associated with aggressive, invasive malignancies (1Egeblad M. Werb Z. Nat. Rev. Cancer. 2002; 2: 161-174Crossref PubMed Scopus (5087) Google Scholar, 3Zucker S. Pei D. Cao J. Lopez-Otin C. Curr. Top. Dev. Biol. 2003; 54: 1-74Crossref PubMed Google Scholar, 4Hotary K.B. Allen E.D. Brooks P.C. Datta N.S. Long M.W. Weiss S.J. Cell. 2003; 114: 33-45Abstract Full Text Full Text PDF PubMed Scopus (570) Google Scholar, 5Sabeh F. Ota I. Holmbeck K. Birkedal-Hansen H. Soloway P. Balbin M. Lopez-Otin C. Shapiro S. Inada M. Krane S. Allen E. Chung D. Weiss S.J. J. Cell Biol. 2004; 167: 769-781Crossref PubMed Scopus (482) Google Scholar). MT1-MMP transgenic mice displayed mammary gland abnormalities and tumor promotion in mammary gland (6Ha H.Y. Moon H.B. Nam M.S. Lee J.W. Ryoo Z.Y. Lee T.H. Lee K.K. So B.J. Sato H. Seiki M. Yu D.Y. Cancer Res. 2001; 61: 984-990PubMed Google Scholar). MT1-MMP functions as one of the main mediators of proteolytic events on the cell surface, and it is directly involved in the pericellular proteolysis of the extracellular matrix, cell surface adhesion, and signaling receptors and in the activation pathway of soluble secretory MMPs (5Sabeh F. Ota I. Holmbeck K. Birkedal-Hansen H. Soloway P. Balbin M. Lopez-Otin C. Shapiro S. Inada M. Krane S. Allen E. Chung D. Weiss S.J. J. Cell Biol. 2004; 167: 769-781Crossref PubMed Scopus (482) Google Scholar, 7Chun T.H. Sabeh F. Ota I. Murphy H. McDonagh K.T. Holmbeck K. Birkedal-Hansen H. Allen E.D. Weiss S.J. J. Cell Biol. 2004; 167: 757-767Crossref PubMed Scopus (278) Google Scholar, 8Holmbeck K. Bianco P. Yamada S. Birkedal-Hansen H. J. Cell Physiol. 2004; 200: 11-19Crossref PubMed Scopus (149) Google Scholar, 9Cowell S. Knauper V. Stewart M.L. D'Ortho M.P. Stanton H. Hembry R.M. Lopez-Otin C. Reynolds J.J. Murphy G. Biochem. J. 1998; 331: 453-458Crossref PubMed Scopus (152) Google Scholar) Cell surface-associated MT1-MMP acts as a growth factor in malignant cells and assumes tumor growth control (4Hotary K.B. Allen E.D. Brooks P.C. Datta N.S. Long M.W. Weiss S.J. Cell. 2003; 114: 33-45Abstract Full Text Full Text PDF PubMed Scopus (570) Google Scholar). The conditional expression of MT1-MMP can, by itself, confer tumorigenicity on non-malignant epithelial cells and cause the formation of invasive tumors (10Soulie P. Carrozzino F. Pepper M.S. Strongin A.Y. Poupon M.F. Montesano R. Oncogene. 2005; 24: 1689-1697Crossref PubMed Scopus (40) Google Scholar). MT1-MMP also plays an important role in normal development; MT1-MMP knock-out mice are dwarfs, and they die prematurely (8Holmbeck K. Bianco P. Yamada S. Birkedal-Hansen H. J. Cell Physiol. 2004; 200: 11-19Crossref PubMed Scopus (149) Google Scholar, 11Holmbeck K. Bianco P. Caterina J. Yamada S. Kromer M. Kuznetsov S.A. Mankani M. Robey P.G. Poole A.R. Pidoux I. Ward J.M. Birkedal-Hansen H. Cell. 1999; 99: 81-92Abstract Full Text Full Text PDF PubMed Scopus (1102) Google Scholar). A loss of the structurally similar primordial At2-MMP induces dwarfism in Arabidopsis plants (12Golldack D. Popova O.V. Dietz K.J. J. Biol. Chem. 2002; 277: 5541-5547Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). There is no extracellular matrix in plants, however, that is similar to the collagenous extracellular matrix of mammals. This datum alone is enough to suggest that the protease plays a role in certain functionally relevant intracellular events in addition to its role in pericellular proteolysis. MT1-MMP is tightly regulated at the transcriptional and posttranscriptional levels both as a protease (through activation and inhibition) and as a membrane protein (via trafficking, internalization, and recycling) (13Hernandez-Barrantes S. Bernardo M. Toth M. Fridman R. Semin. Cancer Biol. 2002; 12: 131-138Crossref PubMed Scopus (148) Google Scholar, 14Wang X. Ma D. Keski-Oja J. Pei D. J. Biol. Chem. 2004; 279: 9331-9336Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 15Osenkowski P. Toth M. Fridman R. J. Cell Physiol. 