The Rat Liver Na+/Bile Acid Cotransporter
2001; Elsevier BV; Volume: 276; Issue: 9 Linguagem: Inglês
10.1074/jbc.m008797200
ISSN1083-351X
AutoresAn–Qiang Sun, Marco Arrese, Lei Zeng, I'Kyori Swaby, Ming‐Ming Zhou, Frederick J. Suchy,
Tópico(s)Neonatal Health and Biochemistry
ResumoTo understand the potential functions of the cytoplasmic tail of Na+/taurocholate cotransporter (Ntcp) and to determine the basolateral sorting mechanisms for this transporter, green fluorescent protein-fused wild type and mutant rat Ntcps were constructed and the transport properties and cellular localization were assessed in transfected COS 7 and Madin-Darby canine kidney (MDCK) cells. Truncation of the 56-amino acid cytoplasmic tail demonstrates that the cytoplasmic tail of rat Ntcp is involved membrane delivery of this protein in nonpolarized and polarized cells and removal of the tail does not affect the bile acid transport function of Ntcp. Using site-directed mutagenesis, two tyrosine residues, Tyr-321 and Tyr-307, in the cytoplasmic tail of Ntcp have been identified as important for the basolateral sorting of rat Ntcp in transfected MDCK cells. Tyr-321 appears to be the major basolateral-sorting determinant, and Tyr-307 acts as a supporting determinant to ensure delivery of the transporter to the basolateral surface, especially at high levels of protein expression. When the two Tyr-based basolateral sorting motifs have been removed, the N-linked carbohydrate groups direct the tyrosine to alanine mutants to the apical surface of transfected MDCK cells. The major basolateral sorting determinant Tyr-321 is within a novel β-turn unfavorable tetrapeptide Y321KAA, which has not been found in any naturally occurring basolateral sorting motifs. Two-dimensional NMR spectroscopy of a 24-mer peptide corresponding to the sequence from Tyr-307 to Thr-330 on the cytoplasmic tail of Ntcp confirms that both the Tyr-321 and Tyr-307 regions do not adopt any turn structure. Since the major motif YKAA contains a β-turn unfavorable structure, the Ntcp basolateral sorting may not be related to the clathrin-adaptor complex pathway, as is the case for many basolateral proteins. To understand the potential functions of the cytoplasmic tail of Na+/taurocholate cotransporter (Ntcp) and to determine the basolateral sorting mechanisms for this transporter, green fluorescent protein-fused wild type and mutant rat Ntcps were constructed and the transport properties and cellular localization were assessed in transfected COS 7 and Madin-Darby canine kidney (MDCK) cells. Truncation of the 56-amino acid cytoplasmic tail demonstrates that the cytoplasmic tail of rat Ntcp is involved membrane delivery of this protein in nonpolarized and polarized cells and removal of the tail does not affect the bile acid transport function of Ntcp. Using site-directed mutagenesis, two tyrosine residues, Tyr-321 and Tyr-307, in the cytoplasmic tail of Ntcp have been identified as important for the basolateral sorting of rat Ntcp in transfected MDCK cells. Tyr-321 appears to be the major basolateral-sorting determinant, and Tyr-307 acts as a supporting determinant to ensure delivery of the transporter to the basolateral surface, especially at high levels of protein expression. When the two Tyr-based basolateral sorting motifs have been removed, the N-linked carbohydrate groups direct the tyrosine to alanine mutants to the apical surface of transfected MDCK cells. The major basolateral sorting determinant Tyr-321 is within a novel β-turn unfavorable tetrapeptide Y321KAA, which has not been found in any naturally occurring basolateral sorting motifs. Two-dimensional NMR spectroscopy of a 24-mer peptide corresponding to the sequence from Tyr-307 to Thr-330 on the cytoplasmic tail of Ntcp confirms that both the Tyr-321 and Tyr-307 regions do not adopt any turn structure. Since the major motif YKAA contains a β-turn unfavorable structure, the Ntcp basolateral sorting may not be related to the clathrin-adaptor complex pathway, as is the case for many basolateral proteins. rat liver Na+/taurocholate cotransporting polypeptide 56 amino acid residues from carboxyl terminus truncated rat Ntcp green fluorescent protein