Portal de Periódicos da CAPES

Regulation of Interleukin-8 Gene at a Distinct Site of Its Promoter by CCAAT Enhancer-binding Protein Homologous Protein in Prostaglandin E2-treated Human T Cells

2008; Elsevier BV; Volume: 283; Issue: 44 Linguagem: Inglês

10.1074/jbc.m803145200

1083-351X

Maria Cucinotta, Maria Visalli, M. Aguennouz, Andrea Valenti, Saverio Loddo, Lucia Altucci, Diana Teti,

Immune Cell Function and Interaction

For a long period of time, the transcription factor CCAAT/enhancer-binding protein homologous protein (CHOP) has been thought to inhibit transcriptional activity for its ability to interact with CCAAT enhancer-binding protein family factors, thus preventing their binding to DNA. We have previously shown that in human T lymphocytes the CHOP phosphorylation induced by prostaglandin E2 (PGE2)-increased interleukin-8 (IL-8) gene expression. Given the CHOP positive role in the regulation of transcription, here we have investigated the molecular mechanism(s) by which CHOP increases IL-8 gene activity under PGE2 stimulus. Transfection experiments with mutants showed both that the CHOP transactivation domain is essential for IL-8 transcription and that the IL-8/activator protein 1 (AP-1) promoter mutated in NF-κB and NF-IL-6, but not in the AP-1 site, harbors essential CHOP-responsive elements. CHOP silencing confirmed its role in the IL-8 transcriptional regulation and protein production, whereas c-Jun small interfering RNA experiments showed that the PGE2-induced activation of IL-8 promoter is mainly c-Jun-independent. Moreover, PGE2 induced CHOP-DNA complexes only when the entire IL-8/AP-1 promoter or the wild type sequences encompassing the AP-1 upstream region were employed. Mutations introduced in these sequences prevented the DNA-CHOP complex formation. The IL-8/AP-1 mutant promoter lacking the sequence immediately upstream the AP-1 site is PGE2-unresponsive. Finally, chromatin immunoprecipitation data confirmed in vivo that PGE2 induces CHOP binding to the IL-8 promoter. Taken together, our results suggest that the increased expression of CHOP in response to PGE2 exerts a positive transcriptional regulation of the IL-8 promoter mediated by direct binding to a novel consensus site. For a long period of time, the transcription factor CCAAT/enhancer-binding protein homologous protein (CHOP) has been thought to inhibit transcriptional activity for its ability to interact with CCAAT enhancer-binding protein family factors, thus preventing their binding to DNA. We have previously shown that in human T lymphocytes the CHOP phosphorylation induced by prostaglandin E2 (PGE2)-increased interleukin-8 (IL-8) gene expression. Given the CHOP positive role in the regulation of transcription, here we have investigated the molecular mechanism(s) by which CHOP increases IL-8 gene activity under PGE2 stimulus. Transfection experiments with mutants showed both that the CHOP transactivation domain is essential for IL-8 transcription and that the IL-8/activator protein 1 (AP-1) promoter mutated in NF-κB and NF-IL-6, but not in the AP-1 site, harbors essential CHOP-responsive elements. CHOP silencing confirmed its role in the IL-8 transcriptional regulation and protein production, whereas c-Jun small interfering RNA experiments showed that the PGE2-induced activation of IL-8 promoter is mainly c-Jun-independent. Moreover, PGE2 induced CHOP-DNA complexes only when the entire IL-8/AP-1 promoter or the wild type sequences encompassing the AP-1 upstream region were employed. Mutations introduced in these sequences prevented the DNA-CHOP complex formation. The IL-8/AP-1 mutant promoter lacking the sequence immediately upstream the AP-1 site is PGE2-unresponsive. Finally, chromatin