DNA Damage-induced Down-regulation of Human Cdc25C and Cdc2 Is Mediated by Cooperation between p53 and Maintenance DNA (Cytosine-5) Methyltransferase 1
2006; Elsevier BV; Volume: 281; Issue: 34 Linguagem: Inglês
10.1074/jbc.m603724200
ISSN1083-351X
AutoresGérald Le Gac, Pierre‐Olivier Estève, Claude Férec, Sriharsa Pradhan,
Tópico(s)Genomics and Chromatin Dynamics
ResumoThe Cdc25C phosphatase mediates cellular entry into mitosis in mammalian cells. Cdc25C activates Cdc2 for entry into mitosis by dephosphorylating Thr and Tyr at the site of inhibitory phosphorylation. The Cdc25C gene contains tumor suppressor p53 binding sites and is demonstrated to contribute to the p53-dependent cell cycle arrest upon DNA damage. Here we show that both Cdc25C and Cdc2 were down-regulated in wild-type HCT116 cells but not in p53-null, DNMT1-null or DNMT1and DNMT3b-null cells, upon p53 stabilization following doxorubicin-mediated DNA damage. Furthermore, zebularine, a drug that selectively traps and depletes nuclear DNMT1 and DNMT3b, relieved p53-mediated repression of endogenous Cdc25C and Cdc2. Methylation analysis of the Cdc25C and Cdc2 promoter displayed internal CG methylation proximal to the p53 binding site upon DNA damage in a p53-dependent manner. Chromatin immunoprecipitation of doxorubicin treated wild-type HCT116 cells showed the presence of DNMT1, p53, H3K9me2, and the transcriptional repressor HDAC1 on the Cdc25C and Cdc2 promoters, suggesting their involvement as repressive complexes in Cdc25C and Cdc2 gene silencing. Thus, the general mechanism of p53-mediated gene repression may involve recruitment of other repressive factors. The Cdc25C phosphatase mediates cellular entry into mitosis in mammalian cells. Cdc25C activates Cdc2 for entry into mitosis by dephosphorylating Thr and Tyr at the site of inhibitory phosphorylation. The Cdc25C gene contains tumor suppressor p53 binding sites and is demonstrated to contribute to the p53-dependent cell cycle arrest upon DNA damage. Here we show that both Cdc25C and Cdc2 were down-regulated in wild-type HCT116 cells but not in p53-null, DNMT1-null or DNMT1and DNMT3b-null cells, upon p53 stabilization following doxorubicin-mediated DNA damage. Furthermore, zebularine, a drug that selectively traps and depletes nuclear DNMT1 and DNMT3b, relieved p53-mediated repression of endogenous Cdc25C and Cdc2. Methylation analysis of the Cdc25C and Cdc2 promoter displayed internal CG methylation proximal to the p53 binding site upon DNA damage in a p53-dependent manner. Chromatin immunoprecipitation of doxorubicin treated wild-type HCT116 cells showed the presence of DNMT1, p53, H3K9me2, and the transcriptional repressor HDAC1 on the Cdc25C and Cdc2 promoters, suggesting their involvement as repressive complexes in Cdc25C and Cdc2 gene silencing. Thus, the general mechanism of p53-mediated gene repression may involve recruitment of other repressive factors. In mammalian cells complete and accurate DNA replication along with correct epigenetic mark(s) are integral to cell division. This event is initiated at several hundred different chromosomal locations called origins of replication. At an origin of replication maintenance DNA methyltransferase (DNMT1) 3The abbreviations used are: DNMT1, DNA methyltransferase 1; HDAC, histone deacetylase; PBS, phosphate-buffered saline; ChIP, chromatin immunoprecipitation assay; G6PDH, glucose-6-phosphate dehydrogenase; WT, wild type; CDK, cyclin-dependent kinase. methylates cytosine residues on the newly synthesized DNA to maintain the parental methylation pattern (1Leonhardt H. Page A.W. Weier H.U. Bestor T.H. Cell. 1992; 71: 865-873Abstract Full Text PDF PubMed Scopus (838) Google Scholar). PCNA, an auxiliary factor for DNA replication, facilitates DNA methylation by loading DNMT1 onto itself (2Chuang L.S. Ian H.I. Koh T.W. Ng H.H. Xu G. Li B.F. Science. 