SV40-transformed monkey kidney fibroblast cells Madin-Darby canine kidney GFP-fused rat Ntcp a mutant rat Ntcp in which the tyrosine 307 residue was replaced with alanine and fused with green fluorescent protein a mutant rat Ntcp in which the tyrosine-321 residue was replaced with alanine and fused with green fluorescent protein a mutant rat Ntcp in which both tyrosine 307 and tyrosine 321 residues were replaced with alanines and fused with green fluorescent protein taurocholate high performance liquid chromatography dibutyryl cyclic AMP wild type polymerase chain reaction heteronuclear single quantum coherence 4-morpholinepropanesulfonic acid The process of vectorial transport of bile acids and other ions across hepatocytes is dependent upon the polarized distribution of specific transport mechanisms localized to the plasma membrane of these cells (1Suchy F.J. Semin. Liver Dis. 1993; 13: 235-247Crossref PubMed Scopus (44) Google Scholar, 2Nathanson M. Boyer J.L. Hepatology. 1991; 14: 551-566Crossref PubMed Scopus (384) Google Scholar, 3Meier P.J. Am. J. Physiol. 1995; 269: G801-G812PubMed Google Scholar). Na+-dependent bile acid influx has been demonstrated across the sinusoidal (basolateral) membrane of hepatocyte (4Boyer J.L. Hagenbuch B. Ananthanarayanan M. Suchy F.J. Stieger B. Meier P.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 435-438Crossref PubMed Scopus (79) Google Scholar). The cDNAs for liverNa+/taurocholatecotransporting polypeptide (Ntcp)1 have been identified and cloned from several species, including rat, mouse, and human (5Hagenbuch B. Stieger B. Foguet M. Lubbert H. Meier P.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10629-10633Crossref PubMed Scopus (451) Google Scholar, 6Hagenbuch B. Meier P.J. J. Clin. Invest. 1994; 93: 1326-1331Crossref PubMed Scopus (396) Google Scholar, 7Hagenbuch B. Meier P.J. Hepatology. 1996; 24: 368AAbstract Full Text PDF Scopus (27) Google Scholar). Rat liver Ntcp transports conjugated bile acids in a Na+-dependent fashion and is localized on the basolateral surface of hepatocytes (8Ananthanarayanan M. Ng O.C. Boyer J.L. Suchy F.J. Am. J. Physiol. 1994; 267: G637-G643PubMed Google Scholar, 9Stieger B. Hagenbuch B. Landmann L. Höchli M. Schroeder A. Meier P.J. Gastroenterology. 1994; 107: 1781-1787Abstract Full Text PDF PubMed Google Scholar). This bile acid transporter is only expressed in differentiated mammalian hepatocytes in a developmentally regulated pattern (4Boyer J.L. Hagenbuch B. Ananthanarayanan M. Suchy F.J. Stieger B. Meier P.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 435-438Crossref PubMed Scopus (79) Google Scholar). It is a glycoprotein with a seven-transmembrane structure that is similar to the protein superfamily of rhodopsin and the G protein-linked receptors (5Hagenbuch B. Stieger B. Foguet M. Lubbert H. Meier P.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10629-10633Crossref PubMed Scopus (451) Google Scholar, 10Findlay J Eliopoulos E. Trends Physiol. Sci. 1990; 11: 492-499Abstract Full Text PDF PubMed Scopus (131) Google Scholar,11Khorana H.G. J. Biol. Chem. 1992; 267: 1-4Abstract Full Text PDF PubMed Google Scholar). Rat Ntcp contains two N-linked carbohydrate sites at amino terminus and two potential Tyr-based sorting motifs at its carboxyl terminus (Y307-E-K-I and Y321-K-A-A) (5Hagenbuch B. Stieger B. Foguet M. Lubbert H. Meier P.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10629-10633Crossref PubMed Scopus (451) Google Scholar). These potential Tyr-based sorting motifs are conserved in the cytoplasmic tail of Ntcp from other species, such as the human and mouse. However, the mechanisms underlying the tissue-specific basolateral membrane sorting of the bile acid transporter are unknown. Hagenbuch and Meier (7Hagenbuch B. Meier P.J. Hepatology. 