immunoprecipitation data confirmed in vivo that PGE2 induces CHOP binding to the IL-8 promoter. Taken together, our results suggest that the increased expression of CHOP in response to PGE2 exerts a positive transcriptional regulation of the IL-8 promoter mediated by direct binding to a novel consensus site. We have previously reported that prostaglandin E2 (PGE2) 2The abbreviations used are: PGE2, prostaglandin E2; IL, interleukin; C/EBP, CCAAT enhancer-binding protein; CHOP, C/EBP homologous protein; NF, nuclear factor; AP-1, activator protein 1; siRNA, small interfering RNA; wt, wild type; MAPK, mitogen-activated protein kinase; CHOP-RE, CHOP-responsive element; ELISA, enzyme-linked immunosorbent assay; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; PIPES, 1,4-piperazinediethanesulfonic acid. 2The abbreviations used are: PGE2, prostaglandin E2; IL, interleukin; C/EBP, CCAAT enhancer-binding protein; CHOP, C/EBP homologous protein; NF, nuclear factor; AP-1, activator protein 1; siRNA, small interfering RNA; wt, wild type; MAPK, mitogen-activated protein kinase; CHOP-RE, CHOP-responsive element; ELISA, enzyme-linked immunosorbent assay; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; PIPES, 1,4-piperazinediethanesulfonic acid. stimulates the transcription of IL-8 gene in human T lymphocytes by activating in a protein kinase C-, p38 MAPK-, and phosphatidylinositol 3-kinase-dependent manner the transcription factor C/EBP homologous protein (CHOP) (1Caristi S. Piraino G. Cucinotta M. Valenti A. Loddo S. Teti D. J. Biol. Chem. 2005; 280: 14433-14442Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). More recently, the positive correlation between CHOP and IL-8 synthesis has been confirmed by experiments showing that the inhibition of CHOP repressed the NF-κB-mediated and proteasome-induced IL-8 activation (2Vij N. Fang S. Zeitlin P.L. J. Biol. Chem. 2006; 281: 17369-17378Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). These results corroborated a positive role for CHOP in the induction of pro-inflammatory genes that was previously indicated on the IL-6 expression in melanoma cells, although with distinct mechanisms (3Hattori T. Itoh S. Hayashi H. Chiba T. Takii T. Yoshizaki K. Onozaki K. J. Interferon Cytokine Res. 2001; 21: 323-332Crossref PubMed Scopus (12) Google Scholar). The activation of IL-6 transcription was dependent on the CHOP dimerization ability, given that a mutant lacking the leucine zipper domain exhibited a reduced effect on IL-6 promoter activity. CHOP was originally cloned as an inhibitory molecule of the C/EBP family transcriptional factors, to which it binds with its extreme C-terminal leucine zipper region, thus blocking the binding of C/EBPs to DNA (4Ron D. Habener J.F. Genes Dev. 1992; 6: 439-453Crossref PubMed Scopus (972) Google Scholar, 5Shirakawa K. Maeda S. Gotoh T. Hayashi M. Shinomiya K. Ehata S. Nishimura R. Mori M. Onozaki K. Hayashi H. Uematsu S. Akira S. Ogata E. Miyazono K. Imamura T. Mol. Cell Biol. 2006; 26: 6105-6116Crossref PubMed Scopus (71) Google Scholar). Afterward, it has been reported that CHOP can act as transcription factor inducing the gene expression by forming a heterodimer (6Zhao Q. Wang J. Levichkin I.V. Stasinopoulos S. Ryan M.T. Hoogenraad N.J. EMBO J. 2002; 21: 4411-4419Crossref PubMed Scopus (680) Google Scholar). It has also been shown that CHOP can interact with a variety of proteins in a different manner. The gain-of-function of CHOP induces its binding to several nuclear protein from erythroid cells, some of which are not C/EBP family members (7Cui K. Coutts M. Stahl J. Sytkowski. A.J. J. Biol. Chem. 2000; 275: 7591-7596Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 8Sauter K. Grampp T. Fritschy