1997; 277: 1996-2000Crossref PubMed Scopus (795) Google Scholar). The inheritance of the methylation pattern is crucial for determining gene expression because the majority of CpG dinucleotides in the mammalian genome are methylated and methylation often dictates the transcriptional status of a gene. It has been demonstrated that DNA methylation is correlated with transcriptional inactivation of a gene and the reverse is true for gene activation, although recently it was reported that histone modification greatly influences the transcriptional status of a gene (3Fuks F. Curr. Opin. Genet. Dev. 2005; 15: 490-495Crossref PubMed Scopus (534) Google Scholar). Additionally, there are two more DNA (cytosine-5) methyltransferases in the mammalian genome known as de novo methyltransferases, DNMT3a and DNMT3b (4Okano M. Bell D.W. Haber D.A. Li E. Cell. 1999; 99: 247-257Abstract Full Text Full Text PDF PubMed Scopus (4664) Google Scholar). These two enzymes participate in early embryonic development (4Okano M. Bell D.W. Haber D.A. Li E. Cell. 1999; 99: 247-257Abstract Full Text Full Text PDF PubMed Scopus (4664) Google Scholar) and perhaps to a lesser extent in the genome wide maintenance of CpG methylation either alone or in conjunction with DNMT1 (5Rhee I. Jair K.W. Yen R.W. Lengauer C. Herman J.G. Kinzler K.W. Vogelstein B. Baylin S.B. Schuebel K.E. Nature. 2000; 404: 1003-1007Crossref PubMed Scopus (373) Google Scholar, 6Liang G. Chan M.F. Tomigahara Y. Tsai Y.C. Gonzales F.A. Li E. Laird P.W. Jones P.A. Mol. Cell. Biol. 2002; 22: 480-491Crossref PubMed Scopus (460) Google Scholar). Although DNMTs enforce gene silencing directly by DNA methylation, they also act as a platform for recruitment of transcriptional repressor complexes for gene silencing through their N-terminal regions (7Pradhan S. Esteve P.O. Clin. Immunol. 2003; 109: 6-16Crossref PubMed Scopus (82) Google Scholar). Transcriptional repressors such as MeCP2, methyl-binding proteins (MBDs) and histone deacetylases (HDACs) participate in gene silencing by DNMT1 recruitment (8Kimura H. Shiota K. J. Biol. Chem. 2003; 278: 4806-4812Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar, 9Tatematsu K.I. Yamazaki T. Ishikawa F. Genes Cells. 2000; 5: 677-688Crossref PubMed Scopus (119) Google Scholar, 10Fuks F. Burgers W.A. Brehm A. Hughes-Davies L. Kouzarides T. Nat. Genet. 2000; 24: 88-91Crossref PubMed Scopus (832) Google Scholar). Recently another class of enzymes was shown to be involved in repressive chromatin modeling via specific lysine residues methylation on histones. These histone methyltransferases such as G9a, SUV39H1, SetDB1, and their homologues can also act as a recruitment center for several transcriptional repressors (11Tachibana M. Ueda J. Fukuda M. Takeda N. Ohta T. Iwanari H. Sakihama T. Kodama T. Hamakubo T. Shinkai Y. Genes Dev. 2005; 19: 815-826Crossref PubMed Scopus (627) Google Scholar, 12Fuks F. Hurd P.J. Deplus R. Kouzarides T. Nucleic Acids Res. 2003; 31: 2305-2312Crossref PubMed Scopus (606) Google Scholar, 13Sarraf S.A. Stancheva I. Mol. Cell. 2004; 15: 595-605Abstract Full Text PDF PubMed Scopus (393) Google Scholar). The importance of DNA and histone methyltransferase gene products in cell survival was shown in genetic knock-out studies. Knock-out mice for the genes encoding enzymes for DNA methylation or histone methylation displayed growth retardation or embryonic lethality (14Li E. Bestor T.H. Jaenisch R. Cell. 1992; 69: 915-926Abstract Full Text PDF PubMed Scopus (3274) Google Scholar, 4Okano M. Bell D.W. Haber D.A. Li E. Cell. 1999; 99: 247-257Abstract Full Text Full Text PDF PubMed Scopus (4664) Google Scholar, 15Tachibana M. Sugimoto K. Nozaki M. Ueda J. Ohta T. Ohki M. Fukuda M. Takeda N. Niida H. Kato H. Shinkai Y. Genes Dev. 2002; 16: 1779-1791Crossref PubMed Scopus (1006) Google Scholar), demonstrating their importance in animal growth and development. Thus, specific gene expression patterns in mammalian cells are coordinated and conducted by a host of genetic and epigenetic factors. Interaction of these factors on a promoter or in its vicinity often leads to gene silencing or regulation. For example, Myc binds the corepressor DNMT3a and can target DNMT3a selectively to the promoter of p21Cip1 (16Brenner C. Deplus R. Didelot C. Loriot A. Vire E. De Smet C. Gutierrez A. Danovi D. Bernard D. Boon T. Pelicci P.G. Amati B. Kouzarides T. de Launoit Y. Di Croce L. Fuks F. EMBO J. 2005; 24: 336-346Crossref PubMed Scopus (342) Google Scholar). Similarly, the leukemia-promoting PML-RAR fusion protein induces gene hypermethylation and silencing by recruiting DNA methyltransferases to target promoters and contributes to its leukemogenic potential (17Di Croce L. Raker V.A. Corsaro M. Fazi F. Fanelli M. Faretta M. Fuks F. Lo Coco F. Kouzarides T. Nervi C. Minucci S. Pelicci P.G. Science. 2002; 295: 1079-1082Crossref PubMed Scopus (701) Google Scholar). A key protein in gene regulation during cellular stress is tumor suppressor p53. Intracellular stabilization and accumulation of p53 takes place when cells are stressed or their DNA is damaged (18Ma L. Wagner J. Rice J.J. Hu W. Levine A.J. Stolovitzky G.A. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 14266-14271Crossref PubMed Scopus (302) Google Scholar). Tumor suppressor p53 protects mammals from neoplasia by selectively eliminating stressed cells or cells with damaged DNA via programmed cell death. The p53-dependent growth arrest in response to damaged DNA occurs during both the G1 and G2 phases of the cell cycle (19Levine A.J. Cell. 1997; 88: 323-331Abstract Full Text Full Text PDF PubMed Scopus (6804) Google Scholar, 20Vogelstein B. Lane D. Levine A.J. Nature. 2000; 408: 307-310Crossref PubMed Scopus (5905) Google Scholar). Furthermore p53 can also arrest cell division if the nucleotide pool in the cell becomes a limiting factor. The p53 protein has a central DNA binding domain flanked by transactivation and negative regulation domains. Binding of p53 to the promoter results in transcriptional activation of several genes that control cellular responses to stress (21Hoh J. Jin S. Parrado T. Edington J. Levine A.J. Ott J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 8467-8472Crossref PubMed Scopus (247) Google Scholar). For example, p53 causes G1 arrest in cells by stimulating cyclin-dependent kinase (CDK) inhibitor p21/Waf1, thus reducing the activity of CDK2, -4, and -6 that are required for progression from G1 to S phase (22Cox L.S. Lane D.P. Bioessays. 1995; 17: 501-508Crossref PubMed Scopus (311) Google Scholar, 23Enoch T. Norbury C. Trends Biochem. Sci. 1995; 20: 426-430Abstract Full Text PDF PubMed Scopus (240) Google Scholar). Furthermore, p53 was shown to bind to the promoter of cell survival proteins such as survivin and down-regulate its expression by recruitment of epigenetic machinery such as DNMT1 and HDAC1 (24Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (144) Google Scholar). These events link both histone and DNA methylation to gene silencing. Mammalian cell division is controlled by a number of regulatory factors, which including mitotic cyclins A, B1, and B2, mitotic kinase Cdc2 and mitotic phosphatase Cdc25C (25Nilsson I. Hoffmann I. Prog. Cell Cycle Res. 2000; 4: 107-114Crossref PubMed Scopus (387) Google Scholar). The kinase activity of Cdc2 is required at G2 phase of the cell cycle, and its biological activity is dependent on phosphatase activity on specific tyrosine (Tyr15) and the threonine (Thr14) residues by Cdc25C (26Winters Z.E. Hunt N.C. Bradburn M.J. Royds J.A. Turley H. Harris A.L. Norbury C.J. Eur. J. Cancer. 