Portal de Periódicos da CAPES

In Vivo Structure of the Cell Cycle-regulated Humancdc25C Promoter

2000; Elsevier BV; Volume: 275; Issue: 25 Linguagem: Inglês

10.1074/jbc.m001110200

1083-351X

Kathrin Körner, Rolf Müller,

CRISPR and Genetic Engineering

The cdc25C promoter is regulated during the cell cycle by the transcriptional repressor CDF-1 that inhibits the activation function of upstream transcriptional activators, most notably the nuclear factor Y/CAAT box binding factor (NF-Y/CBF). In this report a detailed analysis of the in vivo structure of the cdc25C promoter was made.Micrococcus nuclease and methidiumpropyl-EDTA footprinting strongly suggest that the proximal promoter encompassing the cell cycle-dependent element/cell cycle genes homology region and the upstream NF-Y sites is organized in a positioned nucleosome throughout the cell cycle. Furthermore, structural perturbations were detected by DNase I, phenanthroline copper, and KMnO4footprinting at the NF-Y binding sites in vivo, which is in agreement with the reported property of NF-Y to bend DNA in vitro. Similar results were obtained with the structurally and functionally related cyclin A promoter. The structural perturbations seen in DNase I and phenanthroline copper footprints were less pronounced in G0 cells when compared with cycling cells. This presumably reflects a weakened in vivointeraction of NF-Y with its cognate DNA element in G0. It is likely that these structural perturbations, together with the reported ability of NF-Y to recruit histone acetyl transferase activity, contribute to an opened chromatin structure as a prerequisite for optimal regulation through activation and repression. The cdc25C promoter is regulated during the cell cycle by the transcriptional repressor CDF-1 that inhibits the activation function of upstream transcriptional activators, most notably the nuclear factor Y/CAAT box binding factor (NF-Y/CBF). In this report a detailed analysis of the in vivo structure of the cdc25C promoter was made.Micrococcus nuclease and methidiumpropyl-EDTA footprinting strongly suggest that the proximal promoter encompassing the cell cycle-dependent element/cell cycle genes homology region and the upstream NF-Y sites is organized in a positioned nucleosome throughout the cell cycle. Furthermore, structural perturbations were detected by DNase I, phenanthroline copper, and KMnO4footprinting at the NF-Y binding sites in vivo, which is in agreement with the reported property of NF-Y to bend DNA in vitro. Similar results were obtained with the structurally and functionally related cyclin A promoter. The structural perturbations seen in DNase I and phenanthroline copper footprints were less pronounced in G0 cells when compared with cycling cells. This presumably reflects a weakened in vivointeraction of NF-Y with its cognate DNA element in G0. It is likely that these structural perturbations, together with the reported ability of NF-Y to recruit histone acetyl transferase activity, contribute to an opened chromatin structure as a prerequisite for optimal regulation through activation and repression. nuclear factor Y CCAAT box binding factor cell cycle-dependent element CDE-CHR binding factor-1 cell cycle genes homology region dimethyl sulfate ligation-mediated polymerase chain reaction methidiumpropyl-EDTA phenanthroline copper base pair(s) activating transcription factor NF-Y/CBF1 is a ubiquitously expressed transcriptional activator that interacts with CCAAT boxes found in the promoters of a wide variety of genes, including hormone-inducible, developmentally controlled, and cell cycle-regulated genes (1.Li X-Y. Huijsduijnen R.B. Mantovani R. Benoist C. Mathis D. J. Biol. Chem. 1992; 267: 8984-8990Abstract Full Text PDF PubMed Google Scholar, 2.Wright K.L. Moore T.L. Vilen B.J. Brown A.M. Ting J.P. J. Biol. Chem. 