Portal de Periódicos da CAPES

p300 is required for MyoD-dependent cell cycle arrest and muscle-specific gene transcription

1997; Springer Nature; Volume: 16; Issue: 2 Linguagem: Inglês

10.1093/emboj/16.2.369

1460-2075

Prem Puri, Maria Laura Avantaggiati, Clara Balsano, Nianli Sang, A. Graessmann, Antonio Giordano, Massimo Levrero,

Virus-based gene therapy research

Article15 January 1997free access p300 is required for MyoD-dependent cell cycle arrest and muscle-specific gene transcription Pier Lorenzo Puri Corresponding Author Pier Lorenzo Puri Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Istituto I Clinica Medica, Policlinico Umberto I, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Search for more papers by this author Maria Laura Avantaggiati Maria Laura Avantaggiati DCBOC/Path, National Cancer Institute, National Institutes of Health, Bethesda, MD, 20892-1500 USA Search for more papers by this author Clara Balsano Clara Balsano Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Dipartimento di Medicina Interna, Università degli Studi di L'Aquila, L'Aquila, Italy Search for more papers by this author Nianli Sang Nianli Sang Sbarro Institute for Cancer Research and Molecular Medicine and Department of Microbiology/Immunology, Thomas Jefferson University, Philadelphia, PA, 19107 USA Search for more papers by this author Adolf Graessmann Adolf Graessmann Institut fur Molekularbiologie und Biochemie der Freien Universitat Berlin, Berlin, 33 Germany Search for more papers by this author Antonio Giordano Antonio Giordano Sbarro Institute for Cancer Research and Molecular Medicine and Department of Microbiology/Immunology, Thomas Jefferson University, Philadelphia, PA, 19107 USA Search for more papers by this author Massimo Levrero Corresponding Author Massimo Levrero Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Istituto di Medicina Interna, Università di Cagliari, 09124 Cagliari, Italy Search for more papers by this author Pier Lorenzo Puri Corresponding Author Pier Lorenzo Puri Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Istituto I Clinica Medica, Policlinico Umberto I, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Search for more papers by this author Maria Laura Avantaggiati Maria Laura Avantaggiati DCBOC/Path, National Cancer Institute, National Institutes of Health, Bethesda, MD, 20892-1500 USA Search for more papers by this author Clara Balsano Clara Balsano Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Dipartimento di Medicina Interna, Università degli Studi di L'Aquila, L'Aquila, Italy Search for more papers by this author Nianli Sang Nianli Sang Sbarro Institute for Cancer Research and Molecular Medicine and Department of Microbiology/Immunology, Thomas Jefferson University, Philadelphia, PA, 19107 USA Search for more papers by this author Adolf Graessmann Adolf Graessmann Institut fur Molekularbiologie und Biochemie der Freien Universitat Berlin, Berlin, 33 Germany Search for more papers by this author Antonio Giordano Antonio Giordano Sbarro Institute for Cancer Research and Molecular Medicine and Department of Microbiology/Immunology, Thomas Jefferson University, Philadelphia, PA, 19107 USA Search for more papers by this author Massimo Levrero Corresponding Author Massimo Levrero Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy Istituto di Medicina Interna, Università di Cagliari, 09124 Cagliari, Italy Search for more papers by this author Author Information Pier Lorenzo Puri 1,2, Maria Laura Avantaggiati3, Clara Balsano1,4, Nianli Sang5, Adolf Graessmann6, Antonio Giordano5 and Massimo Levrero 1,7 1Laboratory of Genetic Expression, Fondazione Andrea Cesalpino, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy 2Istituto I Clinica Medica, Policlinico Umberto I, Università degli Studi di Roma La Sapienza, 00161 Rome, Italy 3DCBOC/Path, National Cancer Institute, National Institutes of Health, Bethesda, MD, 20892-1500 USA 4Dipartimento di Medicina Interna, Università degli Studi di L'Aquila, L'Aquila, Italy 5Sbarro Institute for Cancer Research and Molecular Medicine and Department of Microbiology/Immunology, Thomas Jefferson University, Philadelphia, PA, 19107 USA 6Institut fur Molekularbiologie