2001; 37: 2405-2412Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). Phosphorylation of Cdc25C by Chk kinase creates a binding site for 14-3-3 protein that can anchor Cdc25C in the cytoplasm, thus preventing Cdc2 activation. The dual specificity phosphatase Cdc25C mediates cell cycle progression into mitosis and also serves as a checkpoint at G2 (27Morgan D.O. Annu. Rev. Cell Dev. Biol. 1997; 13: 261-291Crossref PubMed Scopus (1831) Google Scholar). Upon DNA damage, repression of the Cdc2 and Cdc25C is mediated by p53 interaction on the promoter element of these genes. However, the precise mechanism of p53-mediated repression is not known. In this report, we have investigated the possible role of epigenetic modifications such as DNA methylation and histone methylation in the repression of Cdc2 and Cdc25C gene expression upon DNA damage. A direct recruitment of various enzymatic units for DNA and histone modification on to the target promoters by stabilized p53 is investigated here. Cell Culture—Parental HCT116 (colorectal carcinoma) cells were purchased from the American Type Culture Collection. DNMT1–/– and both DNMT1–/–/DNMT3b–/– HCT116 cells were kindly provided by Bert Vogelstein (Johns Hopkins University, Baltimore, MD). All cells were incubated at 37 °C in a5%CO2 humidified atmosphere and propagated in Mac Coy's 5A modified medium (ATCC) supplemented with 10% fetal bovine serum and 100 units/ml penicillin and streptomycin. 100 μg/ml hygromycin were added to the DNMT1–/– cells. Drug Treatments—For zebularine treatment, cells were plated (5 × 105 cells/100-mm diameter dish) and treated with 1.5 10–4m of zebularine (Calbiochem) 24 h post-plating. The medium was changed every 3 days, along with fresh zebularine treatment, for up to 8 days. For doxorubicin treatment, subconfluent cells were treated with 1 μm doxorubicin (Sigma) for 0, 2, 4, 24, and 48 h. For mitotic index determination, HCT116 and DNMT1-null cells were grown on coverslips. The cells were treated with doxorubicin and were fixed with paraformaldehyde 24and 48-h post-treatment. The cells were permeabilized with 1× PBS supplemented with 0.2% Triton X-100 and incubated with Hoechst 33342. Mitotic cells were scored under UV using a Zeiss inverted microscope. Western Blot Analysis—Subconfluent cultures of HCT116 cells were washed with 1× PBS, and lysed at 4 °C for 20 min with wash buffer (50 mm Tris-Cl pH 8.0, 150 mm NaCl, 0.02% sodium azide, 100 μg/ml phenylmethylsulfonyl fluoride, and 1% Nonidet P-40) supplemented with a protease inhibitor mixture (Sigma). Protein concentrations of the supernatants were determined using the Bio-Rad protein assay reagent based on the Bradford colorimetric method. 25–75 μg of proteins were electrophoresed on 4–20% SDS-polyacrylamide gels (Daiichi) after boiling for 5 min in a SDS sample buffer supplemented with 100 mm dithiothreitol (New England Biolabs (NEB)). The proteins were transferred onto Protran® pure nitrocellulose membranes (0.2 μ) (Schleicher and Schuell). After overnight electroblotting at 4 °C, the membranes were incubated with Tris-buffered saline with 0.1% Tween-20, 5% nonfat dry milk (Bio-Rad) and rabbit polyclonal antibody against DNMT1 (NEB), DNMT3a, DNMT3b (NEB), p53, Cdc2, Cdc25C, Chk1, Chk2, Chk1 phos (Ser296), Chk2 phos (Thr68), rabbit monoclonal for Cdc25C phos (Ser216), mouse monoclonal for survivin (Cell Signaling Technology (CST)), and rabbit polyclonal antibody against actin (Sigma). Goat anti-mouse or anti-rabbit secondary antibodies, conjugated to