Selective Interaction of AGS3 with G-proteins and the Influence of AGS3 on the Activation State of G-proteins
2001; Elsevier BV; Volume: 276; Issue: 2 Linguagem: Inglês
10.1074/jbc.m005291200
ISSN1083-351X
AutoresMichael L. Bernard, Yuri K. Peterson, Peter Chung, Jane Jourdan, Stephen M. Lanier,
Tópico(s)Glycosylation and Glycoproteins Research
ResumoAGS3 (activator ofG-protein signaling 3) was isolated in a yeast-based functional screen for receptor-independent activators of heterotrimeric G-proteins. As an initial approach to define the role of AGS3 in mammalian signal processing, we defined the AGS3 subdomains involved in G-protein interaction, its selectivity for G-proteins, and its influence on the activation state of G-protein. Immunoblot analysis with AGS3 antisera indicated expression in rat brain, the neuronal-like cell lines PC12 and NG108-15, as well as the smooth muscle cell line DDT1-MF2. Immunofluorescence studies and confocal imaging indicated that AGS3 was predominantly cytoplasmic and enriched in microdomains of the cell. AGS3 coimmunoprecipitated with Gαi3 from cell and tissue lysates, indicating that a subpopulation of AGS3 and Gαi exist as a complex in the cell. The coimmunoprecipitation of AGS3 and Gαi was dependent upon the conformation of Gαi3 (GDP ≫ GTPγS (guanosine 5′-3-O-(thio)triphosphate)). The regions of AGS3 that bound Gαi were localized to four amino acid repeats (G-protein regulatory motif (GPR)) in the carboxyl terminus (Pro463–Ser650), each of which were capable of binding Gαi. AGS3-GPR domains selectively interacted with Gαi in tissue and cell lysates and with purified Gαi/Gαt. Subsequent experiments with purified Gαi2 and Gαi3 indicated that the carboxyl-terminal region containing the four GPR motifs actually bound more than one Gαi subunit at the same time. The AGS3-GPR domains effectively competed with Gβγ for binding to Gαt(GDP) and blocked GTPγS binding to Gαi1. AGS3 and related proteins provide unexpected mechanisms for coordination of G-protein signaling pathways. AGS3 (activator ofG-protein signaling 3) was isolated in a yeast-based functional screen for receptor-independent activators of heterotrimeric G-proteins. As an initial approach to define the role of AGS3 in mammalian signal processing, we defined the AGS3 subdomains involved in G-protein interaction, its selectivity for G-proteins, and its influence on the activation state of G-protein. Immunoblot analysis with AGS3 antisera indicated expression in rat brain, the neuronal-like cell lines PC12 and NG108-15, as well as the smooth muscle cell line DDT1-MF2. Immunofluorescence studies and confocal imaging indicated that AGS3 was predominantly cytoplasmic and enriched in microdomains of the cell. AGS3 coimmunoprecipitated with Gαi3 from cell and tissue lysates, indicating that a subpopulation of AGS3 and Gαi exist as a complex in the cell. The coimmunoprecipitation of AGS3 and Gαi was dependent upon the conformation of Gαi3 (GDP ≫ GTPγS (guanosine 5′-3-O-(thio)triphosphate)). The regions of AGS3 that bound Gαi were localized to four amino acid repeats (G-protein regulatory motif (GPR)) in the carboxyl terminus (Pro463–Ser650), each of which were capable of binding Gαi. AGS3-GPR domains selectively interacted with Gαi in tissue and cell lysates and with purified Gαi/Gαt. Subsequent experiments with purified Gαi2 and Gαi3 indicated that the carboxyl-terminal region containing the four GPR motifs actually bound more than one Gαi subunit at the same time. The AGS3-GPR domains effectively competed with Gβγ for binding to Gαt(GDP) and blocked GTPγS binding to Gαi1. AGS3 and related proteins provide unexpected mechanisms for coordination of G-protein signaling pathways. activator of G-protein signaling tetratricopeptide