und Biochemie der Freien Universitat Berlin, Berlin, 33 Germany 7Istituto di Medicina Interna, Università di Cagliari, 09124 Cagliari, Italy The EMBO Journal (1997)16:369-383https://doi.org/10.1093/emboj/16.2.369 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions Figures & Info The nuclear phosphoprotein p300 is a new member of a family of 'co-activators' (which also includes the CREB binding protein CBP), that directly modulate transcription by interacting with components of the basal transcriptional machinery. Both p300 and CBP are targeted by the adenovirus E1A protein, and binding to p300 is required for E1A to inhibit terminal differentiation in both keratinocytes and myoblasts. Here we demonstrate that, in differentiating skeletal muscle cells, p300 physically interacts with the myogenic basic helix–loop–helix (bHLH) regulatory protein MyoD at its DNA binding sites. During muscle differentiation, MyoD plays a dual role: besides activating muscle-specific transcription, it induces permanent cell cycle arrest by up-regulating the cyclin-dependent kinase inhibitor p21. We show that p300 is involved in both these activities. Indeed, E1A mutants lacking the ability to bind p300 are greatly impaired in the repression of E-box-driven transcription, and p300 overexpression rescues the wild-type E1A-mediated repression. Moreover, p300 potentiates MyoD- and myogenin-dependent activation of transcription from E-box-containing reporter genes. We also provide evidence, obtained by microinjection of anti-p300 antibodies, that p300 is required for MyoD-dependent cell cycle arrest in either myogenic cells induced to differentiate or in MyoD-converted C3H10T1/2 fibroblasts, but is dispensable for maintenance of the post-mitotic state of myotubes. Introduction Biochemical and morphological differentiation of muscle cells require a coordinated sequence of events, including arrest in the G0 phase, irreversible exit from the cell cycle and a timely ordered expression of muscle-specific genes. This programme depends on the myogenic regulatory proteins, including the basic helix–loop–helix (bHLH) proteins MyoD, myogenin, Myf5, MRF4 (Lassar and Munsterberg, 1994; Olson and Klein, 1994) and the MADS domain transcription factor MEF2 (Gossett et al., 1989; Yu et al., 1992; reviewed by Olson et al., 1995). As regards MyoD, a dual role during myogenesis has been demonstrated: it induces permanent cell cycle arrest by up-regulating the cyclin-dependent kinase (cdk) inhibitor p21 (Crescenzi et al., 1990; Sorrentino et al., 1990; Guo et al., 1995; Halevy et al., 1995) and activates muscle-specific gene transcription (Weintraub et al., 1991). MyoD transcriptional activity is mediated by binding to a common DNA sequence motif, the E-box, which is present in the regulatory region of many muscle-specific genes (Lassar and Munsterberg, 1994; Olson and Klein, 1994). The viral oncoproteins E1A of adenovirus and large T antigens (TAg) of both SV40 and polyomavirus share the ability to inhibit myogenic differentiation (Fogel and Defendi, 1967; Webster et al., 1988; Braun et al., 1992; Maione et al., 1992; Tedesco et al., 1995). This property has been attributed to their binding to a common region of pRb, p107 and pRb2/p130, called the 'pocket domain'. The pocket proteins participate in the induction and maintenance of the post-mitotic state of differentiated myotubes (Gu et al., 1993; Schneider et al., 1994; Corbeil et al., 1995; Kiess et al., 1995; Shin et al., 1995). They negatively regulate the transcriptional activity of E2F/DP family members (La Thangue, 1994), and pRb has been found to interact directly with MyoD (Gu et al., 1993). However, the ability of E1A to prevent skeletal muscle cell differentiation has been shown to require sequences located at its N-terminus, which in turn bind the nuclear phosphoprotein p300 (Mymryk et al., 1992; Caruso et al., 1993). p300 belongs to a new family of 'co-activators' (which also includes the CREB binding protein CBP) that are able to modulate transcription. Co-activators function as adaptor proteins for complex transcriptional regulatory elements by favouring the communication between certain transcription factors, including