Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Cloning of Factors Related to HIV-inducible LBP Proteins That Regulate Steroidogenic Factor-1-independent Human Placental Transcription of the Cholesterol Side-chain Cleavage Enzyme, P450scc

2000; Elsevier BV; Volume: 275; Issue: 4 Linguagem: Inglês

10.1074/jbc.275.4.2852

ISSN

1083-351X

Autores

Ningwu Huang, Walter L. Miller,

Tópico(s)

RNA Research and Splicing

Resumo

The cholesterol side-chain cleavage enzyme, cytochrome P450scc, initiates the biosynthesis of all steroid hormones. Adrenal and gonadal strategies for P450scc gene transcription are essentially identical and depend on the orphan nuclear receptor steroidogenic factor-1, but the placental strategy for transcription of P450scc employs cis-acting elements different from those used in the adrenal strategy and is independent of steroidogenic factor-1. Because placental expression of P450scc is required for human pregnancy, we sought factors that bind to the −155/−131 region of the human P450scc promoter, which participates in its placental but not adrenal or gonadal transcription. A yeast one-hybrid screen of 2.4 × 106 cDNA clones from human placental JEG-3 cells yielded two unique clones; one is the previously described transcription factor LBP-1b, which is induced by HIV, type I infection of lymphocytes, and the other is a new factor, termed LBP-9, that shares 83% amino acid sequence identity with LBP-1b. When expressed in transfected yeast, both factors bound specifically to the −155/−131 DNA; antisera to LBP proteins supershifted the LBP-9·DNA complex and inhibited formation of the LBP-1b·DNA complex. Reverse transcriptase-polymerase chain reaction detected LBP-1b in human placental JEG-3, adrenal NCI-H295A, liver HepG2, cervical HeLa, and monkey kidney COS-1 cells, but LBP-9 was detected only in JEG-3 cells. When the −155/−131 fragment was linked to a minimal promoter, co-expression of LBP-1b increased transcription 21-fold in a dose-dependent fashion, but addition of LBP-9 suppressed the stimulatory effect of LBP-1b. The roles of LBP transcription factors in normal human physiology have been unclear. Their modulation of placental but not adrenal P450scc transcription underscores the distinctiveness of placental strategies for steroidogenic enzyme gene transcription. The cholesterol side-chain cleavage enzyme, cytochrome P450scc, initiates the biosynthesis of all steroid hormones. Adrenal and gonadal strategies for P450scc gene transcription are essentially identical and depend on the orphan nuclear receptor steroidogenic factor-1, but the placental strategy for transcription of P450scc employs cis-acting elements different from those used in the adrenal strategy and is independent of steroidogenic factor-1. Because placental expression of P450scc is required for human pregnancy, we sought factors that bind to the −155/−131 region of the human P450scc promoter, which participates in its placental but not adrenal or gonadal transcription. A yeast one-hybrid screen of 2.4 × 106 cDNA clones from human placental JEG-3 cells yielded two unique clones; one is the previously described transcription factor LBP-1b, which is induced by HIV, type I infection of lymphocytes, and the other is a new factor, termed LBP-9, that shares 83% amino acid sequence identity with LBP-1b. When expressed in transfected yeast, both factors bound specifically to the −155/−131 DNA; antisera to LBP proteins supershifted the LBP-9·DNA complex and inhibited formation of the LBP-1b·DNA complex. Reverse transcriptase-polymerase chain reaction detected LBP-1b in human placental JEG-3, adrenal NCI-H295A, liver HepG2, cervical HeLa, and monkey kidney COS-1 cells, but LBP-9 was detected only in JEG-3 cells. When the −155/−131 fragment was linked to a minimal promoter, co-expression of LBP-1b increased transcription 21-fold in a dose-dependent fashion, but addition of LBP-9 suppressed the stimulatory effect of LBP-1b. The roles of LBP transcription factors in normal human physiology have been unclear. Their modulation of placental but not adrenal P450scc transcription underscores the distinctiveness of placental strategies for steroidogenic enzyme gene transcription. steroidogenic factor-1 base pair rapid amplification of cDNA ends polymerase chain reaction glyceraldehyde-3-phosphate dehydrogenase reverse transcriptase Dulbecco's modified Eagle's/Ham's medium minimal 32-base promoter of the thymidine kinase gene luciferase Steroid hormones regulate a wide variety of physiologic functions. Mineralocorticoids, produced by the adrenal cortex, are needed to retain sodium and maintain blood pressure (1.Fardella C.E. Miller W.L. Annu. Rev. Nutr. 1996; 16: 443-470Crossref PubMed Scopus (61) Google Scholar); glucocorticoids, also produced by the adrenal cortex, raise blood sugar but also play roles in numerous physiologic processes (2.Baxter J.D. Rousseau G.G. Glucocorticoid Hormone Action. Springer-Verlag New York Inc., New York1979Crossref Google Scholar); and androgens and estrogens, produced by the gonads, are required for reproduction (3.Dufau M. Annu. Rev. Physiol. 