J.M. Kaupmann K. Bettler B. Mohler H. Benke D. J. Biol. Chem. 2005; 280: 33566-33572Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). More recently, it has been reported that truncation of the N-terminal amino acids 1–42 (CHOPΔN) abolishes its co-localization with γ-aminobutyric acid type B1a receptor, indicating that CHOP may also interact with its N-terminal domain (8Sauter K. Grampp T. Fritschy J.M. Kaupmann K. Bettler B. Mohler H. Benke D. J. Biol. Chem. 2005; 280: 33566-33572Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). On the other hand, a direct activity of CHOP as transcription factor was demonstrated by Ubeda et al. (9Ubeda M. Wang X.Z. Zinszner H. Wu I. Habener J.F. Ron D. Mol. Cell. Biol. 1996; 16: 1479-1489Crossref PubMed Google Scholar), who showed CHOP binding to a specific nucleotide sequence, which is similar to but distinct from the typical C/EBP-binding motif. Moreover, dose-dependent bidirectional effects of CHOP on the monocyte chemo-attractant protein-1 promoter were shown in vascular smooth muscle cells (10Kodama K. Nishio Y. Sekine O. Sato Y. Egawa K. Maegawa H. Kashiwagi A. Am. J. Physiol. 2005; 289: C582-C590Crossref PubMed Scopus (15) Google Scholar). Low expression of CHOP blocked the C/EBP binding to C/EBP-responsive elements, whereas increased expression directly stimulated the activity of monocyte chemo-attractant protein-1. Thus, CHOP seems to exhibit different, and in some ways opposite, mechanisms in regulating gene expression and molecular interactions. In the present study, we addressed the molecular mechanism(s) by which CHOP increases the IL-8 gene expression following its activation by PGE2. Initially we investigated whether PGE2 induced CHOP expression in T cells; successively we demonstrated that CHOP is essential for PGE2-mediated IL-8 transcription, identifying the CHOP domains and the IL-8 promoter sites involved. Finally, a CHOP-responsive element (CHOP-RE) in the IL-8 promoter of human T lymphocytes stimulated by PGE2 was characterized.EXPERIMENTAL PROCEDURESCells and Culture Conditions—Jurkat T cells (clone E6–1) were obtained from European Collection of Cell Cultures (Sigma-Aldrich) and maintained in a humidified atmosphere of 5% CO2 in 95% air (37 °C) in RPMI 1640 (Euroclone, Milan, Italy) supplemented with 50 IU/ml penicillin, 50 μg/ml streptomycin (Euroclone, Milan, Italy), and 20% heat-inactivated fetal calf serum (Euroclone, Milan, Italy). The cells were routinely tested for mycoplasma infection, and the cultures were renewed, from frozen stocks, every 2 months.RNA Extraction and Reverse Transcriptase—T cells were cultured in 35-mm well plates (5 × 106 cells/well) in the absence or presence of anti-CD3 (1 μg/ml) plus anti-CD28 (250 ng/ml) antibodies (Immnunotech, Marseilles, France), and the cells were then immediately stimulated for the indicated times with 10–5 m PGE2. Total RNA was extracted with TRIzol (Invitrogen) according to the manufacturer's instructions. 1 μg of total RNA was reverse-transcribed in a total volume of 20 μl with an IMProm-IITM reverse transcriptase kit (Promega, Milan, Italy) according to the manufacturer's instructions.Reverse Transcription PCR—20 μl of reverse transcription products were brought to a volume of 100 μl containing 2 mm MgCl2, 0.2 mm PCR nucleotide mixture, a 1 μm concentration of both the upstream and downstream PCR primers (Sigma), 5 units of Taq DNA polymerase (Transgenomic, Inc., Bergamo, Italy), and 10× PCR buffer (Transgenomic, Inc.). Two pairs of primers were used in this study. The primer sequences were as follows: CHOP, 5′-CAGAACCAGCAGAGGTCACA-3′ (sense) and 5′-AGCTGTGCCACTTTCCTTTC-3′ (antisense); and β-actin, 5′-TGACGGGGTCTACCCACACTGTGCCCCATCTA-3′ (sense) and 