Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Cot Kinase Activates Tumor Necrosis Factor-α Gene Expression in a Cyclosporin A-resistant Manner

1998; Elsevier BV; Volume: 273; Issue: 23 Linguagem: Inglês

10.1074/jbc.273.23.14099

ISSN

1083-351X

Autores

Alicia Ballester, Ana Velasco, Rafael Tobeña, Susana Alemany,

Tópico(s)

Immune Response and Inflammation

Resumo

Cot kinase is a protein serine/threonine kinase, classified as a mitogen-activated protein kinase kinase kinase, implicated in T lymphocyte activation. Here we show that an increase in Cot kinase expression promotes tumor necrosis factor-α (TNF-α) production in Jurkat T cells stimulated by soluble anti-CD3 or by low concentrations of phorbol 12,13-dibutyrate (PDBu) and calcium ionophore. Overexpression of Cot kinase in Jurkat cells activates TNF-α gene expression. Cot kinase promotes TNF-α promoter activation to a similar extent as calcium ionophore and PDBu or soluble anti-CD28 and PDBu. Neither phorbol esters nor calcium ionophore can replace Cot kinase on TNF-α promoter-driven transcription. Expression of a dominant negative form of Cot kinase inhibits TNF-α promoter activation induced by stimulation with either calcium ionophore and PDBu, soluble anti-CD28 and PDBu, or soluble anti-CD3 and PDBu. TNF-α promoter-driven transcription by Cot kinase is partially mediated by MAPK/ERK kinase and is cyclosporin A-resistant. Cot kinase increases at least the AP-1 and AP-2 response elements. These data indicate that Cot kinase plays a critical role in TNF-α production. Cot kinase is a protein serine/threonine kinase, classified as a mitogen-activated protein kinase kinase kinase, implicated in T lymphocyte activation. Here we show that an increase in Cot kinase expression promotes tumor necrosis factor-α (TNF-α) production in Jurkat T cells stimulated by soluble anti-CD3 or by low concentrations of phorbol 12,13-dibutyrate (PDBu) and calcium ionophore. Overexpression of Cot kinase in Jurkat cells activates TNF-α gene expression. Cot kinase promotes TNF-α promoter activation to a similar extent as calcium ionophore and PDBu or soluble anti-CD28 and PDBu. Neither phorbol esters nor calcium ionophore can replace Cot kinase on TNF-α promoter-driven transcription. Expression of a dominant negative form of Cot kinase inhibits TNF-α promoter activation induced by stimulation with either calcium ionophore and PDBu, soluble anti-CD28 and PDBu, or soluble anti-CD3 and PDBu. TNF-α promoter-driven transcription by Cot kinase is partially mediated by MAPK/ERK kinase and is cyclosporin A-resistant. Cot kinase increases at least the AP-1 and AP-2 response elements. These data indicate that Cot kinase plays a critical role in TNF-α production. Tpl-2/Cot kinase is a mitogen-activated protein kinase kinase kinase that activates both the ERK 1The abbreviations used are: ERK, extracellular signal-regulated kinase; TNF-α, tumor necrosis factor-α; MEK, MAPK/ERK kinase; JNK, c-Jun N-terminal kinase; PDBu, phorbol 12,13-dibutyrate; Luc, luciferase; CSA, cyclosporin A; IL-2, interleukin 2; bp, base pair(s); RT, reverse transcriptase; PCR, polymerase chain reaction; Dex, dexamethasone; nt, nucleotide(s); PHA, phytohemagglutinin; inac-cot, inactive cot. and JNK signal transduction pathways (1Salmerón A. Ahmad T.B. Carlille G.W. Pappin D. Narsimham R.P. Ley S.C. EMBO J. 1996; 15: 817-826Crossref PubMed Scopus (270) Google Scholar, 2Fanger G.R. Gerwins P. Widmann C. Jarpe M.B. Johnson G.L. Curr. Opin. Genet. & Dev. 1997; 7: 67-74Crossref PubMed Scopus (299) Google Scholar, 3Hunter T. Cell. 1997; 88: 333-346Abstract Full Text Full Text PDF PubMed Scopus (630) Google Scholar, 4Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2285) Google Scholar). The COT kinase gene was first cloned in a truncated form in transformed foci induced in SHOK cells by transfection of the genomic DNA of a human thyroid carcinoma cell line (5Miyoshi J. Higashi T. Mukai H. Ohuchi T. Kakunaga T. Mol. Cell. Biol. 1991; 11: 4088-4096Crossref PubMed Scopus (106) Google Scholar). The human COT gene is unique in the genomic sequence (5Miyoshi J. Higashi T. Mukai H. Ohuchi T. Kakunaga T. Mol. Cell. Biol. 1991; 11: 4088-4096Crossref PubMed Scopus (106) Google Scholar). The normal human cellular homologue has an open reading frame encoding 467 amino acids, being the first 397 identical to the truncated form, whereas the 69 amino acids from the C terminus are replaced by 18 amino acids in the truncated form (6Aoki M. Hamada F. Sugimoto T. Sumida S. Akiyama T. Toyoshima K. J. Biol. Chem. 1993; 268: 22723-22732Abstract Full Text PDF PubMed Google Scholar, 7Aoki M. Akiyama T. Miyoshi J. Toyoshima K. Oncogene. 1991; 6: 1515-1519PubMed Google Scholar, 8Chan A.M.-L. Chedid M. McGovern E.S. Popescu N.C. Miki T. Aronson S.A. Oncogene. 1993; 8: 1329-1333PubMed Google Scholar). The rat homologue gene was identified as an oncogene associated with the progression of Moloney murine leukemia virus-induced T cell lymphomas in rats (Tpl-2) (9Makris A. Patriotis C. Bear S.E. Tsichlis P.N. J. Virol. 1993; 67: 4283-4289Crossref PubMed Google Scholar, 10Patriotis C. Makris A. Bear S.E. Tsichlis P.N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2251-2255Crossref PubMed Scopus (147) Google Scholar). The provirus insertion occurs in the last intron of the Tpl-2 gene. Transgenic mice expressing the truncated oncogenic protein in thymocytes develop T cell lymphomas (11Ceci J.D. Patriotis C.P. Tsatsanis C. Makris A.M. Kovatch R. Swing D.A. Jenkins N.A. Tsichlis P.N. Copeland N.G. Genes Dev. 1997; 11: 688-700Crossref PubMed Scopus (116) Google Scholar). As occurs with the human homologue, the disruption of the last coding exon of Tpl-2 appears to unmask the oncogenic potential of the protein (6Aoki M. Hamada F. Sugimoto T. Sumida S. Akiyama T. Toyoshima K. J. Biol. Chem. 1993; 268: 22723-22732Abstract Full Text PDF PubMed Google Scholar, 10Patriotis C. Makris A. Bear S.E. Tsichlis P.N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2251-2255Crossref PubMed Scopus (147) Google Scholar, 11Ceci J.D. Patriotis C.P. Tsatsanis C. Makris A.M. Kovatch R. Swing D.A. Jenkins N.A. Tsichlis P.N. Copeland N.G. Genes Dev. 1997; 11: 688-700Crossref PubMed Scopus (116) Google Scholar, 12Erny K.M. Peli J. Lambert J.-F. Muller V. Diggelmann H. Oncogene. 1996; 13: 2015-2020PubMed Google Scholar). However, overexpression of the human normal gene is also capable of conferring the transformed phenotype in established cell lines (6Aoki M. Hamada F. Sugimoto T. Sumida S. Akiyama T. Toyoshima K. J. Biol. Chem. 1993; 268: 22723-22732Abstract Full Text PDF PubMed Google Scholar, 8Chan A.M.-L. Chedid M. McGovern E.S. Popescu N.C. Miki T. Aronson S.A. Oncogene. 1993; 8: 1329-1333PubMed Google Scholar). At the amino acid level the identity between the human Cot kinase and the rat Tpl-2 homologue is >95% (1Salmerón A. Ahmad T.B. Carlille G.W. Pappin D. Narsimham R.P. Ley S.C. EMBO J. 1996; 15: 817-826Crossref PubMed Scopus (270) Google Scholar). Transient expression of Cot/Tpl-2 kinase activates ERK1 (1Salmerón A. Ahmad T.B. Carlille G.W. Pappin D. Narsimham R.P. Ley S.C. EMBO J. 1996; 15: 817-826Crossref PubMed Scopus (270) Google Scholar, 13Patriotis C. Makris A.M. Chernoff J. Tsichlis P.N. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9755-9759Crossref PubMed Scopus (109) Google Scholar, 14Troppmair J. Bruder J.T. Munoz H. Lloyd P.A. Kyriakis J. Banerjee P. Avruch J. Rapp U.R. J. Biol. Chem. 1994; 269: 7030-7035Abstract Full Text PDF PubMed Google Scholar). Overexpression of the rat homologue in human Jurkat T cells also phosphorylates and activates JNKK, and consequently JNK is also phosphorylated and activated (1Salmerón A. Ahmad T.B. Carlille G.W. Pappin D. Narsimham R.P. Ley S.C. EMBO J. 1996; 15: 817-826Crossref PubMed Scopus (270) Google Scholar). This activation of JNK by Cot kinase leads to the phosphorylation of c-jun in its N-terminal region (1Salmerón A. Ahmad T.B. Carlille G.W. Pappin D. Narsimham R.P. Ley S.C. EMBO J. 1996; 15: 817-826Crossref PubMed Scopus (270) Google Scholar). A variety of stimuli induce TNF-α production in many cell types (15Goldfeld A.E. Maniatis T. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1490-1494Crossref PubMed Scopus (85) Google Scholar,16Ware C.F. Cruve P.D. Grayson M.H. Androlewicz M.J. Browing J.L. J. Immunol. 1992; 149: 3881-3888PubMed Google Scholar), including T cells (17Ferreri N.R. Sarr T. Askenase P.W. Ruddle N.H. J. Biol. Chem. 1992; 267: 9443-9449Abstract Full Text PDF PubMed Google Scholar, 18Cuturi M.C. Murphy M. Costa-Giomi M.P. Weinmann R. Perussia B. Trinchieri G. J. Exp. Med. 1987; 165: 1581-1594Crossref PubMed Scopus (299) Google Scholar, 19Tsai E.Y. Yie J. Thanos D. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 5232-5244Crossref PubMed Scopus (178) Google Scholar, 20Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar, 21Sung S.S. Bjorndahl J.M. Wang C.Y. Kao H.T. Fu S.M. J. Exp. Med. 1988; 167: 937-953Crossref PubMed Scopus (146) Google Scholar, 22Fisher H. Dohlsten M. Andersson U. Hedlund G. Ericsson P. Hansson J. Sjoren H.O. J. Immunol. 1990; 144: 4663-4669PubMed Google Scholar). Phorbol esters (23Goldfeld A.E. Strominger J.L. Doyle C. J. Exp. Med. 1991; 174: 73-81Crossref PubMed Scopus (136) Google Scholar, 24Leitman D.C. Mackoe E.R. Williams T. Baxter J.D. West B.L. Mol. Cell. Biol. 1992; 12: 1352-1356Crossref PubMed Google Scholar, 25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar), calcium (26Goldfeld A.E. McCaffrey P.G. Strominger J.L. Rao A. J. Exp. Med. 1993; 178: 1365-1379Crossref PubMed Scopus (191) Google Scholar,27McCaffrey P.G. Goldfeld A.E. Rao A. J. Biol. Chem. 1994; 269: 30445-30450Abstract Full Text PDF PubMed Google Scholar), anti-CD3 antibody (20Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar), or phorbol esters and anti-CD3 induce TNF-α promoter transcription (21Sung S.S. Bjorndahl J.M. Wang C.Y. Kao H.T. Fu S.M. J. Exp. Med. 1988; 167: 937-953Crossref PubMed Scopus (146) Google Scholar, 28Steffen M. Ottmann O.G. Moore M.A. J. Immunol. 1988; 140: 2621-2624PubMed Google Scholar). Enterotoxin (22Fisher H. Dohlsten M. Andersson U. Hedlund G. Ericsson P. Hansson J. Sjoren H.O. J. Immunol. 1990; 144: 4663-4669PubMed Google Scholar), anti-AIM/CD 69 (29Santis A.G. Campanero M.R. Alonso J.L. Tugores M.A. Yague E. Pivel J.P. Sanchez-Madrid F. Eur. J. Immunol. 1992; 22: 1253-1259Crossref PubMed Scopus (89) Google Scholar), or anti-CD2 pathway (30Santis A.G. Campanero M.R. Alonso J.L. Sanchez-Madrid F. Eur. J. Immunol. 1992; 22: 3155-3160Crossref PubMed Scopus (21) Google Scholar) also regulate TNF-α promoter activity. The regulation of TNF-α gene transcription is cell type-specific (15Goldfeld A.E. Maniatis T. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1490-1494Crossref PubMed Scopus (85) Google Scholar, 16Ware C.F. Cruve P.D. Grayson M.H. Androlewicz M.J. Browing J.L. J. Immunol. 1992; 149: 3881-3888PubMed Google Scholar, 19Tsai E.Y. Yie J. Thanos D. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 5232-5244Crossref PubMed Scopus (178) Google Scholar, 25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar), and different response elements such as AP-1 (25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar, 31Sung S.J. Walters J.A. Fu S.M. J. Immunol. 1991; 147: 2047-2054PubMed Google Scholar), AP-2 (25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar, 31Sung S.J. Walters J.A. Fu S.M. J. Immunol. 1991; 147: 2047-2054PubMed Google Scholar), CRE (cAMP response element) (19Tsai E.Y. Yie J. Thanos D. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 5232-5244Crossref PubMed Scopus (178) Google Scholar, 20Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar, 32Newell C.L. Deisseroth A.B. Lopez-Berestein G. J. Leukocyte Biol. 1994; 56: 27-54Crossref PubMed Scopus (117) Google Scholar), SP-1 (19Tsai E.Y. Yie J. Thanos D. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 5232-5244Crossref PubMed Scopus (178) Google Scholar, 20Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar, 24Leitman D.C. Mackoe E.R. Williams T. Baxter J.D. West B.L. Mol. Cell. Biol. 1992; 12: 1352-1356Crossref PubMed Google Scholar, 25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar), Krox-24 (25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar, 33Kramer B. Meichle A. Hensel G. Charnay P. Kronke M. Biochim. Biophys. Acta. 1994; 1219: 413-421Crossref PubMed Scopus (118) Google Scholar), NF-kappa B (34Steffan N.M. Bren G.B. Frantz B. Tocci M.J. O'Neill A. Paya C.V. J. Immunol. 1995; 155: 4685-4691PubMed Google Scholar, 35Collart M.A. Baeuerde P. Vassalli P. Mol. Cell. Biol. 1990; 10: 1498-1506Crossref PubMed Google Scholar, 36Drouet C. Shakhov A.N. Jongeneel C.V. J. Immunol. 1991; 147: 1694-1700PubMed Google Scholar, 37Goldfeld A.E. Doyle C. Maniatis T. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9769-9773Crossref PubMed Scopus (214) Google Scholar), and NFAT (nuclear factor activated T cells) (19Tsai E.Y. Yie J. Thanos D. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 5232-5244Crossref PubMed Scopus (178) Google Scholar, 20Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A.E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar, 26Goldfeld A.E. McCaffrey P.G. Strominger J.L. Rao A. J. Exp. Med. 1993; 178: 1365-1379Crossref PubMed Scopus (191) Google Scholar, 38Goldfeld A.E. Tsai E. Kincaid R. Belshaw P.J. Schrieber S.L. Strominger J.L. Rao A. Cell. Immunol. 1986; 103: 19-26Crossref PubMed Scopus (107) Google Scholar) have been identified in the TNF-α promoter. The data shown here demonstrate that overexpression of Cot kinase enhances TNF-α secretion in Jurkat cells. Transfection of Cot kinase in Jurkat T cells promotes TNF-α gene expression. We also demonstrate that a dominant negative form of Cot kinase inhibits TNF-α promoter-driven transcription. Our data also further demonstrate that Cot kinase activates TNF-α promoter-driven transcription in a CSA-resistant way and that Cot kinase regulates at least the AP-1 and AP-2 response elements. The DraI fragment (222–1871 nt) of cot (8Chan A.M.-L. Chedid M. McGovern E.S. Popescu N.C. Miki T. Aronson S.A. Oncogene. 1993; 8: 1329-1333PubMed Google Scholar) was subcloned in the eukaryotic expression vector pEF-BOS, previously digested with BamHI, treated with CIP, and subsequently with Klenow enzyme. A pEF-BOS-cot construct, in the 5′-3′ orientation relative to the EF promoter, was selected. A similar pEF-BOS-trunc-cot construct, in the 5′-3′ orientation relative to the EF promoter, was obtained by digesting truncated cot withDraI (30–1302 nt) (5Miyoshi J. Higashi T. Mukai H. Ohuchi T. Kakunaga T. Mol. Cell. Biol. 1991; 11: 4088-4096Crossref PubMed Scopus (106) Google Scholar). The inactive kinase form of full-length cot was generated by PCR. TheAvaI-HindIII fragment of cot was cloned into the AvaI-HindIII sites of a normal pUC19 vector. A PCR with the mutagenic primers AGAATGGCGTGTGCACTGATCCCA and TAGTCTACCGAATTTAACTAGATG encompassing the substitution Lys-168 to Ala-168 was performed using this construct as template. Separately, cot cDNA (8Chan A.M.