1988; 50: 483-508Crossref PubMed Scopus (226) Google Scholar,4.Richards J.S. Hedin L. Annu. Rev. Physiol. 1988; 50: 441-463Crossref PubMed Scopus (226) Google Scholar). In human beings, absence of mineralocorticoids leads to death in infancy, absence of glucocorticoids may lead to death during times of severe physiologic stress, and absence of sex steroids would, eventually, lead to death of the species. Thus, the regulation of steroid hormone biosynthesis is of fundamental interest. The role of steroid hormones in the fetus is less obvious, and there are important species differences among mammals. Human fetuses can develop normally, reach term gestation, undergo normal parturition, and make initial adaptations to extrauterine life in the absence of mineralocorticoids, glucocorticoids, or sex steroids (5.Miller W.L. Clin. Perinatol. 1998; 25: 799-817Abstract Full Text PDF PubMed Google Scholar). By contrast, normal human gestation is totally dependent on the action of progesterone to suppress uterine contractility and thus to maintain pregnancy (6.Strauss III, J.F. Gåfvels M.E. King B.F. DeGroot L.J. Endocrinology. W. B. Saunders Co., Philadelphia1995: 2171-2206Google Scholar). Progesterone is initially provided by the mother's ovarian corpus luteum, but after about 8–10 weeks virtually all progesterone is produced by the placental syncytiotrophoblast cells, which are fetal tissue (7.Csapo A.I. Pulkkinen M.O. Wiest W.B. Am. J. Obstet. Gynecol. 1973; 115: 759-765Abstract Full Text PDF PubMed Scopus (283) Google Scholar, 8.Csapo A.I. Pulkkinen M.O. Obstet. Gynecol. Surv. 1978; 83: 69-81Crossref Scopus (256) Google Scholar). Therefore, placental synthesis of progesterone is essential for the initiation of human life (5.Miller W.L. Clin. Perinatol. 1998; 25: 799-817Abstract Full Text PDF PubMed Google Scholar). The synthesis of placental progesterone, and of all other steroid hormones, begins with the conversion of cholesterol to pregnenolone by mitochondrial cytochrome P450scc, which is the rate-limiting and hormonally regulated enzymatic step in steroidogenesis (9.Miller W.L. Endocr. Rev. 1988; 9: 295-318Crossref PubMed Scopus (1193) Google Scholar). Human P450scc is encoded by a single gene (10.Morohashi K. Sogawa K. Omura T. Fujii-Kuriyama Y. J. Biochem. (Tokyo). 1987; 101: 879-887Crossref PubMed Scopus (159) Google Scholar), formally termed CYP11A (11.Nebert D.W. Nelson D.R. Coon M.J. Estabrook R.W. Feyereisen R. Fujii-Kuriyama Y. Gonzalez F.J. Guengerich F.P. Gunsalus I.C. Johnson E.F. Loper J.C. Sata R. Waterman M.R. Waxman D.J. DNA Cell Biol. 1991; 10: 1-14Crossref PubMed Scopus (826) Google Scholar), that is located on chromosome 15q23-q24 (12.Sparkes R.S. Klisak I. Miller W.L. DNA Cell Biol. 1991; 10: 359-365Crossref PubMed Scopus (127) Google Scholar) and is expressed in the adrenals (13.Voutilainen R. Tapanainen J. Chung B. Matteson K.J. Miller W.L. J. Clin. Endocrinol. Metab. 1986; 63: 202-207Crossref PubMed Scopus (250) Google Scholar), gonads (13.Voutilainen R. Tapanainen J. Chung B. Matteson K.J. Miller W.L. J. Clin. Endocrinol. Metab. 1986; 63: 202-207Crossref PubMed Scopus (250) Google Scholar), placenta (14.Chung B. Matteson K.J. Voutilainen R. Mohandas T.K. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 8962-8966Crossref PubMed Scopus (324) Google Scholar), and brain (15.Mellon S.H. Deschepper C.F. Brain Res. 1993; 629: 283-292Crossref PubMed Scopus (356) Google Scholar). Because of its key role in the production of all steroid hormones, the transcription of the P450scc gene has been the subject of intensive study (reviewed in Refs. 16.Hum D.W. Miller W.L. Clin. Chem. 1993; 39: 333-340Crossref PubMed Scopus (63) Google Scholar, 17.Waterman M.R. J. Biol. Chem. 1994; 269: 27783-27786Abstract Full Text PDF PubMed Google Scholar, 18.Parker K.L. Schimmer B.P. Vitam. Horm. 1995; 51: 339-370Crossref PubMed Scopus (100) Google Scholar). Such studies led to the discovery of steroidogenic factor-1 (SF-1),1 also known as Ad4-BP, an orphan nuclear receptor that is essential for fetal adrenal and gonadal development as well as for expression of all the steroidogenic genes in these tissues (19.Parker K.L. Schimmer B.P. Endocr. Rev. 1997; 18: 361-377Crossref PubMed Scopus (556) Google Scholar). However, although SF-1 is expressed in many tissues (20.Morohashi K. Trends Endocrinol. Metab. 1999; 10: 169-173Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), very little SF-1 is expressed in other tissues that contain P450scc including brain, embryonic gut, and placenta (20.Morohashi K. Trends Endocrinol. Metab. 1999; 10: 169-173Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 21.Honda S. Morohashi K. Nomura M. Takeya M. Kitajima M. Omura T. J. Biol. Chem. 1993; 268: 7494-7502Abstract Full Text PDF PubMed Google Scholar, 22.Keeney D.S. Ikeda Y. Waterman M.R. Parker K.L. Mol. Endocrinol. 