repeat motif G-protein regulatory motif Partner of Inscuteable cell washing solution glutathione S-transferase Chinese hamster ovary guanosine 5′-3-O-(thio)triphosphate Signal processing via heterotrimeric G-protein proteins generally involves an initial input sensed by a cell surface receptor with seven membrane-spanning regions. Conformational changes in receptor subdomains then transfer this signal to a G-protein, promoting exchange of GTP for GDP and subunit dissociation with both the Gα and Gβγ subunits regulating effector molecules. These events are tightly regulated to maximize signal efficiency, optimize signal specificity, and integrate cellular responses to diverse stimuli. Regulatory mechanisms include the segregation of specific signaling molecules in cell microdomains, receptor phosphorylation and internalization, cross-talk between signaling pathways, and proteins that regulate the basal activation state of G-proteins independently of the receptor. We partially purified a direct G-protein activator from NG108-15 cells (1Sato M. Kataoka R. Dingus J. Wilcox M. Hildebrandt J. Lanier S.M. J. Biol. Chem. 1995; 270: 15269-15276Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 2Sato M. Ribas C. Hildebrandt J.D. Lanier S.M. J. Biol. Chem. 1996; 271: 30052-30060Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) and subsequently used a functional screen to identify three proteins (AGS1–3, for activator of G-protein signaling 1–3) that activated heterotrimeric G-protein signaling in the absence of a cell surface receptor (3Cismowski M. Takesono A. Ma C. Lizano J.S. Xie S. Fuernkranz H. Lanier S.M. Duzic E. Nat. Biotech. 1999; 17: 878-883Crossref PubMed Scopus (159) Google Scholar, 4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar, 5Cismowski M. Ma C. Ribas C. Xie X. Spruyt M. Lizano J.S. Lanier S.M. Duzic E. J. Biol. Chem. 2000; 275: 23421-23424Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). The identification of such proteins raises many interesting and unexpected questions relative to signal processing by heterotrimeric G-proteins. As an initial approach to address these issues, we focused on the biochemical and functional characterization of AGS1 proteins, and this report deals specifically with AGS3 (AF107723, calculated molecular weight 72,049). AGS3, isolated from a rat brain cDNA library, contains seven tetratricopeptide repeats (TPRs) and four GPR (G-protein-regulatory) motifs separated by a linker in the middle of the protein (4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar) 2The GPR motif was also termed the GoLoco motif (6Siderovski D.P. Diverse-Pierlussi M.A. De Vries L. Trends Biochem. Sci. 1999; 24: 340-341Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar). (Fig.1). AGS3 is one member of a larger protein family defined by a two-domain structure (Fig. 1). In rodents and humans, this family is defined by rat AGS3 and human LGN (U54999), which was isolated in a yeast two-hybrid screen using Gαi2 as bait (8Mochizuki N. Cho G. Wen B. Insel P.A. Gene (Amst.). 1996; 181: 39-43Crossref PubMed Scopus (97) Google Scholar). A single AGS3-related protein is found in Caenorhabditis elegans (AAA81387) and Drosophila melanogaster (AF36967). Analysis of genome and expressed sequence tag data bases indicated that in addition to human LGN cDNAs, there are partial human cDNAs exhibiting higher homology to AGS3 versus LGN (e.g. AL117478 (360 amino acids), 95% sequence similarity to AGS3 and 57% sequence similarity to LGN;AI272212 (190 amino acids), 93% sequence similarity to AGS3 and 57% sequence similarity to LGN). Likewise, analysis of mouse/rat genome and expressed sequence tag data bases indicate that in addition to AGS3 cDNAs (e.g. L23316) there are mouse cDNAs (e.g. AA543923, AA166402, and AW539573) exhibiting higher sequence homology to human LGN versus AGS3. Thus, AGS3 and LGN are distinct proteins, and perhaps there are additional related proteins in the primate genome yet to be identified. The first insight as to the functional role of LGN and AGS3 in signal processing was their identification as a Gαi-binding protein (8Mochizuki N. Cho G. Wen B. Insel P.A. Gene (Amst.). 