horseradish peroxidase, were used in a chemiluminescence detection system as directed by the manufacturer (CST). For zebularine experiments, cytoplasmic and nuclear extracts were separated and prepared using the NE-PER® Nuclear and Cytoplasmic Extraction reagents according to the manufacturer's instructions (Pierce). Total RNA Extraction and Quantification—Total RNA was isolated from subconfluent cells (cultured in 6-well plates) using RNAqueous® columns (Ambion) according to the manufacturer's recommendations for mammalian cultured cells. Briefly, the RNA of lysed cells was absorbed to a silica matrix, washed, and eluted with 50 μl (40 + 10) of 70 °C preheated Rnase-free elution solution. Residual DNA contamination was eliminated using the DNA-free™ kit (Ambion). RNA concentrations and purities were determined by diluting 20 μl of each RNA preparation in 480 μl of Tris-EDTA, pH 8.0 (1:25 dilution) and measuring the absorbance at 260 and 280 nm. cDNA Synthesis—One microgram of purified total RNA was reverse-transcribed using the Protoscript™ First Strand cDNA synthesis kit (NEB) and oligo(dT23) primer. cDNAs were diluted to 50 μl (1–2.5) prior use in quantitative PCR experiments. Quantitative PCR Experiments—The cDNAs of interest and reference cDNA (G6PDH) were amplified from a separate mix. All reactions were prepared in a 25-μl final volume with indicated end-concentrations: 0.8 μm of forward and reverse primer, 1× iQ™ SYBR® Green Supermix (Bio-Rad) and 4% cDNAs (2 of 50 μl). For each mix a No Template Control (NTC) was performed with 1 μg of total RNA in place of cDNAs. G6PDH primers were previously published (28Radonic, A., Thulke, S., Mackay, I. M., Landt, O., Siegert, W., and Nitsche, A.(2004) 313, 856–862Google Scholar). All the other primer sets (Table 1) were designed using the Primer3 program. These primers were selected to produce PCR fragments between 100 and 200 base pairs in length and in a narrow range of various primer annealing temperatures. All targets were thus amplified using a common PCR program as follows: a denaturation step at 95 °C for 2 min and 40 cycles with a 59 °C annealing temperature (95 °C for 20 s, 59 °C for 20 s, 72 °C for 20 s). All reactions were carried out using the i-Cycler instrument from Bio-Rad and double-strand DNA SYBR green incorporation that was measured during each elongation step.TABLE 1Primer setsGenBank™ accession no.Primer sequences (5′-3′)Real-time PCR efficiency (E)Forward primerReverse primerG6PDHX03674atcgaccactacctgggcaattctgcatcacgtcccggaE = 1.98, R2 = 0.997SurvivinNM_001168gttgcgctttcctttctgtcgcactttcttcgcagtttccE = 2.01, R2 = 0.999Cdc2BT007004tggggtcagctcgttactcacacttctggccacacttcatttaE = 2.16, R2 = 0.984Cdc25CNM_001790gaacaggccaagactgaagcgcccctggttagaatcttccE = 1.97, R2 = 0.998DNMT1X63692ggctgagatgaggcaaaaagaccaactcggtacaggatgcE = 2.00, R2 = 0.996DNMT3aAF067972ccggaacattgaggacatctcagcagatggtgcagtaggaE = 2.04, R2 = 0.998DNMT3bAF156487cccattcgagtcctgtcatttgatattcccctcgtgcttcE = 2.32, R2 = 0.993 Open table in a new tab Quantitative RT-PCR Analysis—Relative expression ratios were calculated using the mathematical model described by M. W. Pfaffl (29Pfaff M.W. Nucleic Acids Res. 2001; 29: e45Crossref PubMed Scopus (26612) Google Scholar). Real-time PCR efficiency (E) of each of the target and reference gene (G6PDH) transcript was investigated from 40-ng to 64-pg cDNA dilutions (Table 1). Each cDNA sample was examined in triplicate. pcdc2-luc and pcdc25C-luc Plasmid Constructions—The Cdc2–945/+69 bp (GenBank™ AF512554) and Cdc25C–339/+647 bp (GenBank™ AY497474) promoter regions were amplified by PCR from the genomic DNA of parental HCT116 cells, using the following primers: Cdc2 promoter forward primer, 5′-GCG GCG GGG TAC CCC CTG CAG TAA GTG CAG AAA