1995; 9: 1091-1098PubMed Google Scholar), and studies of P450scc regulation in the brain (23.Zhang P. Rodriguez H. Mellon S.H. Mol. Endocrinol. 1995; 9: 1571-1582Crossref PubMed Google Scholar) and placenta (24.Moore C.C.D. Hum D.W. Miller W.L. Mol. Endocrinol. 1992; 6: 2045-2058PubMed Google Scholar, 25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar) indicate that the SF-1 sites in the P450scc promoter are not involved in P450scc transcription in these tissues. As placental P450scc expression and progesterone synthesis are mandatory for successful pregnancy and as little is known about SF-1-independent expression of genes for steroidogenic enzymes, we have studied the transcription of P450scc in human placental JEG-3 cells (24.Moore C.C.D. Hum D.W. Miller W.L. Mol. Endocrinol. 1992; 6: 2045-2058PubMed Google Scholar, 25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar). We now report the cloning and characterization of two transcription factors that modulate the human placental expression of P450scc; both factors are related to the LBP-1 family of transcription factors induced by HIV, type I infection of lymphocytes (26.Yoon J.B. Li G. Roeder R.G. Mol. Cell. Biol. 1994; 14: 1776-1785Crossref PubMed Scopus (99) Google Scholar). Saccharomyces cerevisiae strain YM4271 [MATa, ura3–52, his3–200, ade2–101, lys2–801, leu2–3, 112, trp1–901, tyr1–501, gal4-Δ538, gal80-Δ538, -ade5::hisG] (27.Wilson T.E. Fahrner T.J. Johnston M. Milbrandt J. Science. 1991; 252: 1296-1300Crossref PubMed Scopus (481) Google Scholar, 28.Liu J. Wilson T.E. Milbrandt J. Johnston M. Methods Enzymol. 1993; 5: 125-137Crossref Scopus (46) Google Scholar) (CLONTECH Laboratories) was grown on standard media (29.Rose M.D. Winston F. Hieter P. Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1990Google Scholar). A double-stranded oligonucleotide (see Table I) corresponding to bases −155 to −131 of the human P450scc promoter (30.Moore C.C.D. Brentano S.T. Miller W.L. Mol. Cell. Biol. 1990; 10: 6013-6023Crossref PubMed Scopus (120) Google Scholar) was tetramerized in a head-to-tail orientation and propagated in Escherichia coli. This P450scc −155/−131 ×4 DNA was inserted into plasmid pHISi (CLONTECH) cleaved with EcoRI andXbaI and was also inserted into plasmid pLacZi cleaved withEcoRI and SalI, thus placing the −155/−131 tetramer immediately upstream from the minimal promoter sequences for the reporter genes HIS3 (in pHISi) and LacZ (in pLacZi). After propagation in E. coli, these plasmids were sequentially transformed into yeast YM4271 using lithium acetate (31.Gietz R.D. Schiesti R.H. Willems A.R. Woods R.A. Yeast. 1995; 11: 355-360Crossref PubMed Scopus (1712) Google Scholar), and stable, integrated transformants were identified on selective media: His− for pHISi and Ura− for theURA3 marker in pLacZi.Table IOligonucleotide sequences (5′ → 3′)Sense (s) and antisense (as) primers for RT-PCR experimentsLocationNH-1s-4ATGGCCTGGGTGCTCAA175–191NH-1as-1GCAGCTAGCTGAGTGTA848–864NH-9s-1bAGCTGCATGAAGAGACGCT269–287NH-9as-2TCTCGGGACATCTTCAGCA1103–1121NH-32s-1bGATCTCAGTCTGCGGATG794–811NH-32as-2AAGTCATCTTCTGTGCCGT1632–1650c17-s-12CGTGGCTCTCTTGCTGCTTA53–72c17-as-810AGCCATTATCTGAGTTCATCTT849–870scc-s-1GATGCCATCTACCAGATGTT747–766scc-as-1CTCTGAAGTTCTCCAGCATA1478–1497GAPDH-s-1GTATCGTGGAAGGACTCAT566–584GAPDH-as-1TACTCCTTGGTGGCCATGT1049–1067Antisense primers used in 5′ RACE experimentsLocation9-GSP-1CTTGAACACCTTGATCT731–7479-GSP-2TGCAAGCTTGTCGACAGACAGTGGAATATCGATGT482–50132-GSP-1TTTGCTTCATCGTTGAT1202–121832-GSP-2TGTAAGCTTGTCGACCATGATCACACTTCGAACT1006–1024−155/−131 sequences used−155/−131wt-sGATCTCGCTGCAGAAATTCCAGACTGAACCGGATC−155/−131wt-asGATCCGGTTCAGTCTGGAATTTCTGCAGCGAGATC−155/−131mut-sGATCTCGCTTACTTCTAGACAGACTGAACCGGATC−155/−131mut-asGATCCGGTTCAGTCTGTCTAGAAGTAAGCGAGATC Open table in a new tab Both randomly primed and oligo(dT)-primed cDNA made from JEG-3 cell RNA was ligated with phosphorylated EcoRI-NotI-SalI adapters and passed through Sephacryl S-300 to exclude DNA smaller than 300–400 bp. The cDNA was ligated to the GAL4 activation domain (32.Kumar R. Chen S. Scheurer D. Wang Q.-L. Duh E. Sung C.-H. Rehemtulla A. Swaroop A. Adler R. Zack D.J. J. Biol. Chem. 1996; 271 (29218): 29612Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 33.Chen X. Rubock M.J. Whitman M. Nature. 1996; 383 (696): 691Crossref PubMed Scopus (634) Google Scholar) in the LEU2 plasmid pGAD10 and propagated inE. coli. The plasmid DNA library was introduced by LiAc/polyethylene glycol transformation into the yeast YM4271 (P450scc −155/−131 ×4 HIS3/LacZ) reporter strain and plated onto 16 243 × 243-mm minimal media (SD) Ura−-Leu−-His− plates containing 45 mm 3-amino-1,2,4-trizole. Growth of a small aliquot on SD/Leu− selective media was used to estimate the number of transformants. After 7 days of growth on minimal medium, survivors were assayed for β-galactosidase activity (34.Schneider S. Buchert M. Hovens C.M. BioTechniques. 