1996; 24: 368AAbstract Full Text PDF Scopus (27) Google Scholar) have identified a short mouse liver Na+-dependent bile acid cotransporter (Ntcp2) in which the last 45 amino acid residues were missing compared with wild type (WT) Ntcp. Ntcp2 is presumed to be the result of alternative splicing. This potential alternative splicing structure (sites) on the genomic DNA was also found in Ntcp genes from rat and human liver. The physiological function of this tailless Ntcp isoform, Ntcp2, is unknown. Previous studies from our laboratory demonstrated that removing of the 56-amino acid cytoplasmic tail from rat Ntcp resulted in accumulation of the truncated form intracellularly and loss of the fidelity of basolateral membrane sorting in transfected Madin-Darby canine kidney (MDCK) cells (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). The present studies were performed to understand the potential function of the cytoplasmic tail of Ntcp and to determine the basolateral sorting mechanisms for this transporter. Green fluorescent protein-fused wild type Ntcp and mutant rat Ntcps were constructed, and the function and cellular localization were assessed in transfected COS 7 and MDCK cells. The results from transport kinetics and substrate analog inhibition studies demonstrated that removal of the entire cytoplasmic tail from Ntcp did not change its bile acid transport function. Confocal microscopy and polarized taurocholate transport studies showed that, in contrast to WT Ntcp, most of the truncated Ntcp protein accumulated intracellularly in transfected COS 7 cells. Replacement of the Tyr-321 and Tyr-307 residues with alanines in the potential Tyr-based sorting motifs of cytoplasmic tail of Ntcp redirected the tyrosine to alanine (Y/A) mutant transporters to the apical domain of transfected MDCK cells. However, this apical surface localization of the Y/A mutant could be abolished by tunicamycin treatment. Two-dimensional NMR spectroscopy of a 24-mer peptide corresponding to the sequence from Tyr-307 to Thr-330 on the cytoplasmic tail of Ntcp confirms that both Tyr-321 and Tyr-307 regions do not adopt any turn structure. The above results suggest that 1) the 56-amino acid cytoplasmic tail of rat Ntcp is important for plasma membrane delivery, 2) both Tyr-321 and Tyr-307 residues mediated the specific basolateral surface sorting, 3) both Tyr-321 and Tyr-307 regions do not adopt any turn structure, and 4) N-linked carbohydrate groups can act as a apical sorting signal to direct the Y/A mutant transporter to the apical surface. Removal of the 56-amino acid cytoplasmic tail from rat hepatic Ntcp was done by using a PCR-based strategy to modify rat Ntcp coding sequence as described previously (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). PCR amplifications were carried out using a PTC-100TM Programmable Thermal Controller (MJ Research, Inc., Watertown, MA). Chimeric molecules that fuse the mutant or wild type rat Ntcp to GFP were made using similar PCR-based strategies. The full-length cDNA coding sequences of wild type or mutant rat Ntcp were used as templates. The PCR-generated mutant and wild type rat Ntcp cDNA products were subcloned into a green fluorescent protein vector, pEGFPN2 (CLONTECH, Palo Alto, CA), using standard techniques. These chimeras were made using a forward primer 5′-CGAAGCTTATGGAGGTGCACAACGTATCAGCC-3′, which was designed to anneal to 5′-end coding sequence of rat Ntcp cDNA with anHindIII restriction site (bold type), and a reverse primer 5′- CCGGATCCCATTTGCCATCTGACCAGAATTCAGGCCATTAGGGG -3′, containing codons that anneal to sequences 3′ end region of rat Ntcp cDNA with a BamHI restriction site (bold type). For cytoplasmic tail truncated Ntcp, the same forward primer was used, whereas a reverse primer 5′-GGTGGATCCCGCACCGGAAGATAATGATGATGAG-3′, which contained codons that anneal to the sequence A296 to C306region of rat Ntcp cDNA with a BamHI restriction site (bolded) was used. These restriction sites were compatible with the pEGFP N2 polylinker. The PCR products were gel-purified, digested at sites incorporated at the ends of PCR products, and ligated directly to pEGFP N2 digested with the same restriction enzymes to produce chimeras. All plasmid constructs were checked for correct orientation by restriction digestion analysis. The positive clones containing the wild type or mutant cDNA inserts were verified by DNA cycle sequencing using a Perkin Elmer, GeneAmp 9600, ABI Prism 377 DNA Sequencer at the DNA Core Facility, Mount Sinai School of Medicine. These positive clones were used for