Portal de Periódicos da CAPES

Binding of Pyridine Nucleotide Coenzymes to the β-Subunit of the Voltage-sensitive K+ Channel

2001; Elsevier BV; Volume: 276; Issue: 15 Linguagem: Inglês

10.1074/jbc.m008259200

1083-351X

Siqi Liu, Hongjun Jin, Albert Zacarias, Sanjay Srivastava, Aruni Bhatnagar,

Neuroscience of respiration and sleep

The β-subunit of the voltage-sensitive K+ (Kv) channels belongs to the aldo-keto reductase superfamily, and the crystal structure of Kvβ2 shows NADP bound in its active site. Here we report that Kvβ2 displays a high affinity for NADPH (K d = 0.1 μm) and NADP+(K d = 0.3 μm), as determined by fluorometric titrations of the recombinant protein. The Kvβ2 also bound NAD(H) but with 10-fold lower affinity. The site-directed mutants R264E and N333W did not bind NADPH, whereas, the K dNADPH of Q214R was 10-fold greater than the wild-type protein. TheK dNADPH was unaffected by the R189M, W243Y, W243A, or Y255F mutation. The tetrameric structure of the wild-type protein was retained by the R264E mutant, indicating that NADPH binding is not a prerequisite for multimer formation. A C248S mutation caused a 5-fold decrease inK dNADPH, shifted the pK a of K dNADPH from 6.9 to 7.4, and decreased the ionic strength dependence of NADPH binding. These results indicate that Arg-264 and Asn-333 are critical for coenzyme binding, which is regulated in part by Cys-248. The binding of both NADP(H) and NAD(H) to the protein suggests that several types of Kvβ2-nucleotide complexes may be formed in vivo. The β-subunit of the voltage-sensitive K+ (Kv) channels belongs to the aldo-keto reductase superfamily, and the crystal structure of Kvβ2 shows NADP bound in its active site. Here we report that Kvβ2 displays a high affinity for NADPH (K d = 0.1 μm) and NADP+(K d = 0.3 μm), as determined by fluorometric titrations of the recombinant protein. The Kvβ2 also bound NAD(H) but with 10-fold lower affinity. The site-directed mutants R264E and N333W did not bind NADPH, whereas, the K dNADPH of Q214R was 10-fold greater than the wild-type protein. TheK dNADPH was unaffected by the R189M, W243Y, W243A, or Y255F mutation. The tetrameric structure of the wild-type protein was retained by the R264E mutant, indicating that NADPH binding is not a prerequisite for multimer formation. A C248S mutation caused a 5-fold decrease inK dNADPH, shifted the pK a of K dNADPH from 6.9 to 7.4, and decreased the ionic strength dependence of NADPH binding. These results indicate that Arg-264 and Asn-333 are critical for coenzyme binding, which is regulated in part by Cys-248. The binding of both NADP(H) and NAD(H) to the protein suggests that several types of Kvβ2-nucleotide complexes may be formed in vivo. The voltage-sensitive K+ (Kv) channels participate in several cellular processes. In excitable tissues, these channels play an essential role in establishing the resting membrane potential and in modulating the frequency and the duration of the action potential (1Hille B. Ionic Channels of Excitable Membranes.Sinauer Associates, Inc. 1991; Google Scholar). In nonexcitable cells, they are involved in cell volume regulation, hormone secretion, oxygen sensing, and cell proliferation (2Kolb H.A. Rev. Physiol. Biochem. Pharmacol... 1990; 115: 51-91Google Scholar). The functional diversity of these channels is partly due to variations in their structure. The ion-conducting pore of these channels is formed by heterotetramers of different, but structurally related, α subunits (2Kolb H.A. Rev. Physiol. Biochem. Pharmacol... 1990; 115: 51-91Google Scholar, 3Shi G. Nakahira K. Hammond S. Rhodes K.J. Schechter L.E. Trimmer J.S. Neuron.. 