-L. Chedid M. McGovern E.S. Popescu N.C. Miki T. Aronson S.A. Oncogene. 1993; 8: 1329-1333PubMed Google Scholar) was ligated to a pUC19 vector devoid of AvaI and HindIII sites. The AvaI-HindIII fragment of cot was replaced by the mutatedAvaI-HindIII fragment obtained by PCR, yielding inactive cot (inac-cot), which was subsequently cloned in the pEF-BOS vector as described for cot kinase and obtaining pEF-BOS-inac-cot(5′-3′). DNA sequencing of inac-cot was performed to verify the construct. Different constructs of the TNF-α promoter linked to theluc gene (−1185 pTNFα-Luc, −615 pTNFα-Luc, and −36 pTNFα-Luc) were generously provided by Dr. J. S. Economou (25Rhoades K. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar); the −362 pTNFα-Luc and −105 pTNFα-Luc constructs were generously provided by Dr. M. Lopez Cabrera. The collagenase promoter constructs −73 pcol-Luc and −63 pcol-Luc generously provided by Dr. A. Aranda, were described in Ref. 39Deng T. Karin M. Genes Dev. 1993; 7: 479-490Crossref PubMed Scopus (292) Google Scholar. The NFAT-AP-1 composite element of the IL-2 promoter linked to the Luc gene was provided by Dr. G. Crabtree (40Durand D.B. Shan J.P. Bush M.R. Replogle R.E. Beld R. Crabtree G.R. Mol. Cell. Biol. 1988; 8: 1715-1724Crossref PubMed Scopus (375) Google Scholar). The anti-CD3 monoclonal antibody was obtained by injecting 106 T3b hybridoma cells (41Arroyo A.G. Campanero M.R. Sanchez-Mateos P. Zapata J.M. Ursa M.A. del Pozo M.A. Sanchez-Madrid F. J. Cell Biol. 1994; 126: 1277-1286Crossref PubMed Scopus (88) Google Scholar, 42Spits H. Issel H. Leeuwenberg J. de Vries J.E. Eur. J. Immunol. 1985; 15: 88-91Crossref PubMed Scopus (155) Google Scholar), generously provided by Dr. F. Sanchez-Madrid in Balb/c mice, previously pristanized. Immunoglobulin from the ascitic fluid was purified by Sepharose-protein A chromatography. The human leukemia T cell line Jurkat was obtained from Dr. Abelardo López-Rivas and maintained in RPMI 1640 medium supplemented with 10% fetal calf serum (Life Technologies, Inc.), gentamycin (50 μg/ml), and l-glutamine (2 mm) (complete medium). DNA-mediated gene transfer into Jurkat cells was accomplished by electroporation (43Ballester A. Tobeña R. Lisbona C. Calvo V. Alemany S. J. Immunol. 1997; 159: 1613-1618PubMed Google Scholar). Exponentially growing cells were washed and resuspended in complete medium at a concentration of 2 × 107/ml, and 1 ml of the cell suspension was transferred into a 0.4-cm electroporation cuvette (Bio-Rad), and unless otherwise indicated, 10 μg of the different pEF-BOS constructs and 5 μg of the different pTNFα-Luc constructs were added. Electroporation was accomplished with a Gene Pulser apparatus (Bio-Rad) with a capacitance of 960 microfarads and an electrical field of 300 V. The electroporated cells were transferred into tissue culture flasks (Costar) in complete medium at a concentration of 106 cells/ml. After 2 h in culture, transfected cells were stimulated with calcium ionophore A23187 (Boehringer Mannheim) and different concentrations of PDBu (Sigma) or with soluble anti-CD3 for 24 h. Culture supernatants were tested for TNF-α production with the human TNF-α quantification enzyme-linked immunosorbent assay kit (Genzyme), following the manufacturer's instructions. The detection limit according to the standard curve was over 73 pmol. The transfection efficiency of electroporation, as tested by expression of the fluorescent protein from the pTR-UF2 construct (44Zolotuknin S. Potter M. Hauswirth W.W. Guy J. Muzyczka N. J. Virol. 