1995; 270: 20978-20986Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 3.Filatov D. Thelander L. J. Biol. Chem. 1995; 270: 25239-25243Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 4.Maity S.N. Crobrugghe B. Trends Biochem. Sci. 1998; 23: 174-178Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar). A particularly well studied example of the latter group of genes is the G2-specificcdc25C promoter (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar, 6.Zwicker J. Gross C. Lucibello F.C. Truss M. Ehlert F. Engeland K. Müller R. Nucleic Acids Res. 1995; 23: 3822-3830Crossref PubMed Scopus (91) Google Scholar, 7.Zwicker J. Lucibello F.C. Wolfraim L.A. Gross C. Truss M. Engeland K. Müller R. EMBO J. 1995; 14: 4514-4522Crossref PubMed Scopus (280) Google Scholar, 8.Zwicker J. Lucibello F.C. Jérôme V. Brüsselbach S. Müller R. Nucleic Acids Res. 1997; 25: 4926-4932Crossref PubMed Scopus (16) Google Scholar, 9.Liu N. Lucibello F.C. Körner K. Wolfraim L.A. Zwicker J. Müller R. Nucleic Acids Res. 1997; 25: 4915-4920Crossref PubMed Scopus (73) Google Scholar, 10.Körner K. Wolfraim L. Lucibello F.C. Müller R. Nucleic Acids Res. 1997; 25: 4933-4939Crossref PubMed Scopus (16) Google Scholar), which contains three functionally important NF-Y binding sites. Genomic DMS footprinting and functional promoter analyses demonstrate that NF-Y binding to the core and flanking regions of NF-Y sites is necessary for both maximal promoter activity and cell cycle regulation (6.Zwicker J. Gross C. Lucibello F.C. Truss M. Ehlert F. Engeland K. Müller R. Nucleic Acids Res. 1995; 23: 3822-3830Crossref PubMed Scopus (91) Google Scholar). The cdc25C promoter is regulated in G0/G1 phase by the transcriptional repressor CDF-1, which binds the CDE-CHR bipartite DNA element (9.Liu N. Lucibello F.C. Körner K. Wolfraim L.A. Zwicker J. Müller R. Nucleic Acids Res. 1997; 25: 4915-4920Crossref PubMed Scopus (73) Google Scholar), thereby blocking the function of the NF-Y and Sp1-Sp3 complexes bound immediately upstream of the CDE-CHR element (6.Zwicker J. Gross C. Lucibello F.C. Truss M. Ehlert F. Engeland K. Müller R. Nucleic Acids Res. 1995; 23: 3822-3830Crossref PubMed Scopus (91) Google Scholar). Upon entry into S/G2 the interaction of CDF-1 to its cognate binding site is abrogated, thus allowing for NF-Y- and Sp1-Sp3-mediated transcriptional activation of the cdc25C gene (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar, 6.Zwicker J. Gross C. Lucibello F.C. Truss M. Ehlert F. Engeland K. Müller R. Nucleic Acids Res. 1995; 23: 3822-3830Crossref PubMed Scopus (91) Google Scholar, 9.Liu N. Lucibello F.C. Körner K. Wolfraim L.A. Zwicker J. Müller R. Nucleic Acids Res. 1997; 25: 4915-4920Crossref PubMed Scopus (73) Google Scholar). A similar situation exists with the cyclin A promoter, which is also repressed by CDF-1 and activated by NF-Y (7.Zwicker J. Lucibello F.C. Wolfraim L.A. Gross C. Truss M. Engeland K. Müller R. EMBO J. 1995; 14: 4514-4522Crossref PubMed Scopus (280) Google Scholar). The mechanism through which NF-Y activates transcription is not fully understood. However, NF-Y has been reported to interact with the histone acetylases Gcn5 and P/CAF (11.Currie R.A. J. Biol. Chem. 1998; 273: 1430-1434Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar), and these interactions seem to be relevant in the context of the multiple drug resistance-1 gene promoter (12.Jin S. Scotto K.W. Mol. Cell. Biol. 1998; 18: 4377-4388Crossref PubMed Google Scholar). Furthermore, it has been shown that NF-Y is capable of associating with nucleosomal templates in vitro (13.Caretti G. Motta M.C. Mantovani R. Mol. Cell. Biol. 1999; 19: 8591-8603Crossref PubMed Scopus (59) Google Scholar), although the in vivo relevance of this observation remains to be investigated. These observations imply a role for NF-Y in chromatin remodeling and may provide an explanation for the ability of DNA-bound NF-Y to recruit other transcription factors to promoter DNA (14.Wright K.L. Vilen B.J. Itoh-Lindstrom Y. Moore T.L. Li G. Criscitiello M. Cogswell P. Clarke J.B. Ting J.P. EMBO J. 1994; 13: 4042-4053Crossref PubMed Scopus (136) Google Scholar, 15.Linhoff M.W. Wright K.L. Ting J.P. Mol. Cell. Biol. 1997; 17: 4589-4596Crossref PubMed Scopus (51) Google Scholar). NF-Y binds to both the major and minor groove of the DNA and has been reported to induce DNA bending in vitro (16.Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar). This is believed to be important for the functional organization of activated promoters in vivo, as in the case of the γ-globin promoter (17.Liberati C. Ronchi A. Lievens P. Ottolenghi S. Mantovani R. J. Biol. Chem. 1998; 273: 16880-16889Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). However, there is no evidence that NF-Y binding to promoter DNA is indeed associated with structural distortions in vivo. In the present study, we have used a combination of different genomic footprinting techniques to analyze in detail the in vivostructure of the cdc25C promoter, in particular with respect to its nucleosomal organization and transcription factor-associated structural distortions. WI-38 cells were cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium and MCDB 135 medium with 10% fetal calf serum. For synchronization in G0, cells were maintained in serum-free medium for 3 days. For DMS footprinting, WI-38 cells were grown to 70% confluency. After treatment with 0.2% DMS for 2 min, the cells were washed 3 times with cold phosphate-buffered saline and the DNA was isolated with DNAzol (Life Technologies, Inc.). For potassium permanganate (KMnO4) treatment, the cells were incubated with 20 mm KMnO4 for 2 min and were washed twice with phosphate-buffered saline containing 2% β-mercaptoethanol and once with phosphate-buffered saline. For DNase I,Micrococcus nuclease, MPE, and OP-Cu footprinting, the cells were scraped into phosphate-buffered saline and resuspended in DNase I digestion buffer (60 mm KCl, 15 mm NaCl, 5 mm MgCl2, 0.1 mm EGTA, 15 mm Tris-HCl, pH 7.4, 0.5 mm dithiothreitol, 0.1 mm phenylmethylsulfonyl fluoride, and 1 msucrose) containing 0.2% Nonidet P-40 (for permeabilization of cells). For Micrococcus nuclease and MPE cleavage, the scraped cells were homogenized on ice with 10 strokes in a Dounce homogenizer.Micrococcus nuclease treatment was performed with 0.05–1 unit of enzyme for 3 min. For DNase I cleavage, 200–400 units of enzyme (Roche Molecular Biochemicals) were added, and the reactions were stopped after 5 min by addition of 0.2 volume of 62.5 mm EDTA and 2.5% SDS. MPE treatment was performed as described previously (18.Cartwright M.I.L. Herzberg R.P. Dervan P.B. Elgin S.C. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 3213-3217Crossref PubMed Scopus (80) Google Scholar). For OP-Cu treatment, a complex formed from 40 μm 1,10-phenanthroline and 10 μmCuSO4 (final concentrations) was added to the cell suspension, and the reaction was started by the addition of 3-mercaptopropionic acid to a concentration of 6.9 mm. After 2–4 min, the reaction was stopped by addition of 2,9-dimethyl-1,10-phenanthroline to a final concentration of 2.8 mm. For comparison, WI-38 genomic DNA was methylatedin vitro with 0.2% DMS for 10–30 s, treated with 2 mm KMnO4 for 30 s, and cleaved with 0.05–0.1 unit of Micrococcus nuclease or 2–4 units of DNase I for 30 s or treated with OP-Cu for 60–75 s. In each case, 3 μg of piperidine-cleaved genomic DNA were used for LM-PCR with the Stoffel fragment of Taq polymerase (Perkin-Elmer) as described previously (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar). For OP-Cu and Micrococcus nuclease treatment, the DNA was phosphorylated