1996; 181: 39-43Crossref PubMed Scopus (97) Google Scholar) and isolation as a receptor-independent G-protein activator (4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar), respectively. Additional insight was provided by recent studies in D. melanogaster, where the AGS3/LGN homolog PINS (Partner of Inscuteable) is required for events involved in the asymmetric cell division of neuroblasts in the early stages of development (9Yu F.W. Morin X. Cai Y. Yang X.H. Chia W. Cell. 2000; 100: 399-409Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 10Schaefer M. Schevchenko A. Schevchenko A. Knoblich J.A. Curr. Biol. 2000; 10: 353-362Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). PINS is part of a multiprotein complex that is translocated from the cytosol to one pole of the dividing neuroblast. In this article, we report the existence of an AGS3-Gαi complex within the cell, define the Gα-interacting domains of AGS3, and determine the selectivity of AGS3 for different Gα subunits. AGS3, which preferentially binds to GαGDP, can bind multiple Gα subunits and hence may function as a scaffolding protein to provide spatially and temporally discrete signaling events. AGS3 and Gβγ actually competed with each other for interaction with Gαt(GDP), and AGS3 inhibited guanine nucleotide exchange on Gαi1. The properties of the AGS3-Gα interactions add unexpected dimensions to signal processing by G-protein-regulated signaling systems. [35S]GTPγS (1250 Ci/mmol) was purchased from PerkinElmer Life Sciences. Tissue culture supplies were obtained from JRH Bioscience (Lenexa, KS). Acrylamide, bisacrylamide, Bio-Rad protein assay kits, and sodium dodecyl sulfate were purchased from Bio-Rad. Ecoscint A was purchased from National Diagnostics (Manville, NJ). Guanosine diphosphate, guanosine triphosphate, and Thesit (polyoxyethylene-9-lauryl ether) were obtained from Rche Molecular Biochemicals. Polyvinylidene difluoride membranes were obtained from Pall Gelman Sciences (Ann Arbor, MI). Gammabind G-Sepharose was obtained from Amersham Pharmacia Biotech, and nitrocellulose BA85 filters were purchased from Schleicher & Schuell. Poly-l-lysine. normal goat serum, biotinylated goat anti-rabbit IgG, and Extravidin fluorescein isothiocyanate were purchased from Sigma. Immuno Fluore mounting medium was purchased from ICN Biomedicals. Purified bovine brain G-protein and antisera to the COOH-terminal 10 amino acids of Gβ1, which recognizes Gβ1–4, were kindly provided by Dr. John Hildebrandt (Department of Pharmacology, Medical University of South Carolina, Charleston, SC) (11Dingus J. Wilcox M.D. Kohnken R. Hildebrandt J.D. Methods Enzymol. 1994; 237: 457-471Crossref PubMed Scopus (29) Google Scholar, 12Makhlouf M. Ashton S.H. Hildebrandt J.D. Mehta N. Gettys T.W. Halushka P.V. Cook J.A. Biochim. Biophys. Acta. 1996; 1312: 163-168Crossref PubMed Scopus (33) Google Scholar). Gαi1–3 and Gαo were purified from Sf9 insect cells infected with recombinant virus as described (13Graber S.G. Figler R.A. Garrison J.C. J. Biol. Chem. 1992; 267: 1271-1278Abstract Full Text PDF PubMed Google Scholar) and kindly provided by Dr. Stephen Graber (West Virginia University School of Medicine, Morgantown, WV). Gαs and Gαq, similarly expressed in Sf9 insect cells, were kindly provided by Dr. Elliott Ross (University of Texas Southwestern Medical Center, Dallas, TX) (14Biddlecome G.H. Berstein G. Ross E.M. J. Biol. Chem. 1996; 271: 7999-8007Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar). Purified Gαt and Gαβγt (15Lambright D.G. Sondek J. Bohm A. Skiba N.P. Hamm H.E. Sigler P.B. Nature. 