1996; 16: 843-852Google Scholar). Moreover, the cytoplasmic face of the Kvα proteins associates with auxiliary β-subunits (Kvβ), which do not participate in ion conductance but can regulate the activity of the channel (4Xu J. Li M. Trends Cardiovasc. Med... 1998; 8: 229-234Google Scholar, 5Pongs O. Leicher T. Berger M. Roeper J. Bahring R. Wray D. Giese K.P. Silva A.J. Storm J.F. Ann. N. Y. Acad. Sci... 1999; 868: 344-355Google Scholar). Several homologous genes encoding the Kvβ proteins have been described. A comparison of the amino acid sequences of the β-subunit proteins shows that these proteins have a variable N terminus and a highly conserved C-terminal domain. The β-subunits have been assigned to three classes: Kvβ1 to 3. In addition, several splice variants of Kvβ1, that is, Kvβ1.1, 1.2, and 1.3, have been reported (for review, see Refs. 4Xu J. Li M. Trends Cardiovasc. Med... 1998; 8: 229-234Google Scholar and 5Pongs O. Leicher T. Berger M. Roeper J. Bahring R. Wray D. Giese K.P. Silva A.J. Storm J.F. Ann. N. Y. Acad. Sci... 1999; 868: 344-355Google Scholar). Although some of the β-subunits enhance the inactivation of the Kvα currents (4Xu J. Li M. Trends Cardiovasc. Med... 1998; 8: 229-234Google Scholar, 5Pongs O. Leicher T. Berger M. Roeper J. Bahring R. Wray D. Giese K.P. Silva A.J. Storm J.F. Ann. N. Y. Acad. Sci... 1999; 868: 344-355Google Scholar), the physiological role of these proteins remains unclear. In heterologous systems, coexpression of Kvβ increases the surface expression of Kvα, indicating that the β subunits regulate the expression and/or the localization of the Kvα proteins. Moreover, Kvβ2, which is the most widely distributed of the β-subunits, does not affect inactivation even though it associates with Kvα, suggesting that the β-subunits may have other undetermined physiological functions. Structural analyses support the view that Kvβ proteins may have unique regulatory properties not displayed by accessory proteins of other ion channels. The primary amino acid sequence of the Kvβ proteins is not related to the auxiliary proteins of other voltage-sensitive channels but, unexpectedly, to the proteins of the aldo-keto reductase (AKR)1 superfamily (6McCormack T. McCormack K. Cell.. 1994; 79: 1133-1135Google Scholar, 7Chouinard S.W. Wilson G.F. Schlimgen A.K. Ganetzky B. Proc. Natl. Acad. Sci. U. S. A... 1995; 92: 6763-6767Google Scholar). Within this superfamily, the amino acid sequences of the Kvβ proteins are most closely related to alfatoxin reductase (AKR7) and morphine dehydrogenase and 2,5-diketogluconate reductase (AKR5). On the basis of this homology, the Kvβ proteins have been assigned to the AKR6 family (8Jez J.M. Bennett M.J. Schlegel B.P. Lewis M. Penning T.M. Biochem. J... 1997; 326: 625-636Google Scholar). The AKR proteins catalyze the reduction or the oxidation of a broad range of carbonyl substrates, including aldoses, steroids, prostaglandins, and aldehydes derived from lipid peroxidation (8Jez J.M. Bennett M.J. Schlegel B.P. Lewis M. Penning T.M. Biochem. J... 1997; 326: 625-636Google Scholar, 9Srivastava S. Harter T.M. Chandra A. Bhatnagar A. Srivastava S.K. Petrash J.M. Biochemistry.. 1998; 37: 12909-12917Google Scholar, 10Srivastava S. Watowich S.J. Petrash J.M. Srivastava S.K. Bhatnagar A. Biochemistry.. 1999; 38: 42-54Google Scholar, 11Jez J.M. Flynn T.G. Penning T.M. Biochem. Pharmacol... 