1996; 20: 960-962Crossref PubMed Scopus (72) Google Scholar). These plasmid DNAs were isolated from their host yeast and individually transformed intoE. coli DH5α for amplification, restriction endonuclease mapping, and sequencing. Total JEG-3 cell RNA (1 μg) was reverse transcribed into cDNA using 50 ng of primer 9-GSP1 (see Table I), isolated with GlassMAX DNA spin cartridges (Life Technologies, Inc.), then oligo(dC)-tailed with terminal deoxynucleotidyl transferase. The dC-tailed cDNA was amplified by a nested PCR procedure, first using the Abridge Anchor primer (Life Technologies, Inc.) and 9-GSP2, followed by reamplification with primers AUAP (Life Technologies, Inc.) and 9-GSP2, yielding a predominant PCR product of ∼600 bp. This double-stranded cDNA was blunt-ended by T4 DNA polymerase, ligated into SmaI-digested pBluescript II SK+, and sequenced. The full-length cDNA was assembled by ligating the 5′-RACE clone into construct 9pSG5 containing the 3′-end of the cDNA, using theXhoI and Bst107I sites. 5′-RACE was also performed for clone 32 using primers 32-GSP-1 and 32-GSP-2, and the full-length cDNA was assembled by ligating the 5′-RACE clone into pGAD10–32 containing the 3′-end of the cDNA using theXhoI and BclI sites. Total RNA was isolated from JEG-3 cells, NCI-H295A cells, HeLa cells, HepG2 cells, COS-1 cells, and human adrenal tissue. Random primers were used for the first strand cDNA syntheses using reverse transcriptase Superscript II (Life Technologies, Inc.). PCR was done using 5 μl of the first strand cDNA product and oligonucleotides specific for clones 1, 9, 32, human P450c17, and GAPDH (see Table I). Human placental JEG-3 cells (35.Kohler P.O. Bridson W.E. J. Clin. Endocrinol. Metab. 1971; 65: 122-126Google Scholar) (American Type Culture Collection, Manassas, VA) were grown at 37 °C and 5% CO2 in Dulbecco's modified Eagle's/Ham's 21 medium (DME-H21) with 50 μg/ml gentamycin, 5% fetal bovine serum, and 5% horse serum. JEG-3 cells were grown to 60–80% confluence on 6-well tissue culture plates and transfected by calcium phosphate precipitation for 6 h with 3 μg of plasmid DNA for each well. After aspirating the calcium phosphate-DNA precipitates, the cells were washed with 3 ml of DME-H21 medium and incubated for an additional 36 h in regular medium. Human adrenal NCI-H295A cells (36.Rodriguez H. Hum D.W. Staels B. Miller W.L. J. Clin. Endocrinol. Metab. 1997; 82: 365-371Crossref PubMed Scopus (89) Google Scholar), an adherent sub-line of NCI-H295 cells (37.Gazdar A.F. Oie H.K. Shackleton C.H. Chen T.R. Triche T.J. Myers C.E. Chrousos G.P. Brennan M.F. Stein C.A. LaRocca R.V. Cancer Res. 1990; 50: 5488-5496PubMed Google Scholar, 38.Staels B. Hum D.W. Miller W.L. Mol. Endocrinol. 1993; 7: 423-433Crossref PubMed Scopus (176) Google Scholar), were grown in 50% DME-H16, 50% DME-F12 (RPMI 1640), and 2% fetal bovine serum supplemented with 5 μg/ml insulin, 5 μg/ml transferrin, 5 ng/ml sodium selenite, and antibiotics/antimycotics (100 units/ml penicillin, 100 μg/ml streptomycin, and 0.25 μg/ml amphoterecin). Full-length cDNAs for clones 1, 9, and 32 were re-cloned into pSG5 (39.Green S. Issemann I. Sheer E. Nucleic Acids Res. 1988; 16: 369Crossref PubMed Scopus (547) Google Scholar) for transfection of mammalian cells. The human P450scc constructs 1xwt−155/−131/TK32LUC and 1xmt−155/−131/TK32LUC were described previously (25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar). As an internal control, 100 ng of pRL-CMV vector (Promega) was co-transfected for each well. Luciferase assays were performed with Dual-Luciferase™ assay system (Promega) using a Monolight 1500 luminometer (Analytical Luminescence Laboratory, San Diego, CA). Nuclear extracts were prepared from JEG-3 cells and NCI-H295A cells as described (24.Moore C.C.D. Hum D.W. Miller W.L. Mol. Endocrinol. 1992; 6: 2045-2058PubMed Google Scholar). Protein concentrations were determined by Bradford assay. Yeast transformed with HIS multicopy vector YEp90 expressing the cDNA for clones 1, 9, or 32 were grown in 50 ml of SD selective media overnight at 30 °C, transferred into 300 ml of YPD media, and incubated for 3 h at 30 °C (40.Heery D.D. Zacharewski T. Pierrat B. Gronemeyer H. Chambon P. Losson L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4281-4285Crossref PubMed Scopus (72) Google Scholar). Cell pellets were collected by centrifugation, washed once with H2O, and then resuspended in 1.5 ml of 20 mm Tris-HCl, pH 7.5, 20% glycerol, 0.4m KCl, 2 mm dithiothreitol, 1 mmphenylmethylsulfonyl fluoride with protease inhibitors (Roche Molecular Biochemicals). The yeast were vortexed vigorously for 2 min with an equal volume of 450–600-μm glass beads (Sigma), and the debris was pelleted at 4 °C for 15 min at 13,000 rpm. The protein concentration of the supernatant