5′-CTAGAAGCATTGCGCTGGACGATGGAGGG-3′ (antisense). Amplification was carried in a DNA thermal cycler (Applied Biosystems, Milan) after an initial denaturation at 95 °C for 4 min. This was followed by 35 cycles of PCR using the following temperature and time profile: denaturation at 94 °C for 1 min, primer annealing for 1 min at 60 °C for CHOP and at 62 °C for β-actin, primer extension at 72 °C for 2 min, and a final extension at 72 °C for 7 min. The PCR products were visualized by electrophoresis on 1% agarose gel in 1× buffer containing 89 mm Tris borate and 2 mm EDTA (pH 8.3) after staining with 0.5 μg/ml ethidium bromide. The UV light-illuminated gels were photographed, and the relative sum intensity was calculated by normalizing the sum intensity of the CHOP product to the β-actin mRNA control.Quantitative Real-time PCR—Quantitative real-time PCR was performed using the ABI Prism 7500 real-time PCR system (Applied Biosystems). We used 5′-GCTTCTCTGGCTTGGCTGACT-3′ (Forward primer), 5′-CTGTTTCCGTTTCCTGGTTCTC-3′ (Reverse primer), and FAM-5′-CACTCTCCAGATTCCAGTCA-3′-MGBNFQ as primers and a TaqMan probe, respectively. Thermal cycling conditions included activation at 95 °C (10 min) followed by 40 cycles each of denaturation at 95 °C (15 s) and annealing/elongation at 55 °C (1 min). Each sample was analyzed in triplicate with β-actin (Applied Biosystems) as an the inner control, and the mean value of CHOP mRNA was calculated.The cycle threshold (Ct) was used to calculate relative amounts of target DNA. The Ct was determined as the number of PCR cycles required for a given reaction to reach an arbitrary fluorescence value within the linear amplification range.Plasmid Construction and Transient Transfections—Liposome-mediated transient gene transfer was carried out with DMRIE-C (Invitrogen) as recommended by the manufacturer. Briefly, the cells were seeded at 2 × 106 cells/well and transiently transfected with 1 μg of wt IL-8, IL-8 lacking the AP-1 site (IL-8–97), IL-8–97 mutant C/EBP (IL-8–97/mC/EBP), IL-8–97 mutant NF-κB (IL-8–97/mNF-κB), or IL-8 double mutant for C/EBP and NF-κB (IL-8/AP-1) promoter-driven luciferase reporter vectors developed in collaboration with Dr. Hector R. Wong (Cincinnati Children's Hospital Medical Center, Cincinnati OH); pSV-nlsLacZ DNA, a β-galactosidase expression vector (0.5 μg) and “empty” plasmid DNA (pBSM), at a final concentration of 2 μg/plate. pcDNA 3.1/V5 His expression plasmids for CHOP at a final concentration of 0.2 μg/plate were co-transfected where indicated. A mutant IL-8/AP-1 promoter construct (IL-8/AP-1ΔCHOP-RE) lacking the nucleotides GTGTGATG located upstream from the AP-1 was generated by PCR using forward primer 5′-TCCcccgggACTCAGGTTTGCCCTGAGGGGA and reverse primer 5′-CCGctcgagTGCCTTATGGAGTGCTCCGGTG. PCR conditions were 35 cycles at 94 °C for 45 s, 52 °C for 45 s, 72 °C for 45 s, and a final extension at 72 °C for 10 min. The PCR product was cloned as a SmaI/XhoI fragment into PGL2 basic vector (Promega). The constructs were sequenced before utilization.wt CHOP and CHOP mutants lacking the basic DNA-binding domain (CHOPΔBR) or the leucine zipper domain (CHOPΔLZ) or mutated into the p38 MAPK-dependent phosphorylation site (S79A,S82A) were kindly provided by Dr. Hidetoshi Hayashi (Nagoya City University, Nagoya, Japan). The CHOP mutant lacking either the DNA-binding or the leucine zipper domains and containing the sole transactivation domain (CHOPTA) was obtained by Stratagene (Stratagene, La Jolla, CA). To create the dominant negative transactivation domain mutant CHOP (TAM-CHOP), the nucleotide sequences were amplified by PCR from the human genome using the forward primer 5′-ATGGGTACCTATGTTTCACCTCCTGG-3′ and the reverse primer 5′-TCATGCTTGGTGCAGATTCACCATTC-3′. The