CREB, c-Jun, JunB, c-Fos, c-Myb, YY1 and nuclear receptors (Chrivia et al., 1993; Arias et al., 1994; Bannister et al., 1995; Chakravarti et al., 1996; Dai et al., 1996; Kamei et al., 1996; Lee et al., 1996), and components of the basal transcriptional machinery. Indeed, both p300 and CBP have been shown to activate transcription when fused to a DNA binding domain (Chrivia et al., 1993; Arany et al., 1994) and both contain a 'bromodomain', a specialized protein structure present in several proteins implicated as global activators of transcription. The TATA binding protein (TBP)-associated 250 kDa factor (TAFII250/CCG1) is a member of this group (Sekiguchi et al., 1991; Hisatake et al., 1993; Kokubo et al., 1993; Ruppert et al., 1993; Weinzierl et al., 1993). In addition, CBP can interact with the basal transcription factor TFIIB (Kwok et al., 1994) and p300 is found in immune complexes with TBP (Abraham et al., 1993). The protein sequence of p300 and CBP also predicts the presence of three cysteine/histidine-rich regions potentially involved in additional protein–protein interactions (Rikitake and Moran, 1992; Arany et al., 1994, 1995; Eckner et al., 1994; Lundblad et al., 1995). Recently, a p300/CBP-associated factor (P/CAF) with intrinsic histone acetylase activity, which stimulates the transcriptional activity of p300/CBP-bound transcription factors, has been identified (Yang et al., 1996). We have shown previously, by co-immunoprecipitation under low stringency salt conditions and by in vitro binding assays with in vitro synthesized p300 protein and purified bacterial GST–MyoD fusion protein, that p300 is able to bind the myogenic factor MyoD (Yuan et al., 1996). This association occurs through the carboxy-terminal cysteine/histidine-rich domain of p300, which uses its two separate transactivation domains at the amino- and carboxy-terminus to communicate with the components of the basal transcriptional complex (Yuan et al., 1996). Here, we demonstrate that p300–MyoD-containing complexes are recruited at specific MyoD DNA binding sites in differentiating muscle cells. This interaction results in the potentiation of MyoD-dependent transcription of the downstream skeletal muscle-specific genes myogenin and muscle creatine kinase (MCK). In addition, we also show that p300 is required for MyoD-dependent induction of cell cycle arrest in myogenic cells that have been induced to differentiate. Results p300 in differentiating skeletal muscle cells To study p300–MyoD interactions in vivo, we used C2C12 skeletal muscle cells (Yaffé and Saxel, 1977), which represent an amenable model for myogenic differentiation. In high serum [20% fetal calf serum (FCS)], C2C12 myoblasts proliferate until they reach confluence. Full differentiation into multinucleated myotubes is obtained by culturing confluent C2C12 cells in low serum (2% FCS). C2C12 myotubes do not incorporate bromodeoxyuridine (BrdU) and display several muscle-specific markers. Fusion into myotubes is an asynchronous process that starts within a few hours of culture under differentiation conditions (early myotubes) and lasts for up to 96 h (mature myotubes). Cycling C2C12 myoblasts, as well as early and mature myotubes, were labelled with [35S]methionine for 4 h and equal amounts of cell lysate were subjected to immunoprecipitation with either an anti-p300 polyclonal antiserum (Avantaggiati et al., 1996) or a monoclonal anti-E1A antibody. The ability of this anti-p300 antiserum to immunoprecipitate authentic p300 has already been demonstrated by Western analysis and comparative peptide mapping experiments (Avantaggiati et al., 1996). As shown in Figure 1A, lane 1, a 300 kDa protein is precipitated specifically by the p300 antiserum from C2C12 myoblasts; it co-migrates with both the p300 immunoprecipitated from 293 cells with the same anti-p300 antiserum (Figure 1A, lane 4) and the p300 co-immunoprecipitated with E1A from 293 cell extracts using the anti-E1A-specific monoclonal antibody (Figure 1A, lane 6). The pre-immune serum (data not shown) as well as the monoclonal anti-E1A antibody (lane 5) failed to immunoprecipitate p300 from C2C12 cell extracts. Immunofluorescence staining revealed that p300, as expected, has a nuclear