with T4-polynucleotide kinase (New England Biolabs Inc.) prior to LM-PCR. Samples were phenol-extracted and ethanol-precipitated after primer extension with32P-labeled primers. The following oligonucleotides were used as primers: cdc25C promoter, primer set TS1: primer 1, 5′-d(AGGGAAAGGAGGTAGTT)-3′; primer 2, 5′-d(TAGATTGCAGCTATGCCTTCCGAC)-3′; primer 3, 5′-d(CCTTCCGACTGGGTAGGCCAACGTCG)-3′; cdc25C promoter, primer set TS2: primer 1, 5′-d(CTGCGTCAGCCAATCTCC)-3′; primer 2, 5′-d(TGGCCTATCGTTGGGCTCGCAG)-3′; primer 3, 5′-d(GGGCTCGCAGATCAC CTGGGGGCG)-3′; cdc25C promoter, primer set BS: primer 1, 5′-d(CACTAGTAAGGCGCGGT)-3′; primer 2, 5′-d(GTTTAAATCTCCCGGGGTTCGTGG)-3′; primer 3, 5′-d(GGGGTTCG TGGGGCTGAGGGAACTAG)-3′; cyclin A promoter: primer 1, 5′-d(AGCCAGGCCAGCCTA)-3′; primer 2, 5′-d(CAGCCCGCCCGCTCGCTCACC)-3′; primer 3, 5′-d(GCT CACCCAGCTCGAGCCACGCAG)-3′. Our first goal was to analyze the nucleosomal structure of the human cdc25Cpromoter between positions −290 and +121 bp that had previously been found to be necessary and sufficient for maximal activity and cell cycle regulation of the promoter (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar). Toward this end, WI-38 fibroblasts were permeabilized and digested with increasing concentrations of Micrococcus nuclease, and the digested DNA was analyzed by LM-PCR using different cdc25C-specific primer sets. As shown in Fig. 1,A and B, clusters of Micrococcusnuclease hyperreactivity, which are indicative of nucleosomal linker regions, were seen between positions −140 and approximately −200 bp and between +8 and approximately +50 bp. In addition, less defined hyperreactive regions were identified upstream of position −280 bp (Fig. 1). The distance between the two proximal hyperreactive regions (148 bp) correlates very closely with the reported size of a nucleosomal core in vitro (145 bp) (19.Richmond T.J. Finch J.T. Rushton B. Rhodes D. Klug A. Nature. 1984; 311: 532-537Crossref PubMed Scopus (785) Google Scholar, 20.Arents G. Burlingame R.W. Wang B.C. Love W.E. Moudrianakis E.N. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10148-10152Crossref PubMed Scopus (606) Google Scholar). In agreement with this observation, MPE footprinting of the region between −200 and +50 bp revealed short hypersensitive stretches coincident with the proximal Micrococcus nuclease hyperreactive regions (Fig.2, A and B). These data strongly suggest that the proximal promoter region (−140 to +8 bp), including the transcription factor binding sites necessary for activation and cell cycle specific repression, are organized around a positioned nucleosome (Fig. 3).Figure 2MPE footprinting of the cdc25Cpromoter. Normally growing WI-38 cells were permeabilized, homogenized, and treated with increasing amounts of MPE. For comparison, genomic DNA was treated with MPE or DMS in vitro. The products were analyzed by LM-PCR using primer set TS1. Analysis of the top strand shows short stretches of hyperreactive nucleotides around positions between −150 and −130 bp (A) and between positions +23 and +43 bp (B), respectively, suggesting the presence of a positioned nucleosome in the immediate 5′ region of the cdc25C promoter.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Overview of the nucleosomal structure of thecdc25C promoter. The scheme summarizes thein vivo Micrococcus nuclease and MPE footprinting data for the cdc25C promoter region between positions −370 and +50 bp. The rectangular boxes represent the protein binding sites identified by genomic DMS footprinting (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar). Thearrows above the promoter indicate theMicrococcus nuclease and MPE hyperreactivities identified by high resolution footprinting (Figs. 1 and 2). The positioning of a nucleosome deduced from these data is shown by an oval at the bottom.