2004; 200: 2-10Crossref PubMed Scopus (166) Google Scholar) The trafficking and the internalization, via clathrin-coated pits and caveolae, have emerged as the essential mechanisms that regulate the biological function of MT1-MMP (16Annabi B. Lachambre M. Bousquet-Gagnon N. Page M. Gingras D. Beliveau R. Biochem. J. 2001; 353: 547-553Crossref PubMed Scopus (135) Google Scholar, 17Maquoi E. Peyrollier K. Noel A. Foidart J.M. Frankenne F. Biochem. J. 2003; 373: 19-24Crossref PubMed Scopus (25) Google Scholar, 18Rozanov D.V. Deryugina E.I. Monosov E.Z. Marchenko N.D. Strongin A.Y. Exp. Cell Res. 2004; 293: 81-95Crossref PubMed Scopus (65) Google Scholar, 19Urena J.M. Merlos-Suarez A. Baselga J. Arribas J. J. Cell Sci. 1999; 112: 773-784Crossref PubMed Google Scholar, 20Jiang A. Lehti K. Wang X. Weiss S.J. Keski-Oja J. Pei D. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13693-13698Crossref PubMed Scopus (224) Google Scholar, 21Zucker S. Hymowitz M. Conner C.E. DiYanni E.A. Cao J. Lab. Investig. 2002; 82: 1673-1684Crossref PubMed Scopus (57) Google Scholar, 22Labrecque L. Nyalendo C. Langlois S. Durocher Y. Roghi C. Murphy G. Gingras D. Beliveau R. J. Biol. Chem. 2004; 279: 52132-52140Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 23Wang P. Wang X. Pei D. J. Biol. Chem. 2004; 279: 20461-20470Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). These new data, combined together, provided a compelling argument to investigate the trafficking and the intracellular compartmentalization of MT1-MMP in greater detail. These data also argue that there is a role for the protease in intracellular events in addition to its role in pericellular proteolysis. Here, we have discovered compelling evidence that MT1-MMP is trafficked along the tubulin cytoskeleton. A fraction of cellular MT1-MMP accumulates in the centrosomal compartment. In the pericentrosomal compartment, active, functionally potent MT1-MMP degrades an integral centrosomal protein, pericentrin. Pericentrin is essential to the normal functioning of centrosomes in the mitotic spindle formation. MT1-MMP proteolysis of pericentrin causes chromosome instability, which is an early predictor of carcinogenesis. Overall, our results suggest an intracellular function for the membrane-tethered protease and an important role of MT1-MMP in the transition of cells from normalcy to malignancy. Antibodies and Cells—Rabbit polyclonal antibodies against the catalytic domain and against the hinge region of MT1-MMP were from Chemicon (Temecula, CA), Sigma, and Triple Point Biologics (Portland, OR). Rabbit polyclonal antibodies 4b and M8 to the C-terminal and N-terminal parts of pericentrin, respectively, were characterized earlier (24Dictenberg J.B. Zimmerman W. Sparks C.A. Young A. Vidair C. Zheng Y. Carrington W. Fay F.S. Doxsey S.J. J. Cell Biol. 1998; 141: 163-174Crossref PubMed Scopus (408) Google Scholar, 25Doxsey S.J. Stein P. Evans L. Calarco P.D. Kirschner M. Cell. 1994; 76: 639-650Abstract Full Text PDF PubMed Scopus (482) Google Scholar). A murine monoclonal antibody against γ-tubulin was from Sigma. Monoclonal antibodies against α-tubulin, RAB-4 and RAB-11, were from BD Biosciences. Human U251 glioma, human MCF7 breast carcinoma, and Madin-Darby canine kidney (MDCK) cells were from ATCC (Manassas, VA). All cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. For MT1-MMP overexpression, MDCK cells were transfected with the