localization in C2C12 myoblasts (Figure 1B). Immunoprecipitation and indirect immunofluorescence with anti-p300 antibodies were also performed using C2C12 cells at different times during differentiation. We could not detect any change in either p300 levels or localization (Figure 1A, lanes 2 and 3, and Figure 1C) or p300 electrophoretic mobility (Figure 1A, lanes 1–3). Similar results in immunoprecipitation were obtained using a mouse monoclonal anti-p300 (clone NM11 from Pharmigen) (data not shown). Figure 1.p300 levels in differentiating C2C12 cells. (A) Immunoprecipitation of p300 from either semiconfluent C2C12 cycling myoblasts (20% FCS–containing medium) (lane 1) or from both early C2C12 myotubes (18 h in 2% FCS differentiation medium, DM) (lane 2) and mature C2C12 myotubes (72 h in 2% FCS DM) (lane 3), using a polyclonal anti-p300 antiserum. In lane 4, p300 was immunoprecipitated from 293 cells using the same polyclonal antibody. As a control, extracts from early C2C12 myotubes and 293 cells were immunoprecipitated with a monoclonal anti-E1A antibody (Oncogene Science) (lanes 5 and 6). As expected, p300 was co-immunoprecipitated by anti-E1A from 293 cells but not from C2C12 cells. Metabolic labelling, cell extract preparation and immunoprecipitation were performed as described in Materials and methods. (B) and (C) p300 immunofluorescence staining of C2C12 cells. Non-confluent cycling C2C12 cells growing in high serum (20% FCS) (B) and myotubes (C) were incubated with a polyclonal anti-p300 antiserum, followed by rhodamine-conjugated secondary antibody staining. Download figure Download PowerPoint p300–MyoD interaction occurs at the specific MyoD DNA target sequences We have shown previously that p300 and MyoD can be co-immunoprecipitated under low stringency salt conditions from C2C12 myoblasts and we confirmed their direct interaction by in vitro binding assays using in vitro translated p300 protein and purified bacterial GST–MyoD fusion protein (Yuan et al., 1996). However, if the MyoD–p300 interaction plays an important role during muscle differentiation and in view of the putative role of p300 as a transcriptional co-activator, one should expect p300–MyoD complexes to be present on the specific MyoD DNA target sequences. To test this hypothesis, electrophoretic mobility shift assay (EMSA) experiments were performed using 32P-labelled E-box binding sites. C2C12 cells cultured in differentiation medium display increasing levels of E-box DNA binding activity (Figure 2A, lanes 1–3). The binding specificity of this complex was confirmed by competition experiments with excess unlabelled wild-type and mutant E-box-specific oligonucleotides (Figure 2A, lanes 5 and 6). All the myogenic bHLH transcription factors bind these E-box sites together with the products of the E2A gene, E12 and E47, as heterodimers (Weintraub, 1993). Indeed, this E-box activity in C2C12 myotube extracts was supershifted specifically by antibodies directed against the bHLH proteins MyoD and myogenin (Figure 2B, lanes 6 and 7), as well as by anti-E12 antibodies (data not shown). In addition, our polyclonal anti-p300 antiserum (Figure 2B, lane 5) and the anti-p300 monoclonal antibody NM11 (data not shown) both partially supershifted this activity, demonstrating that p300 is part of this complex. The specificity of this supershift was confirmed using either the corresponding anti-p300 pre-immune antiserum (Figure 2B, lane 4) or by adding the antibodies to the probe directly in the absence of C2C12 cell extracts, which does not result in a detectable band (data not shown). Since p300 and CBP are both targeted by E1A (Arany et al., 1995; Lundblad et al., 1995) and share several partner proteins, including CREB and c-Jun (Arias et al., 1994; Arany et al., 1995; Lee et al., 1995; Lundblad et al., 1995), the presence of CBP in E-box DNA binding activity was tested. Using a specific anti-CBP antibody, we were unable to show any supershift of the E-box-bound complexes (Figure 2B). To confirm further the presence of MyoD–p300 complexes at the E-box sites, biotinylated oligonucleotides, containing the E-box consensus sequence, were also used to affinity purify E-box-bound complexes from C2C12 cells