1997; 54: 639-647Google Scholar). The sequence homology between the β-subunits and the AKR proteins suggests that the Kvβ proteins are catalytically competent oxidoreductases that couple metabolic changes to membrane excitability. The crystal structure of Kvβ2 shows that the protein folds into β8/α8 or the triosephosphate isomerase barrel motif similar to other AKR proteins (12Gulbis J.M. Mann S. MacKinnon R. Cell.. 1999; 97: 943-952Google Scholar). A single molecule of NADP+ was found to co-crystallize with each monomer of the protein (12Gulbis J.M. Mann S. MacKinnon R. Cell.. 1999; 97: 943-952Google Scholar). The cofactor was bound to the C terminus of Kvβ2 by active site residues, some of which are conserved within the AKR superfamily. Nonetheless, no functional data are available on pyridine nucleotide binding to Kvβ. In the present study, we examined the coenzyme specificity and selectivity of the purified Kvβ2 and investigated the role of individual active site residues involved in binding pyridine nucleotides. The cDNA containing the coding sequence for Kvβ2 was a gift from Dr. Min Li. To generate the Kvβ2 cDNA fragment with a NdeI site at the 5′ end and a XhoI site at the 3′ end, standard polymerase chain reaction procedures were used. The primers for the full-length β-subunit were 5′-CATATGTATCCGGAATCAACC-3′ (forward) and 5′-GGATCCTGACTTAGGATCTATAGTCC-3′ (reverse) and for the N-terminal deleted β-subunit were 5′-AGACAGCTCCATATGTACAGGAAC-3′ (forward) and 5′-GGATCCTGACTTAGGATCTATAGTCC-3′. The polymerase chain reaction products were inserted into pCR-TOPO (Invitrogen), and the amplified vector was further digested by NdeI and XhoI to isolate the β-subunit fragments, which were ligated to a linearized pET28a vector cleaved by NdeI and XhoI. The expression vectors pET28-Fβ (full-length Kvβ2) and pET28-C β(ΔNKvβ2, encoding amino acid residues 39–367) were transformed into strain BL21 of Escherichia coli. The transformed bacteria were cultured at 37 °C in LB medium containing 50 μg/ml kanamycin. When the absorbance of the culture medium at 600 nm reached ∼0.8, the expression of the Kvβ2 protein was induced by the addition of 1 mm isopropyl-β-d-thiogalactoside. Induction was continued for another 4 h at 25 °C with constant shaking at 280 rpm. The bacteria were lysed by sonication in a buffer consisting of 20 mm Tris-HCl, pH 7.9, 200 mm NaCl, and 5 mm imidazole. The cell debris was pelleted by centrifugation, and the supernatant was applied to a nickel nitrilotriacetic acid Superflow (Qiagen) column that was pre-equilibrated with the binding buffer. The protein bound to the column was eluted by a step change in the imidazole concentration from 50 to 300 mm. The Kvβ2 protein was identified by its mobility on 12% SDS-polyacrylamide gel electrophoresis. Fractions containing Kvβ2 were collected, pooled, and dialyzed against 0.15 m potassium phosphate, pH 7.4. The molecular weight of the purified protein was determined by size-exclusion chromatography using a TSK-GEL G3000SWXL(TosoHass, Montomeryville, PA) column and a Waters Alliance HPLC. The column was equilibrated with 0.4 m potassium phosphate, pH 7.4, and calibrated using thyroglobulin (670 kDa), γ-globulin (158 kDa), ovalbumin (43 kDa), and myoglobin (17.6 kDa). Site-directed mutants of ΔNKvβ2 were prepared using QuikChange mutagenesis kit (Stratagene). Mutation sites were introduced by single-mutant primers in polymerase chain reaction amplification using the PfuTurbo DNA polymerase (Stratagene). The following primers were used: CTGGGGCACATCAATGTGGAGCTCCATGGAG (R189M), GGTGCCATGACCGCGTCCCCTCTGGCGTGC (W243A), GGTGCCATGACCTACTCCCCTCTGGCGTGC (W243Y), CTGGTCCCCTCTGGCGTCCGGCATCGTC (C248S), GTCTCAGGGAAGTTTGACAGCGGGATCCCAC (Y255F), CCCATCTGCGAGCGAGCGGAATATCAC (Q214R), CACCCTACTCCGAAGCCTCCCTGAAG (R264E), CAACTTATGGAGTGGATTGGAGCAATACAG (N333W). The sequence of the site-directed mutants was confirmed by DNA sequencing. The mutants were expressed and purified as described above. Fluorescence spectra were recorded on a Shimadzu RF-5301 PC fluorescence spectrophotometer. Unless indicated otherwise, an excitation