further study. The QuikChangeTM site-directed mutagenesis Kit (Stratagene, La Jolla, CA) was used to convert codons for Tyr-307 and Tyr-321 to alanine residues according to manufacturer's directions with minor modification. The GFP-fused Ntcp chimera was used as template. A Y307A substitution was made using a forward primer 5′-C1030TTCCGGTGCGCCGAGAAAATCAAGCCTCC1059-3′, which annealed to the coding sequence in the Tyr-307 region, and a compatible reverse primer, in place of the codon for Tyr-307 was converted to alanine residue (underlined). A Y321A substitution was made using a forward primer 5′-G1063GACCAAACAAAAATTACCGCCAAAGCTGCTGCAACTG1100-3′, which annealed to the coding sequence in the Tyr-321 region, and a compatible reverse primer, in place of the codon for Tyr-321 was converted to alanine residue (underlined). The constructs of Y307A and Y321A double substitutions were made using a Y307A mutated construct as template and using the same primer for Y321A substitution. COS 7 (SV40 transformed monkey kidney fibroblast) cells were maintained in complete Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10‥ (v/v) fetal bovine serum, 50 units/ml penicillin, 50 μg/ml streptomycin, and 2 mml-glutamine. COS 7 cells were transiently transfected with plasmids containing wild type or mutant rat Ntcp cDNA using LipofectinTM reagent (Life Technologies, Inc.) as described previously (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). Transfected cells were harvested 24–48 h later for bile acid transport and confocal microscopy analysis. All MDCK II cells were grown in a humidified incubator at 37 °C under 5‥ CO2 atmosphere in complete minimum essential medium (Life Technologies, Inc.) that was supplemented with 10‥ (v/v) fetal bovine serum, 50 units/ml penicillin, 50 μg/ml streptomycin, and 2 mml-glutamine. MDCK II cells were stably transfected with plasmids containing wild type or mutant rat Ntcp cDNAs using LipofectinTM reagent as described by the manufacture. Transfected cells were grown 10–15 days in media containing G418 (Geneticin (0.9 mg/ml), Life Technologies, Inc.). Thereafter, stably transfected colonies were selected. For polarity studies, monolayers of polarized MDCK epithelial cells were produced as described previously (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). Briefly, cells were seeded on Transwell filter inserts (0.4-μm pore size, PET track-etched membrane; Falcon, Franklin Lakes, NJ) at a density of ∼1.5 × 105cells/6.4-mm filter. Experiments were conducted 4–6 days after seeding. To enhance the gene expression, the stably transfected MDCK cells were preincubated in 10 mm Na+-butyrate for 15 h at 37 °C. Northern blot hybridization was done according to standard technique. Total RNA was extracted from transfected COS 7 or MDCK cells and purified by TRIzol reagent (Life Technologies, Inc.). RNAs (10 μg/lane) were subjected to electrophoresis on a 1‥ agarose gel (containing 2.2 mformaldehyde, 40 mm MOPS, 10 mmNa+-acetate, 1 mm EDTA, pH 7.0), and blotted onto a GeneScreen membrane (PerkinElmer Life Sciences). Hybridization was carried out in 50‥ formamide buffer at 42 °C overnight with 32P-labeled full-length cDNA probe (1 × 107 cpm) encoding Ntcp protein, and detected by autoradiography. Total proteins extracted from transfected cells were separated by 10‥ SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose. The Western blotting for wild type and cytoplasmic tail truncated rat Ntcp was carried out as described previously (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). GFP-fused chimeric proteins were detected using a rabbit GFP polyclonal antibody (IgG fraction, CLONTECH, Palo Alto, CA) at a dilution of 1:1000 and subsequently with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma) at a dilution of 1:2000. Horseradish peroxidase activity was visualized by enzyme chemiluminescence (ECL) (Amersham Pharmacia Biotech). COS cell plasma membrane fractions were purified and separated by SDS-polyacrylamide gel electrophoresis as described previously (13van't Hof W. Resh M.D. J. Cell Biol. 1997; 136: 1023-1035Crossref PubMed Scopus (124) Google Scholar). The wild type and truncated Ntcp proteins