at different stages of differentiation. A band of the expected size of 300 kDa was detected using 35S-metabolically labelled extracts from early and mature C2C12 myotubes but not from C2C12 myoblasts (Figure 2C). To confirm the efficiency of the affinity purification procedure, we subjected both the biotinylated oligonucleotide-bound material and the corresponding supernatants to E-box EMSA (Figure 2D). Further, the presence of p300 in the E-box DNA-bound complexes was confirmed by immunoblotting with either our polyclonal anti-p300 antiserum (Figure 2E, lane 2) or a monoclonal anti-p300 antibody (Figure 2E, lane 8). No CBP reactivity was detected by immunoblot in the purified E-box-bound complexes (data not shown). Taken together, these results clearly demonstrate that p300 interaction with MyoD (and possibly other myogenic bHLH transcription factors) occurs at E-box sites in differentiating muscle cells. Moreover, although it cannot be excluded that CBP–MyoD complexes, not bound to the MyoD DNA sites or bound to complex promoter elements, might be present in either myoblasts or differentiated myotubes, our results strongly suggest that p300 and not CBP is the preferential partner of MyoD at its DNA binding sites. Figure 2.p300 localizes at E-box MyoD DNA binding sites. (A) E-box DNA binding activity in C2C12 cells during the cell cycle and differentiation. Extracts from semiconfluent C2C12 myoblasts (lane 1), from C2C12 early myotubes (cultured for 18 h in DM) (lane 2), and from mature C2C12 myotubes (cultured for 3 days in DM) (lane 3) were performed as described elsewhere (Gu et al., 1993). Competition experiments were performed by adding a 100- to 200-fold molar excess of either wild-type (wt) (5′CCCCAACACCTGCTGCCTGA3′) or mutant (5′CCCCAACACGGTAAC- CCTGA3′) (mt) unlabelled E-box oligonucleotides (lanes 5 and 6, respectively). (B) Antibody supershift EMSAs of E-box complexes. A specific supershift was obtained with antibodies directed against the bHLH proteins MyoD (lane 6) and myogenin (lane 7), as well as with the anti-p300 polyclonal antibody (lane 5) but not with its pre-immune serum (lane 4) or a specific non-cross-reactive monoclonal antibody directed against the related transcriptional co-activator CBP (lane 3). (C) E-box-bound complexes were affinity purified from [35S]methionine-labelled C2C12 myoblasts (lane 1), early C2C12 myotubes (lane 2) and mature myotubes (lane 3), using biotinylated double-stranded oligonucleotides containing the E-box consensus sequence (5′-biot-5′CCCCAACACCTGCTGCCTGA3′). E-box-bound proteins were resolved on a 7.5% SDS–PAGE. (D) The affinity purification of E-box-bound complexes using the biotinylated E-box oligonucleotides was confirmed by EMSA. In the figure, Sup. is supernatant and Prec. are precipitated proteins after affinity purification. (E) Immunoblot with anti-p300 polyclonal antibody following affinity purification of E-box-bound proteins with biotinylated oligonucleotides from C2C12 early myotube (lane 2), C2C12 myoblast (lane 4) and 293 cell (lane 6) extracts. In lane 8, the immunoblot on the E-box-bound proteins from C2C12 early myotubes was performed using anti-p300 monoclonal antibody NM11. E-box mutant biotinylated oligonucleotides were used as controls to prepare similar samples run in lanes 1, 3, 5 and 7. Download figure Download PowerPoint p300 potentiates MyoD-dependent activation of transcription MyoD is involved in both the induction of permanent cell cycle arrest, which is required for terminal muscle differentiation, and in the activation of muscle-specific genes (Crescenzi et al., 1990; Sorrentino et al., 1990; Weintraub et al., 1991). Therefore, to assess the biological significance of the MyoD–p300 interaction, we next tested the ability of p300 to enhance the myogenic properties of MyoD. The role of p300 in MyoD-dependent activation of transcription was first studied using the synthetic E-box-containing CAT reporter plasmid p4R-tk-CAT. Since all the MyoD family bHLH proteins activate the E-box enhancer and, under the conditions of muscle differentiation, MyoD induces the expression of the other myogenic transcription factors in a variety of non-muscle cells (Weintraub, 1993), we used the Saos