wavelength of 290 nm and an emission wavelength of 335 or 345 nm were used for the fluorometric titrations. Aliquots of the protein were equilibrated with 2.0 ml of 0.15m potassium phosphate, pH 7.4. The fluorescence of the protein was measured before and after the addition of 2–20 μl of the pyridine nucleotides. To minimize nucleotide absorbance, a 5 × 10-mm cuvette was used for titrations with NAD(H). For measuring the pH dependence of coenzyme binding, a three-buffer system was used that consisted of MES, MOPS, and Tris. The pK values of the individual components of the buffer at an ionic strength of 0.2m and the amount of salt needed to keep the ionic strength constant throughout the experimental pH range were calculated using a computer program (13Liu S.Q. Bhatnagar A. Srivastava S.K. J. Biol. Chem... 1993; 268: 25494-25499Google Scholar). The protein concentration was measured by the Bradford dye binding method (14Bradford M.M. Anal. Biochem... 1976; 72: 248-254Google Scholar). Fluorescence titration data were fitted to a binding equation that takes into account the corrections for scatter, dilution, and cofactor absorbance (15Ward L.D. Methods Enzymol... 1985; 117: 400-414Google Scholar). In this equation, the fluorescence intensity I is a function of the cofactor concentration X, the protein concentration P, and the dissociation constant K d, as shown below. I(P,X,Kd)=e−ρXγ(Ymin−Ymax)[PX]P,X,Kd[P]+Ymax+YbgndEquation 1 In this relationship, Y min andY max are the minimum and maximum fluorescence intensities, respectively, Y bgnd is the intensity of the background scatter, γ isV initial/( V initial +V X) (the dilution factor), and ρ is the absorbance coefficient of the cofactor. The fraction of the protein bound to the cofactor is related to these parameters as follows.[PX]P,X,Kd[P]=γP+X+Kd2γP−12γP+X+KdγP2−4XγPEquation 2 Using 0.1–2 μm protein, we first determined the approximate K d of the individual nucleotides. Then, for final measurement of the K d, the data were acquired at a protein concentration less than the expected value ofK d. The concentration of the active protein [P] was determined by the curve-fitting procedure under the condition when the total concentration of the protein was more thanK d. Typically, ∼70% of the protein was found to be active by this method. The absorbance correction used in the curve-fitting procedure was verified by titrating solutions of tryptophan (of equal absorbance as the protein) with NADPH. The pH dependence of coenzyme binding was analyzed using Equation 3, in which log Y (=1/K d) decreases at both high and low pH (16Cleland W.W. Methods Enzymol... 1979; 63: 103-138Google Scholar) as follows.logY=logc1+[H+]Ka+Kb[H+]Equation 3 where K a and K b are the dissociation constants of the enzyme, and c is the pH-independent value of Y. Additionally, Equation 4 was used to analyze data in which the value of Y decreases at low pH but levels out to a new value.logY=loga+bKa[H+]1+Ka[H+]Equation 4 The ionic strength dependence of pyridine nucleotide binding was analyzed using the Boltzmann relationship as follows.Y=Ymax1+e−K1/2−XCEquation 5 where Y is the dissociation constant, X is the ionic strength, Y max is the maximal value of the parameter, K 1/2 is the value of Xat which Y is half-maximal, and C is the slope factor. In all cases, the best fit to the data was chosen on the basis of the standard error of the fitted parameter and the lowest value of ς, which is the residual sum of squares divided by the degrees of freedom. As shown in Fig. 1, the purified wild-type (WT) Kvβ2, its N terminus deleted form (ΔNKvβ2), and the indicated site-directed mutants migrated as single bands on SDS-polyacrylamide electrophoresis gels. The