were detected by Westen blotting. The quantitation of the protein intensity was carried out by using Metamorph software (University Imaging Corp., West Chester, PA). Na+-dependent taurocholate (TC) influx and polarized transport analysis were performed as described previously (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). Indirect immunofluorescence microscopy for wild type and cytoplasmic tail truncated rat Ntcp was carried out as described previously (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). Confocal microscopy of GFP-fused chimeras was performed on a confluent monolayer of transfected cells cultured on glass coverslips. Glass coverslip-grown cells were rinsed three times with phosphate-buffered saline, fixed for 7 min in 100‥ methanol at −20 °C, and rinsed four times with phosphate-buffered saline, and then mounted with Aquamount (BDH Laboratory Supplies, Poole, United Kingdom). Fluorescence were examined with a Leica TCS-SP (UV) 4-channel confocal laser scanning microscope in the Imaging Core Facility Microscopy Center, Mount Sinai School of Medicine. The 488-nm wavelength line of an argon laser and the 568-nm wavelength line of a krypton laser were used. The cell monolayer was optically sectioned every 0.5 μm. Image resolution using a Leica 63× and/or 100× Neofluor objective and Leica TCS-SP software was 512 × 512 pixels. All NMR spectra were acquired at 30 °C on a Bruker DRX-500 NMR spectrometer. The NMR sample of the Ntcp peptide of 10 mm was prepared in a 100 mmphosphate buffer of pH 6.5 in 90‥ H2O, 5‥2H2O, and 5‥ Me2SO-d6. The two-dimensional1H/15N and 1H/13C heteronuclear single quantum coherence (HSQC) spectra were acquired using the nonisotope-enriched peptide with 96 and 1024 complex points in ω1 and ω2, respectively. The NMR spectra were processed and analyzed using the NMRPipe (14Delaglio F. Grzesiek S. Vuister G.W. Zhu G. Pfeifer J. Bax A. J. Biomol. NMR. 1995; 6: 277-293Crossref PubMed Scopus (11533) Google Scholar) and NMRView (15Johnson B.A. Blevins R.A. J. Biomol. NMR. 1994; 4: 603-614Crossref PubMed Scopus (2677) Google Scholar) programs. A 24-mer peptide, YEKIKPPKDQTKITYKAAATEDAT, corresponding to the sequence from Tyr-307 to Thr-330 on the cytoplasmic tail of rat Ntcp, was synthesized by the Howard Hughes Medical Institute Biopolymer/Keck Foundation Biotechnology Resource Laboratory (Yale University, New Haven, CT). The crude peptide was purified by reverse phase HPLC on a YMC C-18 column. The peak fractions were subjected to matrix-assisted laser desorption ionization mass spectrometry and analytical HPLC. Treatment of tunicamycin that abolishes the glycosylation of viral glycoproteins was performed as described previously (16Marzolo M.P. Bull P. Gonzalez A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1834-1839Crossref PubMed Scopus (63) Google Scholar). Briefly, the MDCK cells stably transfected with Tyr-321 and Tyr-307 both mutated rat Ntcp (YYAA) cDNA were incubated with 2 μg/ml tunicamycin for 15 h and followed by 12 μg/ml for 2 h at 37 °C. Following incubation, bile acid transport and fluorescence confocal microscopy analyses were utilized to verify the cell surface distribution of the mutant transporters. Inhibition of Ntcp glycosylation by tunicamycin treatment was confirmed by Western blotting. Most of the results were expressed as mean value ± S.E. and examined by Student's t test. Results of different groups or categories were compared using the unpaired t test. Previous studies from our laboratory have demonstrated that removal of the 56-amino acid cytoplasmic tail from rat Ntcp resulted in a truncated protein that largely accumulated intracellularly in transfected MDCK cells (12Sun A.-Q. Ananthanarayanan M. Soroka C.J. Thevananther S. Shneider B. Suchy F.J. Am. J. Physiol. 1998; 275: G1045-G1055PubMed Google Scholar). Moreover, a tailless Ntcp isoform, Ntcp2, has been isolated from mouse liver, but the function and cellular localization of this protein has not been defined (7Hagenbuch B. Meier P.J. Hepatology. 