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because this region of the promoter is bound constitutively by the transcriptional activator NF-Y (6.Zwicker J. Gross C. Lucibello F.C. Truss M. Ehlert F. Engeland K. Müller R. Nucleic Acids Res. 1995; 23: 3822-3830Crossref PubMed Scopus (91) Google Scholar) and by the cell cycle-regulated transcriptional repressor CDF-1 (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar, 9.Liu N. Lucibello F.C. Körner K. Wolfraim L.A. Zwicker J. Müller R. Nucleic Acids Res. 1997; 25: 4915-4920Crossref PubMed Scopus (73) Google Scholar) the question was raised whether the nucleosomal structure might change during the cell cycle. We therefore performed Micrococcus nuclease footprinting of synchronized cell populations, i.e. serum-deprived cellsversus restimulated cells. However, these experiments did not show any cell cycle-related differences with respect to the presence of hyperreactive nucleotides (data not shown). We therefore concluded that the proximal cdc25C promoter region is organized as a positioned nucleosome and is simultaneously occupied by transcription factors throughout the cell cycle. The chromatin structure is not only determined by histone acetylation but can also be influenced by transcription factor-induced remodeling of nucleosomes, similar to the murine mammary tumor virus promoter (21.Truss M. Barsch J.H. Schelbert A. Hache R.J.G. Beato M. EMBO J. 1995; 14: 1737-1751Crossref PubMed Scopus (265) Google Scholar). In this case, the binding of progesterone receptors leads to conformational changes within the regulatory nucleosome, which in turn enables the interaction with other transcription factors and promoter activation (21.Truss M. Barsch J.H. Schelbert A. Hache R.J.G. Beato M. EMBO J. 1995; 14: 1737-1751Crossref PubMed Scopus (265) Google Scholar). To investigate the cdc25C promoter with respect to structural perturbations such as bending or single-stranded stretchesin vivo, we performed genomic footprinting of thecdc25C promoter using different enzymatic or chemical conformation-sensitive probes. As shown in Fig.4 A, DNase I footprinting of permeabilized cells did not result in a characteristic 10-bp pattern, which would be expected for rotationally positioned nucleosomal structures (22.Pfeifer G.P. Riggs A.D. Genes Dev. 1991; 5: 1102-1113Crossref PubMed Scopus (152) Google Scholar). Instead, protected areas were detected that coincided with the NF-Y and Sp1 binding sites previously identified with in vivo DMS footprinting (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar). In agreement with these findings are the slight DNase I hyperreactivities 5′ and 3′ to the Sp1 sites, which have been reported to occur adjacent to certain transcription factor binding sites in vitro. In addition, the close spacing of the NF-Y and Sp1 binding sites could contribute to the lack of a 10-bp pattern of DNase I hypersensitivity. Particularly strong hyperreactivities were seen between the NF-Y binding sites (Fig.4 A, arrows) suggesting that in these positions the minor groove of the double helix is exposed in a way that allows for a markedly preferred DNase I cleavage. Surprisingly, the DNase I protections at the NF-Y sites were strongly reduced in resting cells (G0) when compared with cycling cells (Fig. 4 A, growing). This is in apparent contrast to previously published in vivoDMS-footprinting data showing that the NF-Y binding sites are occupiedin vivo throughout the cell cycle including G0cells (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar). We attribute this to the fact that DNase I footprinting involves the permeabilization of the cells by a detergent, whereas DMS treatment is carried out with intact cells. It is possible that the interaction of NF-Y with its cognate site is weakened in G0cells, e.g. because of a decreased amount of NF-Y-A (23.Chang Z.F. Liu C.J. J. Biol. Chem. 1994; 269: 17893-17898Abstract Full Text PDF PubMed Google Scholar,24.Good L.F. Chen K.Y. Biol. Signals. 