molecular masses of these proteins were between 38 and 40 kDa. When examined by size exclusion chromatography, the ΔNKvβ2 eluted with a retention time of 9.8 min, which corresponds to a Strokes radius of a protein with a molecular mass of 153 kDa, indicating that under these conditions, the protein exists primarily as a homotetramer. No monomeric or dimeric forms of the protein were observed (Fig.1 B). The freshly purified ΔNKvβ2 showed a high absorbance at 260 nm and an additional absorbance band centered near 360 nm (Fig. 2 A,inset), indicating that the purified protein remains bound to NAD(P)H. From the absorbance at 363 nm, a stoichiometry of ∼0.9 mol of NADPH bound/mol of the protein was calculated. To confirm that the purified preparation was indeed a binary complex, the fluorescence spectrum of the nucleotide-bound protein was recorded. When excited at 290 nm, the freshly isolated protein showed two prominent emission bands with peaks at 335 and 450 nm (Fig. 2 B). Upon extensive dialysis against 0.15 m potassium phosphate, pH 7.4, the intensity of the 335-nm band increased with a corresponding decrease in the emission band at 450 nm. When 1 μm NADPH was added to the dialyzed protein, the 450-nm band reappeared, whereas the emission at 335 nm was quenched (data not shown). The emission band at 450 nm was not restored by the addition of NADP+, although this did quench the emission at 335 nm. We conclude, based on these observations, that NADPH remains bound to the freshly purified ΔNKvβ2 and that it is lost from the protein upon dialysis. These data also show that the formation of a binary complex between NADPH and ΔNKvβ2 quenches the intrinsic tryptophan fluorescence of the protein and leads to the appearance of a new emission band at 450 nm. However, for all subsequent experiments, we monitored the emission at 335 nm because, in contrast to the alterations at 450 nm, changes at 335 nm were independent of the redox state of the nucleotide.Figure 2Retention of NADPH in purified Kvβ2. Freshly prepared ΔNKvβ2 (∼1 mg/ml) was suspended in 0.15 mpotassium phosphate, pH 7.4, and scanned for absorbance and fluorescence. A, absorbance scan of ΔNKvβ2. The inset shows the absorbance of the protein between 310 and 400 nm. B, emission scan of ΔNKvβ2 in phosphate buffer before (−) and after (−) dialysis against phosphate buffer for 2 weeks. Identical protein concentrations were used for the two emission scans.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The titration of the extensively dialyzed Kvβ2 with NADPH led to a progressive loss of fluorescence at 335 nm (Fig.3). The change in fluorescence was saturated at high nucleotide concentration, and the addition of more than 0.6 μm NADPH caused no further decrease in fluorescence. Typically, NADPH quenched a maximum of ∼30–40% of the total fluorescence. Because the protein concentration was an independent variable in the fitting routine, at protein concentration >K d, we estimate that 60–70% of the total protein was bound to NADPH. The K dNADPH of the full-length Kvβ2 was 0.08 ± 0.004 μmand that of ΔNKvβ was 0.10 ± 0.006 μm. These results suggest that Kvβ2 has a high affinity for NADPH that is not affected by the deletion of the N-terminal domain. Thus for all subsequent experiments, the ΔNKvβ2 protein was used. In addition to NADPH, ΔNKvβ2 also displayed a high affinity for NADP+, althoughK dNADP+ was 3-fold higher thanK dNADPH (TableI). The nucleotides, NADH, and NAD+ were also bound to the protein. However, the large intrinsic absorbance of these nucleotides at the high concentrations required for the assay precluded the accurate determination of theK dNAD(H) under conditions identical to those used for measuring