PCR products were cloned into a pcDNA 3.1/V5 His expression vector (TOPO TA; Invitrogen). The sequence was confirmed by DNA sequencing (CEQ 2000; Beckman, Fullerton, CA). wt c-Jun plasmid was provided by Lucia Altucci (Department of General Pathology, Second University of Naples, Naples, Italy).In all of the experiments, the transfections were stopped after 6 h by adding an equal volume of RPMI 1640 containing 20% fetal calf serum. Twenty-four hours after transfection, the cells were treated with 10 μm PGE2 (Sigma, Milan, Italy). After an additional 6 h, the cells were harvested, and protein extracts were prepared for the luciferase activity using luciferine (Promega, Milan, Italy) as the substrate. Luciferase activity was normalized for β-galactosidase activity produced by co-transfected plasmid pnlsLAC.siRNA and Transfection—The siRNA sequence targeting CHOP mRNA corresponding to 5′-CAAUUGUUCAUGCUUGGUGUU-3′, the siRNA sequence targeting c-Jun mRNA corresponding to 5′-GGAUCAAGGCGGAGAGGAA-3′ and the nonspecific duplex corresponding to 5′-CAGUGGAGAUCAACGUGCAAGUU-3′ (ctr-siRNA) were obtained from Dharmacon (Lafayette, CO). Concentrations of siRNA and times of incubation were tested. Both CHOP and c-Jun siRNA knockdown reached the maximum at a concentration of 50 nm and at 48 h post-transfection. To assess gene silencing, the protein levels of CHOP and c-Jun were determined by immunoblotting. Jurkat T cells were plated in 35-mm well plates in RPMI 1640 medium without fetal bovine serum and co-transfected with double-stranded siRNA and wt IL-8 promoter (1 μg) using the DMRIE-C reagent according to the manufacturer's instructions. 48 h after the transfection, the cells were incubated in the absence or presence of anti-CD3 (1 μg/ml) plus anti-CD28 (250 ng/ml) antibodies with PGE2 10 μm. After an additional 6 h, the cells were harvested, and protein extracts were prepared for the luciferase activity using luciferine (Promega, Milan, Italy) as the substrate. Luciferase activity was normalized for β-galactosidase activity produced by co-transfected plasmid pnlsLAC.Western Blot Analysis—The cells were cultured in 35-mm well plates at a concentration of 5 × 106 cells/well. After stimulation, the cells were lysed at 4 °C in 150 μl of lysis buffer M-PER (Pierce) and 1 mm phenylmethylsulfonyl fluoride, 1 mm sodium orthovanadate, 1 mg/ml leupeptin. Where indicated, total extracts were prepared from Jurkat T cells 36 h after transfection with wt or mutant pcDNA 3.1/V5 His CHOP expression plasmids.Western blotting was carried out as previously described (1Caristi S. Piraino G. Cucinotta M. Valenti A. Loddo S. Teti D. J. Biol. Chem. 2005; 280: 14433-14442Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). CHOP (Affinity BioReagents™) and c-Jun (Santa Cruz Biotechnology, Santa Cruz, CA) mouse monoclonal antibodies, diluted 1:500, and anti-V5 mouse monoclonal antibody, diluted 1:5000 (Invitrogen), have been employed, as described by the manufacturer. A mouse monoclonal 1:1000 diluted primary anti-β-actin antibody was used to normalize protein loading to that of specific proteins in each lane (Sigma-Aldrich Milan, Italy). After washings in phosphate-buffered saline with 0.3% Tween 20, the membranes were incubated with secondary horseradish peroxidase-conjugated anti-mouse IgG for 1 h. The proteins were visualized with reagents from Pierce (Super-signal West Pico chemiluminescent substrate system).IL-8 Production Assay—Jurkat T cells were cultured in round-bottom 24-well plates (1 × 106 cells/well) and transiently transfected with IL-8/AP-1 or IL-8/AP-1ΔCHOP-RE promoters, as above reported. Where indicated, the cells were co-transfected with wt CHOP, wt c-Jun plasmids, or both, in the presence or absence of CHOP or c-Jun siRNAs. After transfection, the cells were stimulated with anti-CD3 (1 μg/ml) plus anti-CD28 (250 ng/ml) antibodies and immediately treated with 10–5 m PGE2. 