1996; 5: 163-169Crossref PubMed Scopus (17) Google Scholar), so that under the influence of a detergent this difference becomes detectable. Another finding that deserves particular attention is the fact that decreased protection at the NF-Y sites was associated with a reduction of the surrounding hyperreactivities (Figs. 4 A and5 A). This suggests that a loss of NF-Y binding is correlated with a loss of hyperreactivity in vivo and strongly supports the idea that NF-Y leads to drastic changes in the DNA structure upon binding to its cognate recognition site in vivo. This explanation is supported by similar observations made by OP-Cu footprinting of the cyclin A promoter as described below (see Fig. 5 B). To address the question of whether such structural changes could also be observed in a structurally and functionally related but different promoter, we performed DNase I footprints of the cyclin A gene that contains a single NF-Y site between a CDE-CHR module and an ATF site (Fig. 4 B). Weak hyperreactivities could be detected surrounding the Sp1 site. The lack of hyperreactivities surrounding the NF-Y site may be because of the close proximity of other transcription factor binding sites. In contrast, the occurrence of one strong hyperreactivity within the NF-Y binding site is striking. Thus, in the context of two different promoters, NF-Y binding was associated with strong hyperreactivities (Fig. 4, A and B), suggesting a strong influence on DNA structure. Because NF-Y has been reported to bend DNA in vitro (16.Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar), we decided to analyze the proximal promoter region for local distortions by phenanthroline copper footprinting. OP-Cu is used to detect minor groove binding of transcription factors that sterically inhibit access to the C1–H or alter the DNA structure to a non-B-DNA conformation (25.Sigman D.S. Duwabara M.D. Chen C-H.B. Brucie T.W. Methods Enzymol. 1991; 208: 381-413Google Scholar, 26.Pope L.E. Sigman D.S. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 3-7Crossref PubMed Scopus (109) Google Scholar). Both events result in OP-Cu hyporeactive or protected regions. OP-Cu can also be used to detect protein-induced conformational changes in the DNA that would lead to hyperreactive DNA stretches (27.Morris L. Cannon W. Claverie-Martin F. Austin S. Buck M. J. Biol. Chem. 1994; 269: 11563-11571Abstract Full Text PDF PubMed Google Scholar). Even though OP-Cu has previously not been used for genomic footprinting, we were able to establish an appropriate procedure using permeabilized cells (see “Experimental Procedures” for details). Thus, minor groove protections at the NF-Y binding sites and the CHR region were clearly detectable, whereas the sites of major groove binding (CDE, Sp1 binding sites) did not show any protections (Fig.5 A). These expected results demonstrate the suitability of OP-Cu for genomic footprinting. Of particular interest, however, are the strong hyperreactivities between the NF-Y binding sites (Fig.5 A, arrows). These indicate the presence of local distortions, which may be caused by the unstacking of base pairs that would create more space for the intercalating phenanthroline moiety (28.Drew H.R. J. Mol. Biol. 1984; 176: 535-537Crossref PubMed Scopus (226) Google Scholar). Furthermore, the protections in the area of NF-Y binding are notably stronger when compared with those in the CHR region, which is also occupied in the minor groove. This can be taken as further evidence for a non-B-DNA structure at the NF-Y binding sites (25.Sigman D.S. Duwabara M.D. Chen C-H.B. Brucie T.W. Methods Enzymol. 1991; 208: 381-413Google Scholar, 26.Pope L.E. Sigman D.S. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 3-7Crossref PubMed Scopus (109) Google Scholar,28.Drew H.R. J. Mol. Biol. 1984; 176: 535-537Crossref PubMed Scopus (226) Google Scholar). For comparison, we footprinted the cyclin Apromoter with OP-Cu (Fig. 5 B). Protections were seen in the region of the NF-Y site and to a lesser extent at the CHR, similar to that observed with the cdc25C promoter and at the ATF site. Hyperreactivities were detected specifically between the NF-Y site and the CDE/CHR element. No such hyperreactivity was found between the NF-Y and ATF sites (or other sites) indicating that the structural distortions detected by OP-Cu are indeed transcription factor-specific. We also analyzed potential cell cycle effects on the OP-Cu hyperreactivities in the cyclin Apromoter. A comparison of the patterns obtained after footprinting of normally growing and G0 cells showed a diminished protection of the NF-Y site and hyperreactivities 5′ to the NF-Y site in the G0 cells (Fig. 5 B). These cell cycle effects are likely to reflect a weakened interaction of NF-Y with its cognate recognition site in G0 cells and support the hypothesis that the OP-Cu hyperreactivities are caused by NF-Y bindingin vivo. These observations are also consistent with the finding made with DNase I footprinting of the cdc25Cpromoter described above (Fig. 4 A). In contrast to the cdc25C promoter, the CDE was also protected, and hyperreactivities were detected in its vicinity. This presumably reflects the binding of additional factors of the E2F family with the CDE in the cyclin A promoter (7.Zwicker J. Lucibello F.C. Wolfraim L.A. Gross C. Truss M. Engeland K. Müller R. EMBO J. 1995; 14: 4514-4522Crossref PubMed Scopus (280) Google Scholar, 29.Schulze A. Zerfass K. Spitkovsky D. Middendorp S. Berges J. Helin K. Jansen-Dürr P. Henglein B. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11264-11268Crossref PubMed Scopus (320) Google Scholar, 30.Liu N. Lucibello F.C. Engeland K. Müller R. Oncogene. 1998; 16: 2957-2963Crossref PubMed Scopus (72) Google Scholar). Finally, we analyzed the proximal promoter region for kinked DNA structures or single-stranded stretches by KMnO4 footprinting in vivo. This study showed a strong correlation between KMnO4 hyperreactivity and NF-Y binding (Fig. 6). Neither the Sp1 sites nor the CDE-CHR displayed such hyperreactivities. This KMnO4 hyperreactivity, which coincides with the area of OP-Cu hypersensitivity, probably reflects local kinks or strong bends with a defect in base stacking rather than a melted region, as has been reported for ς factor-induced DNA distortions in vitro(27.Morris L. Cannon W. Claverie-Martin F. Austin S. Buck M. J. Biol. Chem. 1994; 269: 11563-11571Abstract Full Text PDF PubMed Google Scholar). A strong DNA bend or unwinding with a local unstacking of base pairs would enhance the intercalation of OP-Cu between the base pairs while giving KMnO4 access to the 5,6-double bond of the T-ring (31.$$$$$$ ref data missingGoogle Scholar). Downstream of position +1 bp, multiple sites of KMnO4hyperreactivity were also detectable, but these can be presumably attributed to pausing polymerases in the basal promoter region (10.Körner K. Wolfraim L. Lucibello F.C. Müller R. Nucleic Acids Res. 1997; 25: 4933-4939Crossref PubMed Scopus (16) Google Scholar). The high resolution analysis of Micrococcus nuclease and MPE hypersensitivities reported in the present study strongly suggests that the cdc25C promoter is organized in a positioned nucleosome, and this structural organization is maintained throughout the cell cycle. The fact that the positioned nucleosome spans the same size region encompassing the three NF-Y sites in the presence of bound NF-Y (5.Lucibello F.C. Truss M. Zwicker J. Ehlert F. Beato M. Müller R. EMBO J. 1995; 14: 132-142Crossref