K dNADP(H). Hence, to optimize emission and to minimize inner filter effects, a 5 × 10-mm cuvette was used for the assay, and instead of 335 nm, the emission of the protein was measured at 345 nm. Under these conditions the absorbance of 0.1 mm NAD(H) was less than 0.05 (see "Experimental Procedures"). TheK dNAD(H) values thus determined were in the low micromolar range (Table I).Table IThe binding of pyridine nucleotide coenzymes and analogs to Kvβ2LigandK dμmNADPH0.12 ± 0.004NADP+0.36 ± 0.014NADH1.23 ± 0.16NAD+3.61 ± 0.43′-Acetylpyridine NADP+4.24 ± 1.153′-Aminopyridine NADP+14.35 ± 1.34ADP-ribose412.01 ± 23.5FAD10.2 ± 5.99NMN144 ± 15.3NicotinamideN.D.Recombinant ΔNKvβ2 protein was suspended in 2 ml of 0.15m potassium phosphate, pH 7.4, and changes in emission at 335 or 345 nm were monitored using an excitation wavelength of 290 nm. The concentration of the protein used was less than theK d. Aliquots of the indicated ligands were added to the cuvette, and steady-state fluorescence was recorded. TheK d values were determined as described under "Experimental Procedures." Data are shown as the mean ± S.D. (n = 3–7). FAD, flavin adenine dinucleotide; NMN, nicotinamide mononucleotide; N.D., no detectable change in fluorescence observed after the addition of 100 μm ligand. Open table in a new tab Recombinant ΔNKvβ2 protein was suspended in 2 ml of 0.15m potassium phosphate, pH 7.4, and changes in emission at 335 or 345 nm were monitored using an excitation wavelength of 290 nm. The concentration of the protein used was less than theK d. Aliquots of the indicated ligands were added to the cuvette, and steady-state fluorescence was recorded. TheK d values were determined as described under "Experimental Procedures." Data are shown as the mean ± S.D. (n = 3–7). FAD, flavin adenine dinucleotide; NMN, nicotinamide mononucleotide; N.D., no detectable change in fluorescence observed after the addition of 100 μm ligand. We next determined the interaction of Kvβ2 with different nucleotide analogs. The K d of the protein for 3′-acetylpyridine NADP+ was 10-fold greater as compared with NADP+, indicating that the amide side chain of the nicotine ring participates in high affinity binding of NADP+ to the protein. The removal of the 3′-carbonyl from the nicotine ring also led to a decrease in affinity (compare theK d values for 3-aminopyridine NADP+ and NADP+), suggesting that there are energetically significant interactions between the 3′ side chain of the pyridine ring and the binding site residues. Other fragments of the pyridine coenzymes such as ADP-ribose, NMN, and nicotinamide displayed poor affinity for ΔNKvβ2. Moreover, the flavin coenzyme, FAD, bound weakly to the protein, indicating that it is unlikely to be an in vivo ligand of Kvβ2 or to compete with pyridine coenzymes for binding to the active site of the protein. The crystal structure of the ΔNKvβ·NADP+binary complex shows that the coenzyme binds into a deep cleft in the triosephosphate isomerase scaffolding of the protein (12Gulbis J.M. Mann S. MacKinnon R. Cell.. 1999; 97: 943-952Google Scholar). When bound, the cofactor displays an extended conformation and makes several contacts with the binding site residues. A schematic representation of these interactions is shown in Fig. 4. The sequence alignment of the Kvβ proteins, using the program CLUSTLW (17Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res... 1994; 22: 4673-4680Google Scholar), revealed that most of the residues interacting with the cofactor in Kvβ2 are conserved in other Kvβ proteins (Fig. 5). The orientation of the nicotinamide ring in Kvβ2 is constrained by H bonding with a basic residue (Arg-189) and π-stacking against an aromatic residue (Trp-243). To examine the significance of these interactions, site-directed mutants of ΔNKvβ2 were prepared in which Arg-189 was replaced by methionine, and Trp-243 was replaced by phenylalanine. As shown in Table II, no significant changes in theK dNADPH were observed with these mutations as compared with the WT protein. To confirm that the lack of change in the K dNADPH was not due to the retention of hydrophobicity in the tryptophan to phenylalanine substitution, Trp-243 was replaced with alanine. However, theK dNADPH of W243A was comparable with that of W243Y or the WT protein, indicating that ring stacking or the hydrophobicity of the residue at position 243 does not contribute to NADPH binding. In contrast, the disruption of the hydrogen bond between Asn-333 and the adenine ring in the N333W mutant completely prevented NADPH binding to the protein. Similarly, the replacement of an arginine replacement of glutamine 214, which interacts with the hydrogens attached to N7N of the nicotinamide ring, led to a 20-fold increase in K dNADPH. This observation indicates that the amide side chain of the pyridine ring plays a significant role in nucleotide recognition at the Kvβ2 binding site.Figure 5The alignment of the amino acids sequences of the conserved C terminus core of Kvβ proteins. The sequences were aligned using the program CLUSTALW (17Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res... 1994; 22: 4673-4680Google Scholar). The filled circles indicate the residues forming contacts with NADP(H). The residues mutated in this study areboxed. The sequences were obtained from the NCBI protein data bank: Kvβ1 (human, S66503), Kvβ2 (rat,X76724), Kvβ3 (rat, S7562), and Kvβ4 (mouse, U65593).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IIThe binding of NADPH to ΔNKvβ2 and its site-directed mutantsProteinK dμmΔNKvβ20.11 ± 0.02R189M0.093 ± 0.01W243Y0.068 ± 0.003W243A0.106 ± 0.005N333WN.D.Q214R2.14 ± 0.4Y255F0.096 ± 0.001C248S0.017 ± 0.001R264EN.D.The K d values of the protein were determined in 0.15m potassium phosphate, pH 7.4, as described under "Experimental Procedures." Data are the mean ± S.D. N.D., no detectable change in fluorescence after the addition of 1 mm NADPH. Open table in a new tab The K d values of the protein were determined in 0.15m potassium phosphate, pH 7.4, as described under "Experimental Procedures." Data are the mean ± S.D. N.D., no detectable change in fluorescence after the addition of 1 mm NADPH. In the ΔNKvβ2·NADP binary complex the oxygen attached to the ribose phosphate (OP1R) interacts with Tyr-255 via a water molecule (12Gulbis J.M. Mann S. MacKinnon R. Cell.. 1999; 97: 943-952Google Scholar), suggesting that this residue may be involved in coenzyme binding. The replacement of Tyr-255 with phenylalanine, however, did affect K dNADPH (Table II), indicating that this residue does not contribute to pyridine nucleotide binding. In addition to Tyr-255, the water molecule associated with OP1R forms a hydrogen bond with Cys-248 (12Gulbis J.M. Mann S. MacKinnon R. Cell.. 1999; 97: 943-952Google Scholar). This cysteine residue also interacts with the pyrophosphate oxygen (OP2A1) in a mode reminiscent of the lysine residue (Lys-262) that is responsible for the tight binding of NADPH to aldose reductase (AR; Ref. 18Bohren K.M. Page J.L. Shankar R. Henry S.P. Gabbay K.H. J. Biol. Chem... 1991; 266: 24031-24037Google Scholar). The replacement of Cys-248 by serine, however, increased the affinity of ΔNKvβ2 for NADPH, as evinced by a decrease in K dNADPH from 100 to 20 nm (Table II). The coenzyme selectivity of the AKR proteins is in part due to the presence of basic amino acids in their binding pockets that accommodates the 2′-phosphate of