TCT CT-3′; Cdc2 promoter reverse primer, 5′-CGC CGG AGG ATC TTC GCA GCG GCA GCT ACA ACA AC-3′; Cdc25C promoter forward primer, 5′-GCG GCG GGG TAC CCC TAG TAA GGC GCG GTT TA-3′; Cdc25C reverse primer, 5′-CGC CGG AAG ATC TTC GGT CTT CGA ATT CTC-3′. PCR fragments were cloned into KpnI and BglII restriction sites of the Promega promoterless luciferase vector pGL3-Basic. Underlined bases in the primer sequences indicate nucleotides added to permit efficient restrictions of the PCR products by the KpnI (forward primers) and BglII (reverse primers) enzymes. Luciferase Activity Assays—The pGL3 reporter plasmids were transiently transfected into wild-type and mutant HCT116 cells (cultured in 6-well plates) using the FuGENE method according to the manufacturer's recommendations (Roche Applied Science) and using a 4.5:1.2 transfection reagent (μl)/DNA ratio (μg). Transfected DNA included 1.0 μg of the pcdc2-luc or pcdc25C-luc plasmid construction and 200 ng of a pSV-β-galactosidase vector (Promega). This second reporter vector was used to check the transfection efficiencies and normalize luciferase activity values. Twelve hours after transfection, culture medium was changed. Then, cells were washed three times in 1× PBS and lysed in 200 μl of the Promega Passive Lysis Buffer® with gentle shaking at room temperature for 20 min. The cell lysate was centrifuged at 13,800 × g for 2 min to pellet the cell debris. Luciferase and β-galactosidase activities were determined, from 100 and 25 μl of the supernatants respectively, according to the manufacturer's protocols (Promega). For p53 expression pcDNAP53 construct was used. This construct contains the wild-type p53 sequence under the CMV promoter. Promoters Methylation Analysis—Genomic DNA from doxorucibin-treated or untreated cells was extracted using the Easy-DNA™ kit (Invitrogen), diluted in Tris-EDTA and exactly quantified using the PicoGreen® dsDNA Quantification kit (Molecular Probes) in a reduce 200-μl volume assay. Then, 1 μg of each DNA sample was subjected to the restriction enzyme HhaI or BstUI digestion (NEB). Gene-specific primers flanking p53-binding site of Cdc25C and Cdc2 promoter amplified the digested DNAs. Chromatin Immunoprecipitation Assay—HCT116 cells were grown on 150-mm dishes and treated with 1 μm of doxorubicin. After 24 h, proteins were cross-linked with DNA using 1% formaldehyde for 10 min at 37 °C. Cells were washed two times with ice-cold 1× PBS, harvested, and lysed with an SDS lysis buffer (UB) in the presence of a mixture of protease inhibitors (Sigma). The lysates were sonicated to shear DNA to lengths between 200 and 1000 bp. After 10-fold dilution of the sonicated cell supernatants in ChIP dilution buffer (Upstate Biotechnology, UB) containing protease inhibitors. Immunoprecipitations were carried out overnight at 4 °C with mixing by using 2 μg of DNMT1 (NEB), p53 (CST), HDAC1 (CST), H3K9me2 polyclonal (UB), G9a (UB), Sp1 (UB), and control purified rabbit IgG antibodies (Calbiochem) to the extract. 40 μl of protein G-agarose beads pre-adsorbed with salmon sperm DNA were added and incubated for an hour at 4 °C with rotation. The beads were isolated and washed according to UB's manual. DNA-protein complexes were eluted from the beads with a buffer containing 1% SDS and 0.1 m NaHCO3. The cross-links were reversed by incubating the eluates with NaCl (5 m) for 6 h at 65°C. Proteinase K (NEB) was added for 1 h at 45°C, and the DNA was recovered by phenol/chloroform extraction and ethanol precipitation. ChIP DNA was analyzed for the presence of Cdc2 gene promoter sequence by PCR with proximal (forward: 5′-AACTGTGCCAATGCTGGGAG-3′ and reverse: 5′-AGCCAGCTTTGAAGCCAAGT-3′) and distal (forward: 5′-TCCCATTAGGATCAATGCAA-3′ and reverse: 