pcDNA3.1-zeo vector (mock cells) and with the plasmid bearing human MT1-MMP to overexpress the protease. Control and MT1-MMP-expressing breast carcinoma MCF7 and glioma U251 cells were obtained earlier (18Rozanov D.V. Deryugina E.I. Monosov E.Z. Marchenko N.D. Strongin A.Y. Exp. Cell Res. 2004; 293: 81-95Crossref PubMed Scopus (65) Google Scholar, 26Deryugina E.I. Soroceanu L. Strongin A.Y. Cancer Res. 2002; 62: 580-588PubMed Google Scholar). In this work, U251 cells were also transfected with α1-antitrypsin Portland (PDX). MCF7 cells were also transfected with the catalytically inert MT1-MMP-E240A construct and the internalization-deficient, tailless MT1-MMP-ΔCT construct. MCF7 cells were also transfected with MT1-MMP tagged with a FLAG tag. To avoid interference with the trafficking of MT1-MMP, the FLAG tag was inserted into the hinge region of the protease. Peptide cleavage and the mass spectrometry analysis of the digest were performed as described earlier (27Kridel S.J. Sawai H. Ratnikov B.I. Chen E.I. Li W. Godzik A. Strongin A.Y. Smith J.W. J. Biol. Chem. 2002; 277: 23788-23793Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). All of the buffer solutions used for the preparation of cell lysates and for the isolation of centrosomes were supplemented with a protease inhibitor mixture (pepstatin, leupeptin, bestatin, aprotinin, E-64) and additionally with phenylmethylsulfonyl fluoride and EDTA (1 mm each). MT1-MMP Small Interfering (si)RNA Constructs—The MT1-MMP siRNA target sequence was designed by using the siRNA Designer software (Promega). From six tested sequences, the sequence 5′-GAAGCCUGGCUACAGCAAUAU-3′ repressed the expression of MT1-MMP most efficiently. The 5′-GGUCCAUGCUGCAGAAAAACU-3′ scrambled RNA sequence was used as a control in our studies. Both sequences were cloned into the psiLentGene vector (Promega) and used to transfect U251 cells. Transfected cells were selected and cloned in the medium supplemented with 2 μg/ml puromycin. The level of expression of MT1-MMP in the clones was determined by Western blotting. Isolation of Centrosomes—Centrosomes were isolated from nocodazole-synchronized metaphase U251 cells (25Doxsey S.J. Stein P. Evans L. Calarco P.D. Kirschner M. Cell. 1994; 76: 639-650Abstract Full Text PDF PubMed Scopus (482) Google Scholar). Mitotic cells were harvested by mitotic shake off and lysed in 1 mm Tris-HCl, pH 8.0, containing 0.5% Igepal. Cell lysates were spun at 1500 × g to separate the nuclei and cell fragments. The supernatant fractions were filtered through a nylon mesh (70-μm pore size) and centrifuged on a 20% w/w Ficoll-400 cushion at 12,000 rpm for 30 min. The crude centrosomal fraction localized at the Ficoll-water interface was collected and further purified by a 40-80% sucrose gradient centrifugation at 30,000 rpm for 2 h. Immunofluorescence—Cells were fixed in 4% paraformaldehyde for 10 min, permeabilized with 0.1% Triton X-100 for 5 min, and blocked with 1% bovine serum albumin. Cells were incubated with primary antibodies (1:400) for 4 h and then with secondary antibodies (1:200) for 2 h. DNA was stained with 4′,6-diamidino-2-phenylindole. Images were acquired at a 600× original magnification on a Nikon TE300 microscope equipped with a real time, cooled CCD camera SP402-115 (Diagnostic Instruments, Sterling Heights, MI). MMP-2 Activation Assays—The ability of cellular MT1-MMP to activate proMMP-2 was demonstrated by gelatin zymography. For the analysis of centrosomal MT1-MMP, the isolated centrosomes were diluted 1:100 in 25 mm HEPES, pH 7.5. Diluted aliquots were co-incubated for 14 h at 37 °C with the purified proMMP-2 (10 ng). The samples were further analyzed by gelatin zymography. Fluorescence-acitvated