NADPH (8Jez J.M. Bennett M.J. Schlegel B.P. Lewis M. Penning T.M. Biochem. J... 1997; 326: 625-636Google Scholar, 19Kubiseski T.J. Green N.C. Borhani D.W. Flynn T.G. J. Biol. Chem... 1994; 269: 2183-2188Google Scholar, 20Matsuura K. Tamada Y. Sato K. Iwasa H. Miwa G. Deyashiki Y. Hara A. Biochem. J... 1997; 322: 89-93Google Scholar). The 2′-phosphate binding pocket of Kvβ2 contains only one basic residue, that is, Arg-264. This residue forms a hydrogen bond with the free hydroxyl group of the adenine ribose and interacts with OP4R of the 2′-phosphate (Fig. 4). In our experiments, the replacement of Arg-264 with glutamic acid led to a complete loss of NADPH binding. The fluorescence of R264E was not quenched even by the addition of 1 mm of NADPH. These observations suggest that Arg-264 is essential for NADPH binding to Kvβ2. To confirm the results obtained from fluorometric titrations, the complete fluorescence spectra of the site-directed mutants were recorded. As expected, the freshly purified N333G and R264E proteins displayed a much stronger emission band at 335 nm than did equimolar concentrations of the WT or the C248S protein. Both the WT and C248S proteins displayed an additional band at 450 nm, which was absent in the emission spectra of the N333W and the R264E proteins (Fig.6), indicating that the N333W and R264E proteins do not bind NADPH. When excited at 340 nm (to elicit NADPH fluorescence), both the WT and the C248S proteins displayed strong emission near 450 nm, whereas the N333W and the R264E proteins did not; confirming that the N333W and R264E proteins do not contain NADPH bound to their active sites. To examine whether the lack of NADPH binding affects the quaternary structure of the protein, we determined the Strokes radius of R264E using size exclusion chromatography. The R264E protein eluted from the HPLC column with a retention time of 9.7 min (data not shown), which was similar to the retention time of the WT protein, indicating that binding of NADPH is not essential for the formation of the ΔNKvβ2 homotetramers. To further characterize coenzyme binding to Kvβ2, we examined the effects of ionic strength and pH. As shown in Fig.7 A, an increase in the ionic strength of the buffer led to a decrease inK dNADPH. This dependence was best described by a Boltzmann function (Equation 5), in which the maximal value of the K dNADPH(Y max) was calculated to be 2.9 ± 0.3 μm, with a K 1/2 of 0.59 ± 0.04 m and a slope factor C of 0.15 ± 0.03 × 10-6. The effect of ionic strength on theK dNADPH of R189M was similar to that observed with the WT protein. However, the ionic strength dependence was significantly altered by the C248S mutation. Compared with the WT protein, C248S was less sensitive to changes in ionic strength. The best fit of Equation 5 to the data provided the following estimates of the parameters: Y max = 1.6 ± 0.4 μm, K 1/2 = 0.79 ± 0.15m, and C = 0.22 ± 0.05 × 10-6. These results support the idea that NADPH binding to Kvβ2 is sensitive to changes in ionic strength within the physiological range and that this sensitivity is in part due to Cys-248. The binding of NADPH to Kvβ2 was also found to be sensitive to pH. A systematic evaluation of the effects of pH revealed that the values of K dNADPH were enhanced at low pH but decreased at high pH. A plot of log (1/K d) reached a plateau at low pH, giving rise to a wave-like pH dependence (Fig. 7 B). Using Equation 4, a pKa of 6.9 ± 0.4 was calculated. At high pH, a slight decrease in K d was observed, but even at pH 10, log 1/K d did not decrease to half its maximal value, thereby precluding accurate estimates of pK b. An approximate calculation using Equation 3indicated that the pK b is near 9.6. T