was determined, and aliquots of these yeast extracts were stored at −70 °C. Double-stranded wild-type and mutant probes corresponding to bases −155/−131 of the human P450scc promoter (see Table I) were end-labeled by [γ-32P]ATP (Amersham Pharmacia Biotech) and T4 polynucleotide kinase (New England BioLabs) and purified through a G-50 column. About 10 fmol of labeled probe (20,000 cpm) were incubated at room temperature for 15 min with 5–8 μg of nuclear extracts or yeast cell extracts and various competitor oligonucleotides in a final volume of 15 μl in 10 mm Tris-HCl, pH 7.5, 100 mmKCl, 1 m EDTA, 4% glycerol, 5 mmdithiothreitol, 0.1 mg/ml bovine serum albumin with 1 μg of poly(dI-dC) added as a nonspecific competitor. For supershift experiments, 1 μl of undiluted rabbit anti-human LBP-1 antiserum was added following formation of the DNA·protein complex and was incubated for an additional 15 min at room temperature. DNA·protein complexes were analyzed by electrophoresis in 4% native polyacrylamide gel in 50 mm Tris base, 38 mm glycine, 2 mm EDTA, pH 8.0, and 0.35 μl of β-mercaptoethanol at 20 °C for 90 min at 230 volts. Our previous work demonstrated that the DNA segment between −155 and −131 was required for placental, but not for adrenal or gonadal, transcription of human P450scc (24.Moore C.C.D. Hum D.W. Miller W.L. Mol. Endocrinol. 1992; 6: 2045-2058PubMed Google Scholar, 25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar, 30.Moore C.C.D. Brentano S.T. Miller W.L. Mol. Cell. Biol. 1990; 10: 6013-6023Crossref PubMed Scopus (120) Google Scholar, 36.Rodriguez H. Hum D.W. Staels B. Miller W.L. J. Clin. Endocrinol. Metab. 1997; 82: 365-371Crossref PubMed Scopus (89) Google Scholar). Furthermore, the corresponding −155/−131 oligonucleotide formed complexes with nuclear extracts from human placental JEG-3 cells that were not seen with nuclear extracts from human adrenal NCI-H295 cells (25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar). Therefore we sought to clone JEG-3 cell factors that bound to this DNA. Construction of JEG-3 cell cDNA expression libraries and screening 6 × 106 unique λgt11 clones with radiolabeled −155/−131 dimers failed to identify specific clones. 2D. W. Hum, H. Shi, G. K. Fu, and W. L. Miller, unpublished results. Therefore we used the yeast one-hybrid system (41.Wang M.M. Reed R.R. Nature. 1993; 364: 121-126Crossref PubMed Scopus (371) Google Scholar) to search for proteins that bind to this DNA. Yeast strain YM4271 was genetically modified to contain selectableHIS3 and LacZ reporter genes under the control of four tandem copies of the −155/−131 element of P450scc. A human placental cDNA library containing 2.4 × 106unique clones was constructed and propagated in E. coli, and the plasmid DNA was transformed into the YM4271 reporter strain. Of approximately 9 × 107 transformants plated onto selective media, 108 robust, apparently Leu+-His+-Ura+ colonies were identified. After further propagation, 52 plasmids showed β-galactosidase activity, and 36 plasmids contained identifiable cDNA inserts. Most clones appeared to be unique on the basis of insert size and endonuclease digestion pattern; however, clone NH1 was present in 7 copies, clone NH9 in 6 copies, and clone NH32 in 2 copies. All clones were subjected to at least one sequencing run from a plasmid primer. BLAST searches showed that none of the unique copy clones bore identifiable relationships to any known transcription factors, but the multicopy clones NH1, 9, and 32 were all related to LBP-1; these clones were then sequenced in their entirety (Fig.1).Figure 1Sequences of clones NH1 (panel A), NH9 (panel B), and NH32 (panel C). Clones NH9 and 32 were completed by 5′-RACE. GenBank™ accession numbers for these sequences are: LBP-1b (NH1),AF198487; LBP-9 (NH9), AF198488; LBP-32 (NH32), AF198489.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 1Sequences of clones NH1 (panel A), NH9 (panel B), and NH32 (panel C). Clones NH9 and 32 were completed by 5′-RACE. GenBank™ accession numbers for these sequences are: LBP-1b (NH1),AF198487; LBP-9 (NH9), AF198488; LBP-32 (NH32), AF198489.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The insert in clone NH1 was 3843 bp long, had a long 3′-untranslated region, and encoded a protein of 540 amino acids with a predicted molecular weight of 62 kDa. The encoded amino acid sequence of NH1 was 98% identical to human LBP-lb. Because the differences between the published LBP-1b amino acid sequence and the sequence encoded by clone NH1 were mainly confined to one region, we considered whether these were alternately spliced products of the same gene. Therefore, we used RT-PCR to amplify the cDNA regions that were different between NH1 and LBP-1b, using total RNA from JEG-3 and NCI-H295A cells and primers flanking the variant region. Sequencing of two JEG-3 and two NCI-H295A clones showed the sequence found in the NH1 cDNA, suggesting that the NH1 sequence is the correct LBP-1b sequence and that the reported sequence of LBP-1b (26.Yoon J.B. Li G. Roeder R.G. Mol. Cell. Biol. 1994; 14: 1776-1785Crossref PubMed Scopus (99) Google Scholar) has a short, frameshifted, incorrect amino acid sequence (Fig. 2). Hence we refer to the NH1 cDNA sequence as LBP-1b. The insert in clone NH9 was 4777 bp long, had a long 3′-untranslated region, and had an open reading frame of 1395 bp without an initiating methionine in a Kozak sequence. Therefore we performed 5′-RACE (42.Frohman M.A. Dush M.K. Martin G.R. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8998-9002Crossref PubMed Scopus (4341) Google Scholar) using JEG-3 cell RNA reverse-transcribed into cDNA using the specific primer 9-GSP1 (Table I) followed by nested PCR. The 591-bp double-stranded RACE/PCR product was cloned and sequenced, showing complete sequence overlap with the 5′-end of NH9, indicating that it was an accurate RACE product. After appropriate ligation of this RACE product, the full-length clone NH9 was 4909 bp long and encoded a protein of 479 amino acids with a predicted molecular weight of 55 kDa that had 83% amino acid sequence identity to our corrected sequence of LBP-1b and hence is hereafter termed LBP-9. The insert in clone NH32 also appeared to be less than full-length, having an open reading frame of only 1230 bp and lacking an initiating methionine codon in an appropriate Kozak sequence. This clone was also completed by 5′-RACE yielding a sequence of 2250 bp that lacked a complete 3′-untranslated region but contained an open reading frame for 618 amino acids whose sequence was distantly related to human LBP-1b and to the Drosophila transcription factor E1f-1/NTF-1 (43.Bray S.J. Burke B. Brown N.H. Hirsh J. Genes Dev. 1989; 3: 1130-1145Crossref PubMed Scopus (98) Google Scholar,44.Dynlacht B.D. Attardi L.D. Admon A. Freeman M. Tjian R. Genes Dev. 1989; 3: 1677-1688Crossref PubMed Scopus (95) Google Scholar). This protein has a predicted molecular mass of 68 kDa that is hereafter designated LBP-32. No previously defined DNA binding motifs, such as a zinc finger, leucine zipper, helix-loop-helix, or homeobox was identified in any of our three clones. Our previous work indicated that the placental expression of human P450scc involved some transcription factors found in both the adrenals and placenta and some transcription factors found in the placenta but not in the adrenals (24.Moore C.C.D. Hum D.W. Miller W.L. Mol. Endocrinol. 1992; 6: 2045-2058PubMed Google Scholar, 25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar). Therefore we sought to determine whether the expression of clones LBP-1b, -9, and -32 was unique to the placenta or occurred in a broader array of human cell types. The highly sensitive procedure of RT-PCR followed by Southern blotting detected LBP-1b expression in steroidogenic human placental JEG-3 cells and adrenal NCI-H295A cells, in human adrenal tissue, in non-steroidogenic human liver HepG2 cells, human cervical carcinoma HeLa cells, and monkey kidney COS-1 cells (Fig. 3). By contrast, LBP-9 and -32 were expressed abundantly in placental JEG-3 cells, at very low levels in non-steroidogenic cells, and were not detected in human adrenal NCI-H295A cells or in human adrenal tissue. P450c17, a steroidogenic enzyme expressed in the adrenals, gonads, and brain but not the placenta (13.Voutilainen R. Tapanainen J. Chung B. Matteson K.J. Miller W.L. J. Clin. Endocrinol. Metab. 1986; 63: 202-207Crossref PubMed Scopus (250) Google Scholar, 15.Mellon S.H. Deschepper C.F. Brain Res. 1993; 629: 283-292Crossref PubMed Scopus (356) Google Scholar) was found in NCI-H295A cells and human adrenal tissue as predicted but not in JEG-3 cells or the non-steroidogenic cell lines, demonstrating the specificity of this RT-PCR experiment. The clones expressing LBP-1b, -9, and -32 had been identified through trans-activation of selectable markers, presumably through specific binding to the incorporated tetramer of the −155/−131 sequence of the human P450scc promoter. Therefore we sought to determine whether the proteins encoded by these three clones would bind this DNA in vitro. The inserts of each clone were sub-cloned into the multicopy vector YEp90, expressed in yeast, and yeast protein extracts were prepared; these yeast extracts and JEG-3 cell nuclear extracts were then used in electrophoretic mobility shift assays. As shown in Fig. 4, JEG-3 nuclear extracts created two protein·DNA complexes with end-labeled −155/−131 double-stranded DNA. Complex B appeared to be nonspecific, as it was not competed by a 100-fold molar excess of unlabeled oligonucleotide; by contrast, complex A was readily competed by a 100-fold excess of unlabeled probe. When the protein·DNA complexes were incubated with rabbit antiserum to human LBP-1a/b (generously provided by Dr. R. Roeder), the anti LBP-1 inhibited the formation of complex A but not