1996; 70: 4646-4654Crossref PubMed Google Scholar), was about 35%. Jurkat cells were electroporated with pEF-BOS (10 μg/ml), pEF-BOS-cot(5′-3′) (10 μg/ml), or no plasmid. After 30 min incubation cells were stimulated for 6 h, with 0.25 μm calcium ionophore and 50 ng/ml PDBu or 0.1 μm calcium ionophore and 5 ng/ml PDBu, and total RNA was extracted using Ultraspec (Biotech), according to the manufacturer's instructions. To perform the RT reaction (45Souzé F. Ntodou-Thome A. Tran C.Y. Rosténe W. Forgez P. Biotechniques. 1996; 21: 280-284Crossref PubMed Scopus (146) Google Scholar), 2 μg of total RNA from nonstimulated or stimulated cells were heated at 37 °C for 30 min in the presence of 100 mm dithiothreitol, 0.5 mm dNTPs, 50 units of ribonuclease inhibitor (Life Technologies, Inc.), 2.5 units of DNase (Life Technologies, Inc.) and RT buffer (Life Technologies, Inc.), and then treated at 95 °C for 5 min. Ten μmrandom primers (Life Technologies, Inc.) were subsequently added, and the mixture was heated at 70 °C for 10 min. After chilling on ice, 200 units of reverse transcriptase (Superscript RNase H−, Life Technologies, Inc.) were added, and the reaction was continued at 42 °C for 60 min. The reaction was finished by heating at 99 °C for 5 min. To perform the PCR the specific oligonucleotides, 5′ AGCCTCTTCTCCTTCCTGAT (277–297 nt) and 3′ AGTAGATGAGGGTCCAGGAG (575–595 nt), deduced from the human TNF-α cDNA, and 5′ AGCACAATGAAGATCAAGAT (1292–1311 nt) and 3′ TGTAACGCAACTAAGTCATA (1460–1479 nt), deduced from the human β-actin cDNA were used. The first round was performed for 25 cycles, with 10 μmTNF-α primers, 1 μm β-actin primers, and with 1 μl of the RT, and at an annealing temperature of 57 °C. The second round was performed in the same conditions, using 0.2 μl of the first PCR as template, except that 10 μm of the 4 primers were used. The reactions were analyzed in 1% agarose gels. DNA-mediated gene transfer into Jurkat cells was performed as explained above. Jurkat cells were cotransfected with different TNF-α promoter-Luc reporter constructs (5 μg/ml) together with control construct (pEF-BOS) (10 μg/ml) or different pEF-BOS-cot constructs (10 μg/ml). After 30 min in culture, cells were stimulated for 12 h with different stimuli as follows: soluble anti-CD3, soluble anti-CD28 9.3 antibody (generously donated by Dr. C. June), calcium ionophore A23187, or PHA (Sigma) in the presence or absence of different concentrations of PDBu (Sigma). 8-Br-cAMP (Boehringer Mannheim), Dex (Sigma), CSA, or PD 98059 (MEK inhibitor) (Calbiochem) were added to the cells 30 min after electroporation and then the cells were stimulated 2 h later. Twelve hours after stimulation cells were collected by centrifugation, and Luc activity was determined by the luciferase assay kit (Promega), according to the manufacturer's instructions. Cell extracts were normalized by protein measurements with the Dc protein assay (Bio-Rad). Table I illustrates the effect of Cot expression in Jurkat T cells on TNF-α production. Jurkat cells stimulated with 0.25 μm calcium ionophore and 50 ng/ml PDBu (maximum stimulation) produced about 240 pmol/5 × 105 cells of TNF-α, independently of whether cells were electroporated with pEF-BOS-cot(5′-3′), pEF-BOS, or no plasmid. Stimulation with suboptimal concentrations of calcium ionophore and PDBu only increased TNF-α production in cells overexpressing Cot kinase (Table I). Soluble anti-CD3 (10 μg/ml) alone did not stimulate TNF-α production