5′-TTTCTGTTTGTTTGCGGAGA-3′) primer sets using PCR of 30 cycles at 94 °C 30 s, 60 °C 30 s, and 72 °C 30 s. Similarly for Cdc25C promoter ChIP analysis PCR was performed with proximal (forward: 5′-GGCTGACACCTTTGTTGTGA-3′ and reverse: 5′-AGGGAGTGTGGGATGAGTTG-3′) and distal (forward: 5′-AGGGTGTGGAGATTGGTGAG-3′ and reverse: 5′-GCGTTGACCATTCAAACCTT-3′) primer sets. Repression of Cdc2 and Cdc25C Promoters Is Mediated by p53 and DNMT1—Endogenous Cdc2 and Cdc25C promoters contain DNA sequences for p53-binding. In the Cdc2 promoter, CCAAT boxes are responsible for p53-mediated repression of the promoter (30Imbriano C. Gurtner A. Cocchiarella F. Di Agostino S. Basile V. Gostissa M. Dobbelstein M. Del Sal G. Piaggio G. Mantovani R. Mol. Cell Biol. 2005; 25: 3737-3751Crossref PubMed Scopus (195) Google Scholar). Whereas in the human Cdc25C promoter a p53-binding site that physically recruits p53 has been identified (31St Clair S. Giono L. Varmeh-Ziaie S. Resnick-Silverman L. Liu W.J. Padi A. Dastidar J. DaCosta A. Mattia M. Manfredi J.J. Mol. Cell. 2004; 16: 725-736Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). Our previous studies demonstrated p53 stabilization after treatment of HCT116 cells with DNA-damaging agent, doxorubicin, resulting in down-regulation of endogenous Cdc25C expression (24Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (144) Google Scholar). A similar down-regulation of endogenous Cdc2 was reported elsewhere (30Imbriano C. Gurtner A. Cocchiarella F. Di Agostino S. Basile V. Gostissa M. Dobbelstein M. Del Sal G. Piaggio G. Mantovani R. Mol. Cell Biol. 2005; 25: 3737-3751Crossref PubMed Scopus (195) Google Scholar). To reconcile these findings and understand the mechanism of gene repression, reporters were constructed with the promoter of either Cdc2 (pcdc2-luc) or Cdc25C (pcdc25C-luc) preceding the luciferase gene. These reporter constructs were used in transfection assays. These constructs contain essentially all of the features of the respective endogenous promoter including Sp1, NF-Y, CDE, and CHR binding sites (Fig. 1A). To investigate whether p53 can repress these promoters, the constructs were cotransfected with an increasing amount of p53 expression construct pcDNAP53 into HCT116 p53-null cells. In the control experiment, backbone pcDNA vector was used instead of pcDNAP53. Both Cdc2 and Cdc25C promoter-mediated luciferase expression were down-regulated in the transfected cells in a dose-dependent manner by pcDNAP53 (Fig. 1, B and C). To determine if DNMTs participate in this down-regulation event, either pcdc2-luc or pcdc25C-luc were transfected into HCT116 cells WT or into DNMT1-null or DNMT1 and DNMT3b-null background. After the transfection, endogenous p53 was induced via doxorubicin treatment. In the WT cells, luciferase expression was down-regulated. Both Cdc2 and Cdc25C promoters were repressed (∼75%) in the presence of p53. However, in DNMT1-null cells or DNMT1 and DNMT3b-null cells luciferase expression was not down-regulated (Fig. 1, D and E), suggesting a direct involvement of both DNMT1 and p53 in Cdc2 and Cdc25C promoter regulation as observed before for the survivin promoter (24Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (144) Google Scholar). A similar derepression of luciferase reporter was observed in p53-null cells (Fig. 1, D and E). This suggests a plausible general mechanism of gene regulation of promoters containing a p53-binding site that are repressed in the presence of p53. DNA Damage-induced Down-regulation of Endogenous Cdc25C and Cdc2 Requires Both Tumor Suppressor p53 and DNA (Cytosine-5) Methyltransferase 1—To evaluate the impact of p53-mediated repression of the endogenous Cdc2 and Cdc25C promoter, wild-type HCT116 cells were treated with