complex B. Thus JEG-3 nuclear extract contains a protein that binds to −155/−131 and is immunologically related to LBP-1. Yeast extracts containing the LBP-1b and LBP-9 proteins, but not LBP-32, also formed complexes with the double-stranded −155/−131 DNA (Fig. 4). Yeast-expressed LBP-1b forms complex C, which is competed by cold probe and inhibited by the anti LBP-1 antiserum, similarly to complex A formed by the JEG-3 nuclear extract. However, the mobility of complex C was clearly different from that of complex A, suggesting that LBP-1b does not form JEG-3 cell complex A. The absence of a band corresponding to complex C in JEG-3 nuclear extracts could mean that LBP-1b is of low abundance in JEG-3 cells or that LBP-1b has weak affinity for −155/−131. The complex formed by LBP-9 had the same apparent mobility as JEG-3 complex A, was inhibited by excess cold probe, and unlike the other complexes, was supershifted by the antiserum to LBP-1. Thus LBP-9 may be the protein generating complex A, but the difference between inhibition of complex A formation and supershifting of the LBP-9 complex may mean that complex A is not formed by the LBP-9 protein. Yeast extracts containing LBP-32 did not yield detectable complex formation with the −155/−131 oligonucleotide (not shown), hence LBP-32 was not considered further. To assess the potential roles of LBP-1b and LBP-9 in the regulation of human P450scc gene transcription, we assessed the capacity of mammalian expression vectors for these two proteins to transactivate a single copy of the −151/−131 sequence linked to the minimal 32-base promoter of the thymidine kinase gene (TK32) fused to the luciferase reporter transfected into JEG-3 cells. The −155/−131 sequence increased TK32LUC activity 3.4-fold, but mutation of 10 bases in the −155/−131 sequence reduced this to a 2-fold increase (Fig.5 A). To determine whether LBP-1b or LBP-9 influenced this basal activity, we co-transfected JEG-3 cells with the −155/−131/TK32LUC reporter and vectors expressing either LBP-1b or LBP-9. LBP-1b increased the activity of the wild-type −155/−131 sequence 21-fold but had no effect on the 10-base mutant of −155/−131, whereas LBP-9 had no apparent effect on either the wild-type or mutant −155/131 sequence (Fig. 5 A). When the −155/−131 sequence fused to TK32LUC was co-transfected with increasing amounts of the vector expressing LBP-1b, transcription was increased in a dose-dependent manner (Fig. 5 B). Thus LBP-1b had a clear stimulatory effect on transcription fostered by the −155/−131 sequence of human P450scc. Because the basal transcription from the −155/−131/TK32LUC construction was low, it was not clear whether LBP-9 had no effect or exerted a suppressive effect. Therefore, we examined the effect of LBP-9 on LBP-1b-induced transcription from −155/−131/TK32LUC in JEG-3 cells. Co-transfection of the −155/−131/TK32LUC reporter construct with 500 ng of the vector for LBP-1b and with increasing amounts of the vector for LBP-9 showed that LBP-9 suppressed the LBP-1b-induced activation of LUC expression in a dose-dependent fashion (Fig. 5 C). Thus, LBP-9 appears to be a transcriptional suppressor, and, in the amounts of protein expressed by our pSG5-based vectors, the suppressive action of LBP-9 appears to override the activating action of LBP-1b. The orphan nuclear receptor SF-1 is required for the production of steroid hormones in the adrenals and gonads but not in the placenta, brain, or other "extra-glandular" tissues. SF-1-independent transcription of P450scc has been demonstrated in the human placenta (24.Moore C.C.D. Hum D.W. Miller W.L. Mol. Endocrinol. 1992; 6: 2045-2058PubMed Google Scholar) and rat brain (23.Zhang P. Rodriguez H. Mellon S.H. Mol. Endocrinol. 1995; 9: 1571-1582Crossref PubMed Google Scholar), prompting a search for factors that can substitute for the essential role of SF-1. Some candidate factors have been identified. SF-1-independent transcription of the rat gene for steroid 17α-hydroxylase (P450c17) can be regulated by two factors operationally termed StF-IT-1 and StF-IT-2 (45.Zhang P. Mellon S.H. Mol. Endocrinol. 1997; 11: 891-904Crossref PubMed Scopus (133) Google Scholar) and by ku autoantigen (46.Zhang P. Hammer F. Bair S. Wang J. Reeves W.H. Mellon S.H. DNA Cell Biol. 1999; 18: 197-208Crossref PubMed Scopus (15) Google Scholar). StF-IT-1 has recently been identified as the oncoprotein SET (47.Compagnone, N., Zhang, P., and Mellon, S. (1999) 80th Annual Meeting of the Endocrine Society, New Orleans, June 24-27, 1999, p. 118, Abstract OR50–5,Google Scholar), a factor not previously known to be a transcriptional regulator. Thus it appears that an unexpectedly broad array of proteins can regulate the transcription of the genes for the steroidogenic enzymes. We have now added factors related to the LBP group of transcription factors to this growing family. The LBP family of transcription factors was initially characterized as a single cellular factor that bound to two different sites in the HIV, type I promoter (48.Garcia J.A. Wu F.K. Mitsuyasu R. Gaynor R.B. EMBO J. 1987; 6: 3761-3770Crossref PubMed Scopus (176) Google Scholar, 49.Wu F.K. Garcia J.A. Harrich D. Gaynor R.B. EMBO J. 1988; 7: 2117-2130Crossref PubMed Scopus (109) Google Scholar, 50.Jones K.A. Luciw P.A. Duchange N. Genes Dev. 1988; 2: 1101-1114Crossref PubMed Scopus (174) Google Scholar, 51.Kato H. Horikoshi M. Roeder R.G. Science. 