24 h after stimulation, the supernatants were collected and analyzed for IL-8 production using an enzyme-linked immunosorbent assay (ELISA) kit (BioSource International, Nivelles, Belgium) according to the manufacturer's instructions.Electrophoretic Mobility Shift Assay (EMSA)—Isolation of nuclear proteins from cultures of 1 × 108 Jurkat T cells grown in RPMI 1640 (Euroclone) with 10% fetal calf serum (Euroclone) supplemented with 50 IU/ml penicillin, 50 μg/ml streptomycin (Euroclone) in 5% CO2 at 37 °C was performed according to a recently detailed method (11Monici M.C. Aguennouz M. Mazzeo A. Messina C. Vita G. Neurology. 2003; 60: 993-997Crossref PubMed Scopus (146) Google Scholar). Where indicated, the nuclear extracts were prepared from Jurkat T cells 36 h after transfection with c-Jun or TAM-CHOP plasmids.Nuclear extracts (20 μg) were incubated for 30 min at room temperature with 50 fmol of biotin-3′-end-labeled, double-strands of different consensus or mutated probes (Table 1) (both complementary oligonucleotides were end-labeled separately and then annealed prior to use). Binding reaction mixture was prepared in a final volume of 20 μl of HEPES buffer containing 1 mg of double-stranded poly(dI/dC), 10% glycerol, 100 mm MgCl2, and 1% Nonidet P-40, performed with the Light-Shift™ Chemiluminescent EMSA kit (Pierce), according to the manufacturer's instructions. For competition assay, 50-fold excess unlabeled double-stranded oligonucleotides used as competitors were incubated with the extracts at room temperature 10 min prior to probe addition. For antibody supershift assays, the nuclear extracts were incubated with the respective antibodies in the same binding reaction volume for an additional hour at 4 °C. The antibodies used were anti-CHOP (Affinity BioReagents™) and anti-c-Jun (Santa Cruz Biotechnology, Santa Cruz, CA). The bound complexes were separated on 7.5% nondenaturating polyacrylamide gels, blotted onto nylon membrane, and visualized on Kodak x-ray film (Kodak) by autoradiography.TABLE 1Sequences of wild type (A, B, and C) and mutated (Mut 1–5) probes employedOligonucleotide nameSequence (5′ → 3′)AaRegion of IL-8 promoter (GenBank™ accession number M28130) between bases -141 and -99.GAAGTGTGATGACTCAGGTTGCCCTGAGGGGATGGGCCATCMut AGAAGTGTGACTTCTCAGGTTGCCCTGAGGGGATGGGCCATCBbRegion of IL-8 promoter between bases -150 and -130.ACAAAATAGGAAGTGTGATGMut B1TGGACCGATGAAGTGTGATGMut B2ACAAAATAGGAAGTGTGGCAMut B3ACAAAATAGTCCGTGTGATGMut B4ACAAAATAGGACACGTGATGMut B5ACAAAATAGGAAGTTACATGCcRegion of IL-8 promoter between bases -129 and -99.TGACTCAGGTTTGCCCTGAGGGATGGGCCATCMut CTGACGACGGTTTGCCCTGAGGGATGGGCCATCa Region of IL-8 promoter (GenBank™ accession number M28130) between bases -141 and -99.b Region of IL-8 promoter between bases -150 and -130.c Region of IL-8 promoter between bases -129 and -99. Open table in a new tab Chromatin Immunoprecipitation (ChIP)—ChIP was performed essentially as described by Weinmann and Farnhan (12Weinmann A.S. Farnham P.J. Methods. 