in pEF-BOS or non-plasmid electroporated cells. However, with this stimulus TNF-α production was detected in pEF-BOS-cot(5′-3′)-electroporated cells. In the absence of any stimuli pEF-BOS-cot(5′-3′)-transfected cells were not able to produce TNF-α, indicating that overexpression of Cot kinase by itself was not able to induce TNF-α production.Table IRegulation of TNF-α production by Cot kinaseNo stimulusPDBu (50 ng/ml) + ionophore A23187 (0.25 μm)PDBu (5 ng/ml) + ionophore A23187 (0.1 μm)PDBu (0.5 ng/ml) + ionophore A23187 (0.1 μm)Anti-CD3pEF-BOS-cot<73225 ± 20181 ± 5163 ± 9170 ± 11pEF-BOS<73250 ± 13<73<73<73—<73243 ± 10<73<73<73Jurkat cells (2 × 107) were electroporated with 10 μg/ml pEF-BOS-cot(5′–3′), 10 μg/ml pEF-BOS, or no DNA (—) as described under "Experimental Procedures" and stimulated with calcium ionophore A23187 (0.25 μm) and PDBu (50 ng/ml) (maximum stimulation), with calcium ionophore A23187 (0.1 μm) and PDBu (5 ng/ml), with calcium ionophore A23187 (0.1 μm) and PDBu (0.5 ng/ml), or with soluble anti-CD3 (10 μg/ml) for 24 h, and TNF-α production was measured in the supernatant. The data expressed in pmol/5 × 105 cells show the mean of three experiments performed in duplicate. Open table in a new tab Jurkat cells (2 × 107) were electroporated with 10 μg/ml pEF-BOS-cot(5′–3′), 10 μg/ml pEF-BOS, or no DNA (—) as described under "Experimental Procedures" and stimulated with calcium ionophore A23187 (0.25 μm) and PDBu (50 ng/ml) (maximum stimulation), with calcium ionophore A23187 (0.1 μm) and PDBu (5 ng/ml), with calcium ionophore A23187 (0.1 μm) and PDBu (0.5 ng/ml), or with soluble anti-CD3 (10 μg/ml) for 24 h, and TNF-α production was measured in the supernatant. The data expressed in pmol/5 × 105 cells show the mean of three experiments performed in duplicate. We then decided to investigate whether Cot kinase regulated TNF-α gene expression in Jurkat cells. RNA from pEF-BOS, pEF-BOS-cot(5′-3′), or non-plasmid electroporated cells stimulated or not with different concentrations of calcium ionophore and PDBu was isolated to perform RT-PCR assays. In the different electroporated cells stimulated with 0.25 μm calcium ionophore and 50 ng/ml PDBu (maximum stimulation), TNF-α mRNA was detected (Fig.1). A similar amount of TNF-α PCR product was obtained in Cot-transfected cells stimulated with 0.1 μm calcium ionophore and 5 ng/ml PDBu (submaximal stimulation). However, in pEF-BOS or no plasmid-transfected cells incubated with these concentrations of stimuli, a significant decrease in the intensity of the band corresponding to the TNF-α PCR product was detected. Without stimuli, the TNF-α PCR product was only detected in cells overexpressing Cot kinase (Fig. 1). Next, we decided to determine whether Cot kinase enhanced TNF-α promoter-driven transcription. Jurkat cells electroporated with −1185 pTNFα-Luc alone or together with pEF-BOS-cot(5′-3′) or pEF-BOS were subjected to different stimuli, and Luc activity was measured. In −1185 pTNFα-Luc alone or together with pEF-BOS electroporated cells, it is necessary to add both calcium ionophore (0.25 μm) and PDBu (50 ng/ml) (maximum stimulation) to observe an increase (about 25-fold) in TNF-α promoter-driven transcription (Fig. 2 A). Cells transfected with Cot kinase together with the −1185 pTNFα-Luc exhibited a similar Luc activity in the absence of any stimulus (Fig.2 A). Jurkat cells overexpressing Cot kinase treated with calcium ionophore (0.25 μm) and PDBu (50 ng/ml) (maximum stimulation) or calcium ionophore (0.25 μm) alone resulted in a further increase in the Luc activity. Stimulation of these cells with 50 ng/ml PDBu, or with suboptimal doses of calcium ionophore and PDBu (0.1 μm and 