1996; 379: 311-319Crossref PubMed Scopus (1051) Google Scholar) were kindly provided by Dr. Heidi Hamm (Northwestern University Medical School, Chicago, IL). Polyclonal Gαi3 antisera generated against the COOH-terminal 10 amino acids was kindly provided by Dr. Thomas W. Gettys (Department of Medicine, Medical University of South Carolina, Charleston, SC) (16Gettys T.W. Fields T.A. Raymond J.R. Biochemistry. 1994; 33: 4283-4290Crossref PubMed Scopus (99) Google Scholar). Purified GA antibody, which selectively recognizes Gi/Gαo, was kindly provided by Drs. Paul Goldsmith, Andrew Shenkar, and Allen Spiegel (17Goldsmith P. Rossiter K. Carter A. Simonds W. Unson C.G. Vinitsky R. Spiegel A. J. Biol. Chem. 1988; 263: 6476-6479Abstract Full Text PDF PubMed Google Scholar). All other materials were obtained as described elsewhere (4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar, 18Wu G. Hildebrandt J. Benovic J.L. Lanier S.M. J. Biol. Chem. 1998; 273: 7197-7200Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). AGS3 subdomains were generated as glutathione fusion proteins by polymerase chain reaction using the full-length cDNA of AGS3 as a template. Primers were designed to add BamHI and EcoRI sites to the 5′ and 3′ ends, respectively, of AGS3 subdomains to fuse the AGS3 open reading frame with the reading frame of glutathione S-transferase contained in the pGEX4T1 vector. The polymerase chain reactions were generally performed using 250 nm primers and 125 pm template DNA in a total volume of 50 μl. Cycles were 1 × 3 min at 94 °C; 30 × 1.5 min at 94 °C, 1 min at 60 °C, and 2 min at 72 °C; and 1 × 10 min at 72 °C. Primers used to generate specific constructs were as follows. TPR(Met1–Ile462)5′GGGGATCCATGGAGGCCTCCTGTCTGG3′GCGATTTCTCAGATACCCGTGCGAGGCACCTGGPR(Pro463–Ser650)5′CGGGATCCACCATGGCCCCGTCCTCT3′GGGAATTCTTAGCTGGCACCTGGCGGACAGPRI(Pro463–Glu501)5′CGGGATCCACCATGGCCCCGTCCTCT3′CGGAATTCTTACTCAGCAGCCCCAGCCTGGPRII(Ser516–Leu555)5′CGGGATCCTCTGTAACAGCTTCACCA3′CGGAATTCTTAGAGGGTGATGCGAAGCCCGPRIII(Gly563–Thr602)5′CGGGATCCGGCGACGGGGACCCCCAG3′CGGAATTCTTAGGTGGGGCCTCGGGGCAGGPRIV(Thr602–Ser650)5′CGGGATCCACCATGCCTGATGAGGATTTC3′GGGAATTCTTAGCTGGCACCTGGCGGACASEQUENCES1–6 NG108-15, PC12, and DDT1-MF2 cells were grown as described previously (1Sato M. Kataoka R. Dingus J. Wilcox M. Hildebrandt J. Lanier S.M. J. Biol. Chem. 1995; 270: 15269-15276Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 2Sato M. Ribas C. Hildebrandt J.D. Lanier S.M. J. Biol. Chem. 1996; 271: 30052-30060Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Caco-2 cells were obtained from the American Type Culture Collection and cultured in Eagle's minimum essential medium supplemented with 1% minimum essential medium nonessential amino acids. CHO cells were grown on Falcon tissue culture dishes at 37 °C (5% CO2) in Ham's F-12 medium supplemented with 10% fetal bovine serum plus penicillin (100 units/ml), streptomycin (100 μg/ml), and fungizone (0.25 μg/ml) (19Wu G. Bogatkevich G.S. Mukhin Y. Benovic J. Hildebrandt J. Lanier S.M. J. Biol. Chem. 2000; 275: 9026-9034Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Rat brain was homogenized in 3 ml of buffer/g of tissue of lysis buffer (50 mm Tris, pH 8.0, 150 mm NaCl, 5 mm EDTA, 1% Nonidet P-40). Confluent 100-mm dishes of cells were washed with cell washing solution (137 mm NaCl, 2.6 mm KCl, 1.8 mmKH2PO4, 10 mmNa2HPO4) and resuspended in 1 ml of lysis buffer/dish by homogenization. Following a 1-h incubation on ice at 4 °C, the cell homogenate was