2002; 26: 37-47Crossref PubMed Scopus (299) Google Scholar) with the following modifications. Cultures of 1 × 108 Jurkat T cells were grown in RPMI 1640 (Euroclone) with 10% fetal calf serum (Euroclone) supplemented with 50 IU/ml penicillin, 50 μg/ml streptomycin (Euroclone) in 5% CO2 at 37 °C. Cross-linking was induced by adding 1% (v/v) formaldehyde and incubation for 10 min at room temperature on a shaker. After stopping the cross-linking reaction by adding 0.125 m glycine and incubation for 5 min (with shaking at room temperature), the cells were pelletted and washed twice in ice-cold phosphate-buffered saline including protease inhibitors. The nuclei were isolated by resuspending the cellular pellet in 1 ml of ice-cold swelling buffer (5 mm PIPES, pH 8.0, 85 mm KCl, 0.5% Nonidet P-40, and protease inhibitors), split into two aliquots, and incubated on ice for 10 min. Chromatin was fragmented by subjecting the nuclei to sonication procedure, using four pulses of 15 s each at setting 7 on a Fisher model 60 sonic dismembranator.The lysate was combined and transferred to a 15-ml conical tube and diluted with 9 ml of dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-HCl, pH 8.1, 167 mm NaCl, and protease inhibitors). An aliquot of 500 μl of protein A-Sepharose beads (Pharmacia) was added to the diluted nuclear lysate and incubated for 2 h at 4 °C while rotating. The beads were pelletted for 10 min at 2000 rpm, and the supernatant was divided into 10 aliquots. 25 μl containing 1 μg of the appropriate monoclonal antibody (c-Jun or CHOP; Chemicon International and Affinity BioReagents, respectively) or no antibody was added to the aliquoted supernatant and incubated at 4 °C overnight while rotating. The pellets were washed twice with 1× dialysis buffer (2 mm EDTA, 50 mm Tris-Cl, pH 8.0, phenylmethylsulfonyl fluoride and then four times with IP wash buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-Cl, pH 8.1, 167 mm NaCl, protease inhibitors). Elution of antibody-protein-DNA complexes was obtained by the addition of 200 μl of elution buffer (50 mm NaHCO3, 1% SDS). Residual traces of Staph A cells were removed adding 1 μl of high concentration of RNase A (Roche Applied Sciences catalog number 1579681; 10 mg/ml) and 12 μl of 5 m NaCl to a final concentration of 0.3 m. After incubation of samples at 67 °C for 4–5 h to reverse formaldehyde cross-links, 2.5 volumes of ethanol was added, and precipitation was achieved at –20 °C overnight. DNA extraction was performed with phenol/chloroform/isoamyl alcohol protocol. DNA was precipitated adding 30 μl of 5 m NaCl, 5 μg of glycogen (Invitrogen), and 750 μl ethanol for overnight.DNA was dissolved in 10 μl of TE buffer and quantified using a genomic PCR, as reported by Vij et al. (13Vij N. Amoako O.M. Mazur S. Zeitlin P.M. Am. J. Respir. Cell Mol. Biol. 2008; 38: 176-184Crossref PubMed Scopus (53) Google Scholar). Briefly, the 2-μl DNA sample was mixed with 1 μm IL-8 forward primer (CATACTCCGTATTTGATAAGGAAC), 1 μm IL-8 reverse primer (GGCTCTTGTCCTAGAAGCTT), and 16 μl of PCR supermix (Invitrogen). The PCR was carried out as follows: 95 °C for 10 min, 28 three-step cycles: 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Where indicated, DNA was mixed with 1 μm IL-6 forward primer (CCTCAGACATCTCCAGTCCTATA), 1 μm IL-6 reverse primer (TGCTTCTTAGCGCTAGCCTCAAT), and 16 μl of PCR supermix (Invitrogen). The PCR conditions were as follows: 95 °C for 10 min, 38 three-step cycles: 94 °C for 40 s, 68 °C for 50 s, and 72 °C for 60 s. All of the samples were analyzed by 2% agarose gels containing ethidium bromide.Densitometry and Statistical Analysis—The relative intensities of protein and nucleic acid bands were analyzed using the Digital Sciences one-dimensional program from Kodak Scientific Imaging Systems (New Haven, CT). Standard curves were run, and the data that were obtained were in the linear range of the curve. In addition, all of the values were normalized to their respective lane loading controls. The data are expressed as the means ± S.E. of n determinations. The results were analyzed by two-tailed Student's t test. p values <0.05 were considered significant.RESULTSCHOP Expression after Stimulation with PGE2—Because we have previously shown that PGE2 is able to induce IL-8 promoter