5 ng/ml respectively), or with 2 μg/ml of PHA did not further enhance Cot kinase-induced TNF-α promoter activation (Fig. 2 A). Similar results were obtained when Jurkat cells were transfected with pEF-BOS-trunc-cot(5′-3′) instead of pEF-BOS-cot(5′-3′) (data not shown). Jurkat cells overexpressing the kinase-inactive form of Cot, by transfection of pEF-BOS-inac-cot(5′-3′), did not enhance the −1185 pTNFα-driven transcription of the Luc gene (data not shown). These data indicate that the kinase activity of Cot is necessary for TNF-α promoter activation. Several compounds were used to study if overexpression of Cot kinase stimulated the TNF-α promoter-driven transcription through the same mechanism as PDBu and calcium ionophore. Cells electroporated with −1185 pTNFα-Luc and either pEF-BOS-cot(5′-3′), pEF-BOS-trunc-cot(5′-3′), pEF-BOS, or no additional plasmid were incubated with 8-Br-cAMP, Dex, CSA, or MEK inhibitor. Cells transfected with −1185 pTNFα-Luc alone or together with pEF-BOS were also incubated with 50 ng/ml PDBu and 0.25 μm calcium ionophore. Addition of 8-Br-cAMP (0.5 mm) or Dex (10−7m) at concentrations that have been described to inhibit IL-2 promoter transcription in Jurkat T cells (46Paliogianni F. Raptis A. Ahuja S.S. Najiar S.M. Boumpas D.T. J. Clin. Invest. 1993; 91: 1481-1489Crossref PubMed Scopus (190) Google Scholar, 47Northrop J.P. Crabtree G.R. Mattila P.S. J. Exp. Med. 1992; 175: 1235-1245Crossref PubMed Scopus (149) Google Scholar, 48Ohtsuka T. Kaziro Y. Satoh T. Biochim. Biophys. Acta. 1996; 1310: 223-232Crossref PubMed Scopus (28) Google Scholar) did not inhibit TNF-α promoter-driven transcription (Fig. 2 B) in the different transfected cells, and MEK inhibitor (20 μm) reduced the Luc activity of all the electroporated cells by about 50%. CSA added at a concentration of 100 ng/ml inhibited the TNF-α promoter-driven transcription in cells electroporated with pEF-BOS and −1185 pTNFα-Luc or only with pTNFα-Luc by 90%. CSA, used at the same concentration, did not significantly inhibit the TNF-α promoter transcription activity in Jurkat cells overexpressing truncated Cot kinase or Cot kinase (Fig. 2 B). To determine whether stimulation with soluble anti-CD28 (1 μg/ml) or with soluble anti-CD3 (10 μg/ml) further enhanced Cot kinase activation of the TNF-α promoter, cells were electroporated with either pEF-BOS-cot(5′-3′) or pEF-BOS, and −1185 pTNFαLuc or only with the −1185 pTNFα −Luc, and different stimuli were added. Soluble anti-CD3 (10 μg/ml) or soluble anti-CD28 (1 μg/ml) did not enhance the TNF-α promoter-driven transcription in cells overexpressing Cot kinase. However, addition of both stimuli together, or anti-CD28 (1 μg/ml) and PDBu (20 ng/ml), increased the Cot kinase-induced TNF-α promoter-driven transcription by about 2-fold (Fig. 3). CSA inhibited TNF-α promoter activity by about 30% in Cot kinase overexpressing cells stimulated with anti-CD3 and anti-CD28. Nevertheless, CSA hardly inhibited TNF-α promoter activation in Cot-transfected cells stimulated with anti-CD28 and PDBu (Fig. 3). Cells electroporated with the −1185 pTNFα-Luc alone or together with pEF-BOS exhibited a significant activation of the TNF-α promoter-driven transcription when stimulated with anti-CD28 and anti-CD3 (about a 9-fold induction) or when activated with anti-CD28 and PDBu (about a 20-fold induction) (Fig. 3). In these cells CSA inhibited a 30% TNF-α promoter activation by soluble anti-CD3 and anti-CD28 and did not regulate the stimulation by anti-CD28 and PDBu. One of the hallmarks of the anti-CD28 stimulation of cytokine production is its insensitivity to CSA (49Linsley P.S. Ledbetter J.A. Annu. Rev. Immunol. 1993; 11

Referência(s)