centrifuged at 27,000 ×g for 30 min. Supernatants were collected and spun at 100,000 × g for 1 h to generate a detergent-soluble fraction. The supernatant was immediately processed for immunoblotting or immunoprecipitation. In some experiments, cells and tissue were also fractionated to generate a crude membrane pellet and a 100,000 × g supernatant containing cytosol. Tissues were homogenized in 5 mm Tris, 5 mmEDTA, 5 mm EGTA, pH 7.4, and centrifuged at 100,000 ×g for 30 min at 4 °C and washed at least three times by homogenization in membrane buffer. For preparation of cell homogenates, 12 confluent 100-mm dishes were lysed in 3 ml of 5 mm Tris, 5 mm EDTA, 5 mm EGTA, pH 7.4, and centrifuged at 100,000 × g for 30 min at 4 °C. Cell membrane pellets were washed three times with intervening homogenization and pelleting at 100,000 × g. The washed membrane pellets were resuspended in 250 μl of membrane buffer (50 mmTris, 0.6 mm EDTA, 5 mm MgCl2, pH 7.4) by homogenization. Protein concentrations were determined by a Bio-Rad protein assay. The interaction of AGS3 with G-proteins was assessed by both coimmunoprecipitation and protein interaction experiments using tissue/cell lysates or purified G-proteins. Protein concentrations in the lysates were determined by a Bio-Rad protein assay. For immunoprecipitation from mammalian cells, cell/tissue lysates (1–3 mg of protein in 0.5–1 ml) were pre-cleared by rotating incubation with Gammabind G-Sepharose (12.5 μl of packed resin equilibrated in lysis buffer) for 30 min at 4 °C. Following centrifugation, Gαi3 antisera (1:250 dilution) was added to pre-cleared lysates and incubation continued overnight at 4 °C. Protein complexes were captured by adding Gammabind G-Sepharose (12.5 μl packed volume) and continuing the incubation for 30 min at 4 °C. The mixture was then microcentrifuged at 4 °C and the pellets washed (3× 500 μl of incubation buffer) and resuspended in 2× Laemmli buffer. Resuspended samples were placed in a boiling water bath for 5 min and microcentrifuged for 10 min prior to loading on denaturing 10% polyacrylamide gels. Proteins were transferred to polyvinylidene difluoride membranes for immunoblotting. For analysis of the interaction of AGS3-GPR with multiple G-protein subunits, Gαi2 (200 nm) was incubated with Gαi3 (50 nm) in the presence or absence of the AGS3-GPR GST fusion protein (250 nm) in 250 μl of buffer A (20 mm Tris, pH 7.5, 70 mm NaCl, 1 mm dithiothreitol, 0.6 mm EDTA, 0.01% Thesit) for 1 h at 4 °C. Gαi3 antisera (1: 500) was added, and the incubation was continued for 3 h at 4 °C. Protein complexes were isolated and evaluated by immunoblotting as described above. Protein interaction assays using purified G-protein subunits were conducted as described previously (4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar, 18Wu G. Hildebrandt J. Benovic J.L. Lanier S.M. J. Biol. Chem. 1998; 273: 7197-7200Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). All purified G-proteins used in these studies were isolated in the GDP-bound form. Unless indicated otherwise, all G-protein interaction assays contained 10 μm GDP. The AGS3-GST fusion proteins were expressed in and purified from bacteria using a glutathione affinity matrix. The AGS3-GST fusion proteins were eluted from the matrix with glutathione and desalted by centrifugation (Centricon YM-3; Millipore, Bedford, MA). For interaction assays with cell/tissue lysates, the AGS3-GST fusion protein (100–300 nm) was incubated with purified G-protein (50–100 nm) or cell/tissue lysate (∼4 mg of protein/ml) for 1 h at 24 °C in a total volume of 250 μl. 12.5 μl of packed glutathione-Sepharose slurry was added and the mixture rotated at 4 °C for 20 min, after which the affinity matrix was pelleted and washed