Cell Sorter Analysis—Cells were detached in trypsin-EDTA, fixed in 70% ethanol, washed in phosphate-buffered saline, and resuspended in a 1% bovine serum albumin, phosphate-buffered saline solution supplemented with 50 μg/ml propidium iodide. The DNA content of cells was analyzed on a FACScan flow cytometer. Metaphase Spreads and Chromosome Count—Cells were incubated for 30 min at 37 °C with 0.005% ethidium bromide and then with colcemid (50 μg/ml) for 2.5 h. Cells were next treated with 0.56% KCl for 15 min and then fixed with Carnoy's fixative. The fixed cells were mounted on glass slides. After 72 h, chromosomes were stained with Giemsa stain and examined on a microscope. Digital images of chromosome spreads were analyzed, and chromosomes were counted in >100 spreads of each cell line. The Design of the MT1-MMP Chimeras—Using a QuikChange mutagenesis system (Stratagene), the Asp-Tyr-Lys-Asp-Asp-Asp sequence was inserted immediately prior to the Asp307-Lys308 sequence of MT1-MMP. As a result, the final construct exhibited the Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys sequence of the FLAG tag in the hinge region of MT1-MMP. To construct MT1-MMP-GFP, the Thr300-Ser301 sequence of the hinge domain of MT1-MMP was modified to insert PacI and BlpI restriction sites. The enhanced GFP sequence (Clontech) flanked at both ends with (Gly)5 was then inserted into the PacI/BlpI sites of MT1-MMP to generate the MT1-MMP-GFP chimera. MCF7 and U251 cells were stably transfected with the pcDNA3.1-zeo plasmids bearing MT1-MMP-FLAG and MT1-MMP-GFP, respectively. To avoid the aberrant trafficking of the recombinant constructs, the clones expressing low levels of the chimeras were specifically selected and analyzed further. The Analysis of Tumor Biopsies—Frozen samples of colon adenocarcinomas and invasive mammary grade II-III carcinomas and the matched normal tissues were obtained from the NCI Cooperative Human Tissue Network. The homogenized samples were extracted on ice with a radioimmune precipitation assay buffer containing the protease inhibitors. The extract aliquots (60 μg of each) were analyzed by immunoblotting with the MT1-MMP Ab815 and pericentrin 4b antibodies. Centrosomal MT1-MMP—We examined the subcellular localization of endogenously expressed MT1-MMP in breast carcinoma MCF7 and glioma U251 cells, both of which synthesize MT1-MMP naturally. The level of MT1-MMP in MCF7 cells was, however, very low. U251 cells (Fig. 1a) and MCF7 cells (not shown) demonstrated specific centrosomal MT1-MMP immunoreactivity. The centrosomal association of MT1-MMP was confirmed by using γ- and α-tubulin as centrosomal and mitotic spindle markers, respectively. Excess antigen blocked the centrosomal MT1-MMP immunoreactivity (Fig. 1d). Several individual antibodies to MT1-MMP, which were raised against the hinge region and against the catalytic domain, generated similar MT1-MMP immunostaining. The staining of cells with the isotype control was negative. The centrosomal MT1-MMP immunoreactivity was strongly enhanced in the dividing metaphase cells. Overall, only a fraction of MT1-MMP accumulates in centrosomes, whereas the bulk of cellular MT1-MMP is associated with the plasma membrane and the multiple intracellular vesicles (Fig. 1b). Nocodazole abrogated the association of MT1-MMP with centrosomes in the interphase cells. Nocodazole had no effect on the association of MT1-MMP with centrosomes in the metaphase cells (Fig. 1a). To corroborate further the presence of endogenous MT1-MMP in centrosomes, U251 cells were stably transfected with the siRNA construct (GAAGCCUGGCUACAGCAAUAU). MT1-MMP silencing by siRNA repressed both the expression of cellular