1991; 251: 1476-1479Crossref PubMed Scopus (107) Google Scholar). Later work showed that there are two related LBP genes, each of which encodes two alternately spliced transcripts, so that LBP-1a and LBP-1b arise from one gene, and LBP-1c and LBP-1d arise from a second gene (26.Yoon J.B. Li G. Roeder R.G. Mol. Cell. Biol. 1994; 14: 1776-1785Crossref PubMed Scopus (99) Google Scholar). LBP-1c is identical to the α-globin transcription factor CP2 (52.Lim L.C. Swendeman S.L. Sheffery M. Mol. Cell. Biol. 1992; 12: 828-835Crossref PubMed Google Scholar), and proteins in the LBP family are all related to Elf-1/NTF-1, which is essential for Drosophilaembryogenesis (43.Bray S.J. Burke B. Brown N.H. Hirsh J. Genes Dev. 1989; 3: 1130-1145Crossref PubMed Scopus (98) Google Scholar, 44.Dynlacht B.D. Attardi L.D. Admon A. Freeman M. Tjian R. Genes Dev. 1989; 3: 1677-1688Crossref PubMed Scopus (95) Google Scholar). Thus the LBP proteins represent an evolutionary ancient family of transcription factors that participate in development. Sequences related to retroviruses are found throughout the human genome (53.Lieb-Mösch C. Bachmann M. Brack-Werner R. Werner T. Erfle V. Hehlmann R. Leukemia (Baltimore). 1992; 6 (suppl.): 72-75Google Scholar, 54.Lieb-Mösch C. Seifarthe W. Virus Genes. 1995; 11: 133-145Crossref PubMed Scopus (68) Google Scholar) and frequently regulate expression of adjacent cellular genes, especially those expressed in the placenta (55.Simon M. Haltmeier M. Papakonstantinou G. Werner T. Hehlmann R. Leib-Meosch C. Leukemia (Baltimore). 1994; 8 Suppl. 1: 12-17Google Scholar, 56.Sjøttem E. Anderssen S. Johansen T. J. Virol. 1996; 70: 188-198Crossref PubMed Google Scholar). We find no evidence for the insertion of a retroviral regulatory sequence as has been described for placental expression of human pleiotropin (57.Schulte A. Lai S. Kurtz A. Czubayko F. Riegel A. Wellstein A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14759-14764Crossref PubMed Scopus (183) Google Scholar), although sequences similar to −155/−131 are not found in the bovine or rat P450scc promoters. Hence, whereas it may not be surprising to find LBP-related proteins participating in transcriptional regulation in the placenta, to our knowledge this is the first report of an action of LBP-1b on an endogenous, non-viral promoter or of any LBP-related factor participating in the transcriptional regulation of a gene involved in steroid hormone biosynthesis. Our mobility shift data show that LBP-1b and LBP-9 bind to the −151/−131 segment of the human P450scc promoter. In comparison with our previous studies of the P450scc promoter in JEG-3 cells, it appears that LBP-9 forms what was previously called Complex IV, LBP-1b forms a previously undetected complex, and neither LBP-1b or LBP-9 forms what was previously called Complex VII (25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar). Our previous data suggested that a 55-kDa protein forming Complex VII was required for basal, placental-specific expression of P450scc, whereas complex IV appeared to be involved in modulating P450scc expression (25.Hum D.W. Aza-Blanc P. Miller W.L. DNA Cell Biol. 1995; 14: 451-463Crossref PubMed Scopus (31) Google Scholar). Our present data are consistent with those earlier observations, suggesting that LBP-1b and LBP-9, respectively, amplify or diminish the level of expression initiated by other factors. This action of LBP-related proteins to function as quantitative "volume controls" rather than as basal "on/off switches" is consistent with their similar action to modulate the level of HIV, type I transcription and is similar to the reciprocal action of Sp1 and Sp3 on numerous genes (58.Birnbaum M. van Wijnen A. Odgren P. Last T. Suske G. Stein G. Stein J. Biochemistry. 1995; 34: 16503-16508Crossref PubMed Scopus (178) Google Scholar, 59.Philipsen S. Suske G. Nucleic Acids Res. 1999; 27: 2991-3000Crossref PubMed Scopus (537) Google Scholar) including adrenal expression of bovine P450scc (60.Ahlgren R. Suske G. Waterman M. Lund J. J. Biol. Chem. 1999; 274: 19422-19428Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Thus LBP proteins are important newly described modulators of placental P450scc expression, but other, as yet uncharacterized proteins are probably required for basal placental-specific expression of this gene. We thank Dr. Robert G. Roeder (Rockefeller University, New York) for the antiserum to LBP.

Referência(s)