three times with 500 μl of incubation buffer. Proteins retained on the matrix were solubilized in 2× Laemmli loading buffer and separated by electrophoresis on denaturing 10% polyacrylamide gels. Proteins were transferred to polyvinylidene difluoride membranes for immunoblotting. Each blot was checked by Amido Black staining to verify equal loading of fusion proteins. DDT1-MF2 control cells and DDT1-MF2 cells stably transfected with AGS3 were plated onto coverslips (18-mm round no. 1) precoated with 0.01% polylysine and allowed to grow to 60% confluence. Coverslips were then rinsed with 3 × 2 ml of cell washing solution (CWS) (137 mmNaCl, 2.6 mm KCl, 1.8 mmKH2PO4, 10 mmNa2HPO4) and fixed in 4% paraformaldehyde for 10 min, followed by two 5-min incubations in CWS containing 0.1m glycine (3 ml/coverslip). Coverslips were then incubated in 0.01% Triton X-100 for 10 min, followed by three 5-min incubations (3 ml/coverslip) with CWS. Fixed cells were then incubated in 10% goat serum for 1 h and washed once with CWS. AGS3 antibody was diluted into CWS containing 2% goat serum and 1% fetal bovine serum and then centrifuged at 10,000 × g for 10 min prior to use. Coverslips were incubated with 75 μl of AGS3 antibody (0.01 mg/ml) for 1 h by placing the coverslips (cell side down) on parafilm in a humidified chamber. Following incubation with AGS3 antibody, coverslips were washed three times (3 ml/coverslip) with CWS and then incubated with goat anti-rabbit biotin conjugate (1:800) for 40 min. The fixed cells were washed three times in CWS and incubated in Extravidin fluorescein isothiocyanate (1:500) for 40 min, followed by three 10 min incubations with CWS. Washed coverslips were mounted in Immuno Fluore, sealed with nail polish, and stored at 4 °C until evaluated by fluorescent microscopy. All incubations were carried out at 24 °C. Mounted slips were evaluated on a Leica DMLB fluorescent microscope and by confocal microscopy using a Bio-Rad MRC-100 laser scanning confocal imaging system. The cell nucleus was identified by propidium iodide staining. Multiple series of experiments were performed to determine the optimal conditions for signal detection and to verify the specificity of observed signals. These experiments included different methods of fixation and permeabilization as well as a matrix with serial dilutions of primary antibodies and secondary conjugates. We chose to generate stable transfectants to minimize any artifacts introduced by transient transfection. Only very weak immunofluorescence signals were detected in nontransfected DDT1-MF2 cells as expected from the relative strengths of the signals for control and AGS3-transfected cells observed by immunoblotting. No immunofluorescent signal was detected in control or AGS3 transfectants in the absence of any primary antibody. Nucleotide binding assays were conducted by a modification of a described previously techniques (2Sato M. Ribas C. Hildebrandt J.D. Lanier S.M. J. Biol. Chem. 1996; 271: 30052-30060Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar,20Ross M. Higashijima T. Methods Enzymol. 1994; 237: 26-37Crossref PubMed Scopus (97) Google Scholar). G-proteins (100 nm) were preincubated with varying amounts of AGS3 subdomain proteins or GST controls for 15 min at 24 °C (binding buffer = 50 mm Hepes-HCl, pH 7.5, 1 mm EDTA, 2 mm MgCl2, 1 mm dithiothreitol, 50 μm adenosine triphosphate, 10 μg/ml bovine serum albumin) prior to addition of 0.5–1 μm GTPγS (4.0 × 104 dpm/pmol); the final incubation volume was 50 μl. Samples were incubated with GTPγS at 24 °C for 30 min. Incubated reactions were terminated by rapid filtration through nitrocellulose filters (Schleicher & Schuell BA85) with four 4-ml washes of stop buffer (50 mm Tris-HCl, 5 mm MgCl2, 1 