MT1-MMP and its centrosomal immunoreactivity (Figs. 1a and 2c). To demonstrate the existence of centrosomal MT1-MMP in transfected cells, we used MT1-MMP chimeras. The use of chimeras allowed us to avoid using MT1-MMP antibodies to confirm the centrosomal localization of the protease. The MT1-MMP-GFP construct was detected via the GFP moiety fluorescence without using antibody staining. The FLAG and the GFP protein sequences were both inserted into the hinge region of MT1-MMP. Following transfection of the cells with the chimeric constructs, MT1-MMP-FLAG and MT1-MMP-GFP were each detected in the centrosomes and co-localized with γ-tubulin in breast carcinoma MCF7 and glioma U251 cells, respectively (Fig. 1c). The accumulation of the MT1-MMP chimeras in the pericentrosomal space and the partial co-localization with the centrosomes is a result of MT1-MMP overexpression. Evidently, excess MT1-MMP is incapable of fitting into the tight centrosomal compartment. To further corroborate the presence of MT1-MMP in the centrosomes, we isolated centrosomes from the synchronized metaphase U251 cells and determined that MT1-MMP co-fractionates with γ-tubulin (Fig. 2a). The concentration of MT1-MMP in the cytoplasm fraction was significantly lower than that in the centrosomes and that is why the cytoplasm fractions did not demonstrate observable amounts of the protease. In contrast, the centrosome samples were free of MMP-2 (a soluble proteinase and a target of MT1-MMP activation) (Fig. 2b) and a plasma membrane marker CD44 (not shown) suggesting the lack of contamination by plasma membrane or transport vesicles. To demonstrate the functional activity of centrosomal MT1-MMP, purified proMMP-2 was co-incubated with the centrosomal samples. Centrosomal MT1-MMP activated proMMP-2 and converted the latent zymogen proenzyme into the active MMP-2 enzyme (Fig. 2b, bottom panel). Hydroxamate inhibitors GM6001 and AG3340, which are potent against MT1-MMP (Ki ≈ 0.5 nm for both inhibitors), blocked MMP-2 activation (not shown). Consistent with the ability of centrosomal MT1-MMP to activate MMP-2, immunoblotting of the purified centrosomes using an MT1-MMP antibody confirmed that centrosomal MT1-MMP is represented by the active enzyme species (Fig. 2b, upper panel). It is not surprising that MT1-MMP traverses and partially accumulates in the pericentrosomal area, because the microtubule cytoskeleton is essential for the nocodazole-sensitive trafficking of MT1-MMP (28Deryugina E.I. Ratnikov B.I. Yu Q. Baciu P.C. Rozanov D.V. Strongin A.Y. Traffic. 2004; 5: 627-641Crossref PubMed Scopus (41) Google Scholar, 29Remacle A. Murphy G. Roghi C. J. Cell Sci. 2003; 116: 3905-3916Crossref PubMed Scopus (212) Google Scholar). Centrosomes are the microtubule-organizing centers, which play a key role in rapid protein trafficking. Proteins, e.g. caveolin, have been shown to travel from the perinuclear space to the plasma membrane and back using the tubulin cytoskeleton as "railroad tracks" (29Remacle A. Murphy G. Roghi C. J. Cell Sci. 2003; 116: 3905-3916Crossref PubMed Scopus (212) Google Scholar, 30Mundy D.I. Machleidt T. Ying Y.S. Anderson R.G. Bloom G.S. J. Cell Sci. 2002; 115: 4327-4339Crossref PubMed Scopus (260) Google Scholar). Our experiments have led us to the discovery that the microtubulin cytoskeleton and the centrosomes (the microtubulin cytoskeleton-organizing centers) are essential for the trafficking and the internalization of MT1-MMP and that MT1-MMP is trafficked to the pericentrosomal space most probably in the endosome-like vehicles. An analysis of the cells showed the existence of MT1-MMP-positive vesicles localized alongside the tubulin cytoskeleton (Fig. 2d). RAB-4 