human osteosarcoma cell line, which is refractory to myogenic conversion by ectopic expression of muscle-specific bHLH transcription factors (Gu et al., 1993). By doing so, it is possible to distinguish between the E-box activity mediated by MyoD and that mediated by other bHLH and MEF2 transactivators. In both human osteosarcoma Saos (Figure 3A) and U2-OS (data not shown) cells, the basal E-box reporter activity is almost undetectable (data not shown) and it is activated efficiently by MyoD expression (Figure 3A). Wild-type E1A 12S represses the MyoD-dependent E-box activity in a dose-dependent manner, while the E1A N-terminal deletion mutant dl2-36, which is defective for p300 binding but not for binding to the Rb family proteins (Giordano et al., 1991), is much less active in transrepression (Figure 3A). Co-transfection of the p300 expression vector pCMV-βp300 overrides the E1A 12S repression of the MyoD-dependent transcription and potentiates the MyoD-mediated transactivation (Figure 3A). This observation clearly supports the hypothesis that p300 plays an important role in MyoD-dependent activation of transcription during muscle differentiation. Indeed, co-transfection of a plasmid encoding the 1514–1922 p300 mutant, which is still able to bind MyoD but has no transcriptional activity (Yuan et al., 1996), inhibits MyoD-dependent E-box activity on this promoter (data not shown). Since we found that p300 is also effective in potentiating the E-box-dependent activity of myogenin on the same p4R-tk-CAT reporter (Figure 3A), it is likely that p300 also functions as co-activator for bHLH transcription factors other than MyoD. An elevated grade of redundancy has been demonstrated in the myogenic potential of the four bHLH proteins of the MyoD family (Weintraub, 1993; Olson and Klein, 1994), and each family member can activate the programme for skeletal muscle differentiation when introduced into a variety of non-muscle cells (Davis et al., 1987; Hollemberg et al., 1993; Lassar and Mustemberg, 1994; Olson and Klein, 1994). In both skeletal muscle cells and in myogenic converted non-muscle cells, myogenin is a downstream effector of MyoD (Hollemberg et al., 1993; Weintraub, 1993; Olson and Klein, 1994). More recently, MEF2 proteins have been shown to synergize with both MyoD and myogenin in the myogenic conversion of C3H10T1/2 fibroblasts and, for the MEF2C member of the MEF2 family, a direct interaction with myogenin has also been described (Molkentin et al., 1995). We used C3H10T1/2 fibroblasts to evaluate the ability of p300 to potentiate MyoD transcriptional activation of the myogenin promoter. The pMyo84 CAT reporter plasmid contains both an E-box site at position −15 to −10, downstream of the TATA box, and a MEF2 site at position −66 to −58. The latter site has been shown to be essential for myogenin transcription both in cultured cells and in vivo in the mouse embryo (Edmonson et al., 1992; Yee and Rigby, 1993). As shown in Figure 3B, the ability of MyoD to activate the pMyo84 CAT construct is stimulated >3-fold by co-transfection with the p300 expression vector. The ability of microinjected anti-p300 antibodies to suppress MyoD-dependent induction of myogenin expression in C3H10T1/2 cells (data not shown) further confirms the role of p300 in the activation of muscle-specific genes. When the MEF2 site is mutated in the pMyo84mutMEF2 reporter plasmid, activation by MyoD alone is reduced by a factor of two but the synergistic effect of p300 on MyoD-dependent activation is only slightly reduced. Although optimal induction of transcription by myogenic bHLH proteins requires multiple E-box/MEF2 sites (Molkentin et al., 1995), p300 also cooperates with MyoD in inducing transcription from promoters containing only one E-box site (i.e. the pMyo84mutMEF2 promoter, herein described, and the human cardiac α-actin promoter; V.Sartorelli, personal communication). This observation is also supported by the presence of p300 in protein complexes bound to one (Figure 2B) as well as to multiple (data not shown) E&-box sites. Deletion of the E-box site in the pMyo84mutMEF2-E1 reporter completely abolishes p300 activity, thus confirming that p300 indeed acts as a co-activator