doxorubicin and the level of tumor suppressor p53, DNMT1, Cdc2, and Cdc25C were measured at different time intervals (0-, 24-, and 48-h post-treatment) via Western blot analysis. A time-dependent accumulation of the tumor suppressor protein p53 was observed in 24and 48-h post-treatment (Fig. 2A). Correlated with the accumulation of p53 the level of Cdc2 and Cdc25C decreased in the wild-type HCT116 extracts (Fig. 2A). At 48-h post-treatment there was a ∼90% reduction in Cdc2 and Cdc25C protein levels (Fig. 2A, right panels). As a positive control, survivin, another p53-repressed gene, was monitored and was down-regulated under identical conditions. The loading control, actin or PCNA (data not shown) level remained the same in all the different time points indicating consistent loading of extract in each lane. An identical experiment performed side by side with the HCT116 p53-null cells, HCT116 DNMT1-null cells or HCT116 DNMT1 and DNMT3b-null cells resulted in either no changes or a gradual increase with the level of Cdc2 or Cdc25C after doxorubicin treatment (Fig. 2, B–D). The positive control survivin level increased in all the null cell lines validating previously reported up-regulation of survivin (24Esteve P.O. Chin H.G. Pradhan S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1000-1005Crossref PubMed Scopus (144) Google Scholar). The actin level remained the same throughout. A lower time point, between 0 and 24 h, also demonstrated the same effect for survivin, Cdc2, Cdc25C in wild-type HCT116, HCT116 p53-null, and HCT116 DNMT1-null cell lines (data not shown). This argues in favor of the notion that down-regulation of endogenous Cdc2, Cdc25C and survivin is a direct cooperative effect of p53 and DNMT1, and both proteins are needed to be physically present in the cell. The down-regulation was also observed at the RNA level as determined by real time PCR experiments (data not shown). Zebularine-mediated DNMT1 Entrapment Can Disrupt p53-mediated Repression of Cdc2 and Cdc25C—To determine if the derepression of endogenous Cdc2 and Cdc25C promoters is mediated by DNA damage in p53-null cells, DNMT1-null cells or in DNMT1 and DNMT3b-null cells are direct consequence of DNMT1 involvement, we treated the HCT116 cells with zebularine, a mechanistic inhibitor of DNMTs. Zebularine is a nucleotide analogue that can get incorporated to DNA during DNA synthesis and give rise to high affinity complexes with DNA (cytosine-5) methyltransferase (33Zhou L. Cheng X. Connolly B.A. Dickman M.J. Hurd P.J. Hornby D.P. J. Mol. Biol. 2002; 321: 591-599Crossref PubMed Scopus (305) Google Scholar). The incorporation of zebularine into DNA is believed to facilitate DNMT1 entrapment leading to depletion of the enzyme level in the cell, resulting in the demethylation of the genome (34Cheng J.C. Yoo C.B. Weisenberger D.J. Chuang J. Wozniak C. Liang G. Marquez V.E. Greer S. Orntoft T.F. Thykjaer T. Jones P.A. Cancer Cell. 2004; 6: 151-158Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). Initially, to validate the specificity of zebularine, wild-type HCT116 cells were treated with a fixed amount of zebularine and the nuclear and cytoplasmic fractions of the cells were separated, Western-blotted and probed with antibodies specific for human DNMT1, DNMT3a, and DNMT3b (Fig. 3A). In the cytoplasmic fraction either the presence or absence of zebularine did not impact on the quantity of DNMT3a and DNMT3b, because the density of the signal remained consistent between the samples. A small decrease was observed for DNMT3a and DNMT3b in nuclear fraction with zebularine. Thus, in HCT116 cells zebularine treatment displayed only a small percentage of DNMT3a and DNMT3b entrapment. However, in the nuclear fraction of
Referência(s)