and RAB-11 (the markers of late/recycling endosomes and pericentrosomal/recycling endosomes, respectively) (31Peden A.A. Schonteich E. Chun J. Junutula J.R. Scheller R.H. Prekeris R. Mol. Biol. Cell. 2004; 15: 3530-3541Crossref PubMed Scopus (71) Google Scholar) co-localize with MT1-MMP, suggesting its endosomal nature (29Remacle A. Murphy G. Roghi C. J. Cell Sci. 2003; 116: 3905-3916Crossref PubMed Scopus (212) Google Scholar, 32Ullrich O. Reinsch S. Urbe S. Zerial M. Parton R.G. J. Cell Biol. 1996; 135: 913-924Crossref PubMed Scopus (1072) Google Scholar) (Fig. 2, e and f). To examine the intracellular trafficking of MT1-MMP, we used a newly developed non-covalent protein delivery Chariot reagent (33Morris M.C. Depollier J. Mery J. Heitz F. Divita G. Nat. Biotechnol. 2001; 19: 1173-1176Crossref PubMed Scopus (873) Google Scholar). This non-covalent reagent allows the delivery of proteins, including antibodies, to the inside of the cell compartment. Following the penetration through the cell membrane, the delivered Chariot-antibody complex dissociated inside the cell compartment and liberated the antibody. The liberated, functional antibody then diffused throughout the cell and interacted with the target protein and, thus, allowed the identification of the subcellular compartment that harbors the target protein. The transduction of cells with the antibodies to MT1-MMP, by using a Chariot reagent, as well as the uptake of the MT1-MMP antibody by cells (29Remacle A. Murphy G. Roghi C. J. Cell Sci. 2003; 116: 3905-3916Crossref PubMed Scopus (212) Google Scholar) also confirmed the microtubular transport of vesicular MT1-MMP to the centrosomes (not shown). The most recent publication (34Schnaeker E.M. Ossig R. Ludwig T. Dreier R. Oberleithner H. Wilhelmi M. Schneider S.W. Cancer Res. 2004; 64: 8924-8931Crossref PubMed Scopus (127) Google Scholar) confirms the endosomal nature and the microtubular intracellular trafficking of metalloproteinases such as MMP-2 and MMP-9. These results provide indirect support for the data presented in our manuscript. Taken together, our data suggest that the tubulin cytoskeleton is involved in the rapid, vesicular MT1-MMP trafficking. MT1-MMP Targets the Centrosome Proteome—Centrosomes play a central role in the organization of the tubulin cytoskeleton and microtubule nucleation by the γ-tubulin ring complex (24Dictenberg J.B. Zimmerman W. Sparks C.A. Young A. Vidair C. Zheng Y. Carrington W. Fay F.S. Doxsey S.J. J. Cell Biol. 1998; 141: 163-174Crossref PubMed Scopus (408) Google Scholar, 35Blagden S.P. Glover D.M. Nat. Cell Biol. 2003; 5: 505-511Crossref PubMed Scopus (116) Google Scholar, 36Zimmerman W.C. Sillibourne J. Rosa J. Doxsey S.J. Mol. Biol. Cell. 2004; 15: 3642-3657Crossref PubMed Scopus (232) Google Scholar). They regulate the mitotic spindle during cell division and provide sister chromatid disjunction (37Nasmyth K. Science. 2002; 297: 559-565Crossref PubMed Scopus (457) Google Scholar). Centrosomal MT1-MMP is proteolytically potent, and therefore, it may attack the centrosomal targets. Knowing the identity of these targets is of great importance to a more complete understanding of the tumorigenic function of MT1-MMP. In our earlier work, we identified the cleavage preferences of MT1-MMP through the proteolysis of protein substrates and the substrate phage libraries (27Kridel S.J. Sawai H. Ratnikov B.I. Chen E.I. Li W. Godzik A. Strongin A.Y. Smith J.W. J. Biol. Chem. 2002; 277: 23788-23793Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). We determined that the Pro-X-X-↓-XHydrophobic collagen-like cleavage motif is not ideally selective for MT1-MMP because this motif is recognized by several other