of E-box-dependent MyoD transcriptional activity on the myogenin promoter. Surprisingly, we also found a synergistic effect of p300 on MyoD-dependent activation on the pMyo84mutE1 reporter, which only contains one MEF2 site. This would imply that p300 may also cooperate with member(s) of the MEF2 family, induced by MyoD during myogenic conversion/differentiation, either directly or via the interaction with myogenic bHLH proteins (Molkentin et al., 1995). Indeed, both physical interaction and functional synergism between MEF2c and p300 was observed recently by Sartorelli et al. (personal communication). We also co-transfected C3H10T1/2 cells with the MCK CAT reporter plasmid pMCK1256, which contains the MCK regulatory sequences from −1256 to +7 upstream from the CAT gene, together with MyoD, myogenin (data not shown) and p300 expression vectors, either alone or in combination. Figure 3C shows that p300 potentiates both MyoD and myogenin activation of transcription from the MCK promoter. Taken together, these results support the thesis that p300 acts as co-factor for MyoD and other myogenic transcription factors in mediating biochemical muscle differentiation. Figure 3.p300 enhances E-box-dependent MyoD-induced transcriptional activation of the myogenin and MCK regulatory sequences. (A) MyoD and myogenin activity on E-box-driven transcription requires p300. Saos human osteosarcoma cells were co-transfected with 4 μg of the E-box CAT reporter p4R-tk-CAT and 2 μg of either the pCMV-MyoD expression vector (Yuan et al., 1996) or the pEMSV-myogenin (a gift from F.Tatò). Co-transfection of increasing amounts of CMV wild-type E1A 12S expression vector (pE1A12S) blocks MyoD-dependent transcription, whilst the E1A deletion mutant lacking the N-terminal amino acids 2–36 (pE1A12Sdl2-36) is ineffective. Co-transfection of the p300 expression vector pCMV-βp300 (Eckner et al., 1994) rescues the MyoD-dependent transcription in the presence of pE1A 12S and enhances both the MyoD- and myogenin-mediated transactivation. Co-transfection of a plasmid encoding the 1514–1922 p300 mutant, which is still able to bind MyoD but has no transcriptional activity, inhibits MyoD-dependent E-box activity on this promoter. (B) C3H10T1/2 fibroblasts were co-transfected with 2.5 μg of different myogenin–CAT reporter plasmids and increasing amounts of the MyoD expression vector pCMV-MyoD (Yuan et al., 1996), in the presence or absence of 5 μg of pCMV-βp300. pMyo84 contains the myogenin promoter from nucleotide −84 upstream from the CAT gene. pMyo84mutMEF2 and pMyo84mut-E1 are mutated in the MEF2 or the E-box site, respectively. pMyo84mutMEF2-E1 is mutated in both the MEF2 and the E-box sites. (C) C3H10T1/2 fibroblasts were co-transfected with 2.5 μg of the MCK CAT reporter plasmid pMCK1256 (containing the MCK regulatory sequences from −1256 to +7 upstream from the CAT gene) and various combinations of pCMV-MyoD and pCMV-βp300, as indicated. At 48 h after transfection, cells were harvested and then assayed for reporter gene expression. Download figure Download PowerPoint p300 and cell cycle arrest in differentiating skeletal myocytes Cell proliferation and differentiation are usually mutually exclusive. Cell cycle withdrawal is a prerequisite for myoblast differentiation, representing an early event in terminal differentiation (Weintraub, 1993; Olson and Klein, 1994). Terminal differentiation in cultured myoblasts requires both serum deprivation and activation of the bHLH factors. C2C12 cells are prevented from cell cycle withdrawal and phenotypic differentiation by high concentrations of mitogens in the medium. Mitogens appear to block terminal differentiation by promoting the expression of Id, a dominant negative HLH factor that inhibits the binding of the myogenic bHLHs to their DNA target sequences. Once myotubes are formed, cells become unresponsive to further mitogen stimulation and are unable to re-enter the cell cycle. The mechanisms involved in the maintenance of terminal cell cycle arrest in myotubes under conditions of mitogen stimulation remain a matter for discussion. A role in this process has been attributed to pRb and, indeed, cultures of myotubes from Rb-deficient mice maintain the