expression through phosphorylation and activation of CHOP in T lymphocytes (1Caristi S. Piraino G. Cucinotta M. Valenti A. Loddo S. Teti D. J. Biol. Chem. 2005; 280: 14433-14442Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar), we investigated whether PGE2 also affects the expression of this transcription factor. To this end, reverse transcription-PCR, real-time PCR, and Western blot analyses were performed in Jurkat T cells treated with 10–5 m PGE2 for different periods of time. Fig. 1A shows that the mRNA expression of CHOP was induced by PGE2 at 60 min after treatment and decreased at 180 min, with a peak at 120 min (p < 0.01). These results were confirmed and strengthened by data obtained from quantitative PCR experiments, which showed a similar pattern of mRNA synthesis after PGE2 treatment (Fig. 1B). Fig. 1C shows the increase in CHOP protein levels after PGE2 treatment, which reaches the maximum between 180 and 240 min (p < 0.01). Therefore, PGE2 stimulation leads to a time-dependent increase of CHOP at both mRNA and protein levels.CHOP Domains Involved in the IL-8 Promoter Induction—To identify the CHOP domain(s) responsible for the IL-8 promoter activation in untreated (Fig. 2A, white bars) as well as in PGE2-treated (Fig. 2A, black bars) cells, co-transfection with the wt IL-8 promoter along with constructs overexpressing different CHOP mutants was performed, and luciferase activity in the cell lysates was measured. CHOP mutants that either (i) lacked the basic DNA-binding domain (CHOPΔBR), (ii) lacked the leucine zipper domain (CHOPΔLZ), (iii) lacked both (CHOP-TA), or (iv) were mutated into the p38 MAPK-dependent phosphorylation sites (S79A,S82A) were still able to activate IL-8 promoter activity similarly to wt CHOP (Fig. 2A). The CHOP mutant lacking the transactivation domain (TAM-CHOP) exhibited a slight inhibition of the IL-8 promoter in untreated cells, thus suggesting that the basal activity of IL-8 gene is largely CHOP-independent. In PGE2-treated cells overexpressing the CHOPΔBR, CHOPΔLZ, CHOP-TA, or CHOP (S79A,S82A), the IL-8 promoter activity is up-regulated to the same extent of cells expressing wt CHOP. In contrast, expression of TAM-CHOP highly reduced IL-8 promoter activation when compared with wt CHOP (Fig. 2A, black bars). Thus, PGE2 induces IL-8 gene expression mainly through the CHOP transactivating domain. Of note, all mutants resulted in similar expression levels after transfection (Fig. 2B), thus confirming that the described regulations are specific.FIGURE 2CHOP domains responsible for the activation of IL-8 promoter. A, Jurkat T cells were transfected with wt IL-8 promoter and, where indicated, co-transfected with wt or mutants CHOP expression plasmids. After transfection, Jurkat T cells were treated with anti-CD3 (1 μg/ml) plus anti-CD28 (250 ng/ml) antibodies in the absence (white bars) or presence (black bars) of 10–5m PGE2. The data are the means ± S.D. of five independent experiments and are expressed as fold induction. β-Galactosidase levels were determined for transfection efficiency. **, p < 0.01 versus wt CHOP co-transfected cells, based on two-tailed Student's t test. B, Western blot of total extracts prepared from Jurkat T cells 36 h after transfection with pcDNA 3.1/V5 His wt or mutant CHOP expression vectors. The total proteins were resolved by 10% SDS-PAGE and immunoblotted using anti-V5 mouse monoclonal antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT)IL-8 Promoter Sites Responsive to PGE2—To identify the IL-8 promoter region involved in PGE2 activation, promoter regions named wt IL-8, IL-8/AP-1, IL-8–97/mC/EBP, IL-8–97/mNF-κB, and IL-8–97 (Fig. 3A) were transfected in PGE2-treated cells, and their luciferase report