1996; 24: 368AAbstract Full Text PDF Scopus (27) Google Scholar). Thus, the cytoplasmic tail of Ntcp (Fig. 1 A) may contain membrane sorting information and may be of functional importance. To understand further the possible functional role of the cytoplasmic tail of Ntcp, which would be relevant to a potential physiologic role for Ntcp2, the transport properties and cellular localization of a truncated mutant rat liver Ntcp were examined in transfected COS 7 cells. Northern blot analysis was performed with total RNA isolated from COS 7 cells transduced with plasmids containing cDNAs encoding for either the wild type or truncated Ntcp. Probing with a 32P-labeled Ntcp cDNA detected a single message of about 1.7 kilobase pairs in transfected COS 7 cells (data not shown). No hybridization was observed with total RNA from nontransfected COS 7 cells. mRNA from the truncated mutant (NL) was slightly smaller than that of the wild type Ntcp (data not shown). Bile acid transport studies showed that [3H]taurocholate influx was stimulated in both WT and truncated Ntcp cDNA-transfected COS 7 cells in the presence of a sodium but not a choline-containing buffer (Fig. 1 B). However, the truncated transporter (NL) had much lower transport activity compared with the wild type transporter (Fig. 1 B). These results suggested two possibilities: 1) the cytoplasmic tail of Ntcp was essential for bile acid translocation across the membrane, or 2) the cytoplasmic tail provided a signal for plasma membrane localization. To address these questions, indirect immunofluorescence microscopy was done on confluent monolayers of transfected COS 7 cells. When these cells were viewed enface, the WT Ntcp was predominantly located on the plasma membrane (Fig. 1 C). In contrast, in cells expressing the truncated Ntcp (NL), most of the protein accumulated intracellularly, probably in the endoplasmic reticulum and Golgi apparatus. Immunoblotting of plasma membrane proteins isolated from transfected COS 7 cells confirmed that only ∼10‥ of the truncated Ntcp (NL) was sorted to the plasma membrane compared with wild type Ntcp (Fig. 1 D). To verify further the relationship between the cytoplasmic tail of Ntcp and its importance to transport function, the kinetics of taurocholate uptake was analyzed in transfected COS 7 cells. In these cells, equilibrium for the transport process was achieved between 10 and 15 min at 37 °C. No significant uptake was observed in the presence of a sodium gradient at 0 °C or with a choline gradient at both 37° and 0 °C (data not shown). The kinetics of bile acid uptake by wild type and truncated rat Ntcp in transfected COS 7 cells were measured in primary cultures 72 h after transfection. As shown in Fig. 2, in the presence of a sodium gradient, [3H]taurocholate uptake increased with substrate concentration and exhibited saturable kinetics. WT Ntcp exhibited [3H]taurocholate uptake with an apparent Km of 30.4 ± 6.6 μmand a Vmax of 393.4 ± 47.0 pmol/mg of protein/min in transfected COS 7 cells. The transport process mediated by the truncated Ntcp showed a similar Km value of 43.8 ± 3.2 μm, but a markedly reducedVmax of 32.4 ± 3.9 pmol/mg/min. This value was only 10‥ of that observed with WT Ntcp. These results indicate that removal of the cytoplasmic tail does not significantly alter the substrate binding affinity of the transporter. However, the lowerVmax is likely related to a markedly reduced amount of the protein reaching the plasma membrane. To further characterize the importance of the cytoplasmic tail of Ntcp to bile acid transport, studies were done to examine the effects of several bile acid analogues and organic anions on taurocholate transport by transfected COS 7 cells. The COS 7 cells were incubated in the presence or absence of 100 μm unlabeled bile acids or other organic anion competitors. Taurocholate uptake in the absence of a competitor was set at 100‥ and all values measured relative to this level of activity. Fig. 3 demonstrates that the competitive inhibitors (cholate ∼ 45‥, taurodeoxycholate ∼ 30‥, taurochenodeoxycholate ∼ 25‥, and probenecid ∼ 100‥), and the noncompetitive inhibitor bromosulfophthalein (∼ 15‥) revealed similar effects on the initial rate of taurocholate uptake in COS 7 cells expressing either the wild type or truncated transporter. These results indicate that the cytoplasmic tail is not important for substrate binding specificity. Previous studies indicate that hepatic sodium taurocholate cotransport is stimulated by dibutyryl cyclic AMP (Bt2cAMP) via protein kinase A (17Mukhopadhayay S. Ananthanarayanan M. Stieger B. Meier P.J. Suchy F.J. Anwer M.S. Am. J. Physiol. 