individual MMPs. Highly selective MT1-MMP substrates lack the characteristic Pro at the P3 position; they contain, instead, an Arg at the P4 position (27Kridel S.J. Sawai H. Ratnikov B.I. Chen E.I. Li W. Godzik A. Strongin A.Y. Smith J.W. J. Biol. Chem. 2002; 277: 23788-23793Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). This P4 Arg is essential for efficient hydrolysis and for selectivity for MT1-MMP (38Rozanov D.V. Strongin A.Y. J. Biol. Chem. 2003; 278: 8257-8260Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). MT1-MMP appears to recognize cleavage substrates in two distinct modes, using contacts at the P3 and the P1′ to recognize less selective substrates and using contacts at the P4 and the P1′ to recognize highly selective substrates (27Kridel S.J. Sawai H. Ratnikov B.I. Chen E.I. Li W. Godzik A. Strongin A.Y. Smith J.W. J. Biol. Chem. 2002; 277: 23788-23793Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). We used these data to construct a probabilistic cleavage profile of MT1-MMP using a system for the prediction of protease specificity (PoPS) (39, Boyd, S. E., Garcia de la Banda, M., Pike, R. N., Whisstock, G. B., and Rudy, G. B. (2004) Computational Systems Bioinformatics Conference, 2004, Stanford, August 16-19, 2004, pp. 372-381, IEEE, Stanford, CAGoogle Scholar). Using a conventional set of parameters such as charge, polarity, and size, the phage library data for the P4-P1′ positions were used to produce a position specific scoring matrix on a scale of -5.0 to +5.0, as required by PoPS. The matrix contained a strong preference for Arg at P4 and excluded non-hydrophobic residues from the P1′ position. The matrix was also biased against collagen-like cleavage sites by excluding Pro from the P4 position. Lastly, the matrix was weighted in favor of the P4 and P1′ positions. To filter these predictions further, the programs PSIPRED (40Jones D.T. J. Mol. Biol. 1999; 292: 195-202Crossref PubMed Scopus (4411) Google Scholar) and NCOILS (41Lupas A. Van Dyke M. Stock J. Science. 1991; 252: 1162-1164Crossref PubMed Scopus (3457) Google Scholar) (integrated in the PoPS system) were used to predict secondary structure and to search for sites that were located in regions of low structure. PoPS was then used to search for the presence of this profile in the human proteome (>25,000 proteins) and in the centrosomal proteome consisting of 114 proteins (42Andersen J.S. Wilkinson C.J. Mayor T. Mortensen P. Nigg E.A. Mann M. Nature. 2003; 426: 570-574Crossref PubMed Scopus (1044) Google Scholar). This analysis returned a score for each identified site, based on the weighted matrix. The analysis revealed 111 top scoring hits in the human proteome. A significant fraction of known MT1-MMP cleavage targets, including tissue transglutaminase, fibronectin, vitronectin, the low density lipoprotein receptor-related protein LRP, and the complement component C3 (43Belkin A.M. Akimov S.S. Zaritskaya L.S. Ratnikov B.I. Deryugina E.I. Strongin A.Y. J. Biol. Chem. 2001; 276: 18415-18422Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar, 44Hwang I.K. Park S.M. Kim S.Y. Lee S.T. Biochim. Biophys. Acta. 2004; 1702: 79-87Crossref PubMed Scopus (78) Google Scholar, 45Overall C.M. Tam E.M. Kappelhoff R. Connor A. Ewart T. Morrison C.J. Puente X. Lopez-Otin C. Seth A. Biol. Chem. 2004; 385: 493-504Crossref PubMed Scopus (112) Google Scholar, 46Rozanov D.V. Hahn-Dantona E. Strickland D.K. Strongin A.Y. J. Biol. Chem. 2004; 279: 4260-4268Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 47Rozanov D.V. Savinov A.Y. Golubkov V.S. Postnova T.I. Remacle A. Tomlinson S. Strongin A.Y. J. Biol. Chem. 2004; 279: 46551-46557Abstract Full Text Full Tex
Referência(s)