PubMed Scopus (87) Google Scholar) strongly suggests that NF-Y interacts with a nucleosomal template in vivo. This is supported by the observation that NF-Y is capable of interacting with reconstituted nucleosomes in vitro (13.Caretti G. Motta M.C. Mantovani R. Mol. Cell. Biol. 1999; 19: 8591-8603Crossref PubMed Scopus (59) Google Scholar). The footprinting data clearly demonstrate strong structural perturbations in and around the NF-Y binding sites in the context of two different promoters in vivo, i.e. cdc25C and cyclin A, that are structurally and functionally related (7.Zwicker J. Lucibello F.C. Wolfraim L.A. Gross C. Truss M. Engeland K. Müller R. EMBO J. 1995; 14: 4514-4522Crossref PubMed Scopus (280) Google Scholar). Of particular interest are the observed cell cycle effects, which indicate that NF-Y binding is decreased in resting cells concomitantly with diminished hypersensitivities adjacent to the NF-Y sites. These correlations also suggest that the observed structural perturbations in and around the NF-Y binding sites are indeed caused by NF-Y, which is consistent with the ability of NF-Y to induce DNA bending in vitro (16.Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar). The observed structural changes are not typical of rotationally positioned nucleosomes but instead suggest a positioned although partially opened nucleosomal structure, similar to the mouse mammary tumor virus promoter after hormone induction (21.Truss M. Barsch J.H. Schelbert A. Hache R.J.G. Beato M. EMBO J. 1995; 14: 1737-1751Crossref PubMed Scopus (265) Google Scholar). It is conceivable therefore that the structural disturbances at the NF-Y binding sites (coinciding with NF-Y occupation of these sites) together with the reported ability of NF-Y to recruit the histone acetylases, Gcn5 and P/CAF (11.Currie R.A. J. Biol. Chem. 1998; 273: 1430-1434Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 12.Jin S. Scotto K.W. Mol. Cell. Biol. 1998; 18: 4377-4388Crossref PubMed Google Scholar), play a role in opening the chromatin structure of the proximal promoter. The OP-Cu and KMnO4 footprints that show that NF-Y in vivo induces a local unstacking of the base pairs, which is indicative of kinked or strongly bent DNA, support this hypothesis because the ability of transcription factors to bend DNA facilitates binding to nucleosomal structures in vitro (32.Polach K.J. Widom J. J. Mol. Biol. 1995; 254: 130-149Crossref PubMed Scopus (527) Google Scholar). This is strongly supported by the data obtained with the cyclin A promoter, where a functionally crucial NF-Y site (7.Zwicker J. Lucibello F.C. Wolfraim L.A. Gross C. Truss M. Engeland K. Müller R. EMBO J. 1995; 14: 4514-4522Crossref PubMed Scopus (280) Google Scholar), albeit in a different context, is also associated with clearly structural perturbations in vivo. The above observations lead to the following model. NF-Y acts as a transcriptional activator that may involve its property to recruit Gcn5 and P/CAF and its ability to bind to nucleosomal templates in vivo. The structural perturbations at the NF-Y sites that reflect changes in the nucleosomal structure caused by NF-Y may affect the interaction of the promoter with other factors and may thus contribute to transcriptional activation and/or repression of the gene. The binding of the repressor CDF-1 in G0/G1 may weaken the binding of NF-Y through an unknown mechanism, which in turn results in an altered promoter topology that does not favor transcriptional activation. The data obtained in the present study provide the basis for future work addressing the validity of these ideas. We are grateful to M. Beato, M. Funk, T. Schmidt, M. Truss, and A. Scholz for many useful discussions and suggestions. We thank D. Eick for help with the KMnO4footprinting and M. Krause for synthesis of oligonucleotides.