1997; 273: G842-G848PubMed Google Scholar). Experiments were then done to compare the activation of transport activity by Bt2cAMP in COS 7 cells expressing either the wild type or truncated Ntcp. Bt2cAMP stimulated a significant increase (about 24‥, p < 0.05) in taurocholate uptake by transfected cells expressing wild type Ntcp (Fig. 4). In contrast, 100 μm Bt2cAMP did not stimulate taurocholate uptake in COS 7 cells expressing the truncated Ntcp. These results indicate that, as suggested previously, the cytoplasmic tail may be important for regulation of Ntcp membrane localization via protein kinase A stimulation. To determine the importance of two potential Tyr-based sorting motifs in the cytoplasmic tail of Ntcp, a series of mutations were created in these sequences which potentially represent signals for sorting to the basolateral membrane. Three mutants were made by converting Tyr-307 (Y307A-GFP), Tyr-321 (Y321A-GFP), and both Tyr-307 and Tyr-321 (YYAA-GFP) to alanines by site directed mutagenesis. These mutated transporters, as well as wild type Ntcp, were fused with green fluorescent protein at the amino terminus to follow the intracellular localization of these proteins in transfected COS 7 and MDCK II cell lines. Northern and Western blotting were used to verify the cellular expression of the GFP-fused proteins. First, the bile acid transport activity and cell surface expression of these chimeric proteins were examined in transfected COS 7 cells. Fig.5 shows that GFP-fused Ntcp is functionally similar to the wild type protein in its capacity for sodium-dependent transport. Similar to the truncated Ntcp (NL), the GFP-fused truncated Ntcp chimera (NL-GFP) had a markedly reduced initial transport rate (data not shown). However, all of the chimeras containing point mutations, Y307A-GFP, Y321A-GFP, and YYAA-GFP, demonstrated transport activity similar to the wild type Ntcp-GFP (Fig. 5). To confirm the steady state surface expression of the GFP-fused transporter chimeras, transfected COS 7 cells were cultured on glass coverslips and then examined by fluorescence confocal microscopy. When viewed enface, Ntcp-GFP and all of the three Y/A mutants were detected on the plasma membrane of transfected COS 7 cells (Fig. 6). In contrast, in cells expressing NL-GFP, fluorescence was predominantly localized to the cytosolic portion of the cell near the nucleus (Fig. 6). These studies confirm that, similar to wild type Ntcp, the GFP-fused Y/A mutants were targeted to the plasma membrane of transfected COS 7 cells.Figure 6Effects of Y/A mutation of potential Tyr-based signal motifs on membrane localization in transfected COS 7 cells. Transfected COS 7 cells were grown on glass coverslips and fixed with methanol at −20 °C for 7 min. Selected images were analyzed for fluorescence distribution of COS 7 cells nontransfected (left top panel) and transfected with pEGFPN2 vector, Ntcp-GFP, cytoplasmic tail truncated Ntcp-GFP (NL-GFP) (right top panel), and Y/A mutated transporters (Y321A-GFP, YYAA-GFP, and Y307A-GFP, lower panel).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To examine whether the transporters with point mutations of the possible tyrosine-based sorting signals were sorted to the basolateral domain, the Y/A mutant chimeras were stably expressed in MDCK II cells. Fluorescent images both enface and inx-z cross-section were then gathered using laser scanning confocal microscopy. To further confirm the localization of these proteins within this cell line, bile acid uptake was measured across the apical and basolateral membrane domains of stably transfected MDCK cells, which were grown to confluence on permeable Transwell filter inserts. When membrane localization of the Y307A-GFP mutant was examined by both fluorescence confocal microscopy and polarized bile acid uptake, the Y307A-GFP protein was predominantly localized to
Referência(s)