mm EDTA, pH 7.4, 4 °C). Radioactivity bound to the filters was determined by liquid scintillation counting. DDT1-MF2 cells were stably transfected with pcDNA3.AGS3 by DNA/calcium phosphate coprecipitation (21Duzic E. Lanier S.M. J. Biol. Chem. 1992; 267: 24045-24052Abstract Full Text PDF PubMed Google Scholar). For antipeptide antisera, AGS3 peptides (P-32 Thr306–Ile436 and P-22 Asp528–Gly550) were synthesized and conjugated for generation of rabbit polyclonal antisera using the Peptide Synthesis and Antibody Production Facility at the Medical University of South Carolina. Each of the three antisera specifically recognized GST-AGS3 at reasonable dilutions of serum and were affinity-purified. Denaturing gel electrophoresis and immunoblotting were performed as described previously (18Wu G. Hildebrandt J. Benovic J.L. Lanier S.M. J. Biol. Chem. 1998; 273: 7197-7200Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). For reprobing of membrane transfers , the membrane transfers were washed with buffer A containing 20 mm Tris-HCl, pH 7.6, 140 mm NaCl, 0.2% Tween each and then incubated with pre-heated stripping buffer (62.5 mm Tris-HCl, pH 6.8, 2% SDS, 100 mmβ-mercaptoethanol) for 20 min in a 55 °C water bath with gentle shaking. The membrane was then washed with buffer A and processed for immunoblotting. For Coomassie Blue staining of proteins, gels were incubated in 100 ml of staining buffer (0.25% Coomassie Blue in 45% methanol, 45% H2O, 10% glacial acetic acid) for 30 min at room temperature. Stained gels were then washed in 100 ml of destain solution (45% methanol, 45% H2O, 10% glacial acetic acid) and incubated for 30 min. Gels were then washed in fresh destain solution every 30 min until protein bands were visible. Immunoblots with AGS3 antipeptide antibodies indicated expression of AGS3 (Mr ∼ 74,000) in rat brain, the neuroblastoma-glioma cell hybrid NG108-15 (rat/murine) the rat pheochromocytoma cell line PC12, and the DDT1-MF2 smooth muscle cell line derived from hamster vas deferens (Fig.2). Immunoreactive species with an apparent Mr of ∼74,000 were not detected in rat liver, rat kidney, Caco-2 cells, CHO cells, HEK cells, or NIH-3T3 fibroblasts (Fig. 2). 3M. L. Bernard and S. M. Lanier, unpublished observations. The same immunoreactive Mr ∼74,000 species was observed with two different antibodies (P-32, P-22) generated against peptides derived from different regions of the protein (Fig. 2). Fractionation of tissues/cells expressing AGS3 indicated that AGS3 is enriched in the 100,000 × g supernatant consistent with a major distribution of AGS3 in the cytosol (Fig.3 A). A similar fractionation of AGS3 was observed in DDT1-MF2 cells stably transfected with AGS3 (Fig. 3 A). The subcellular localization of AGS3 was also addressed by immunofluorescence analysis following stable expression of AGS3 in the DDT1-MF2 cell line (Fig.3 B). Confocal microscopy was used to generate an image approximately through the middle plane of the cell. The immunofluorescent image indicates that AGS3 is predominantly cytosolic (Fig. 3 B), as suggested by immunoblot analysis of the 100,000 × g supernatant from cell lysates illustrated in Fig. 3 A. Within the cell, the AGS3 signal is often punctate and occasionally enriched in microdomains of the cell.Figure 3Subcellular distribution of AGS3. A, tissues or confluent dishes of cell lines were fractionated into a 100,000 × g supernatant (S) and 100,000 × g pellet (P) as described under "Experimental Procedures." Membrane transfers were immunoblotted with AGS3 antisera P-32. The immunoblot is representative of results obtained in three different experiments. The lines to the right of the blot indicated the migration of size standards (low molecular weight; Bio-Rad) × 10−3. The arrows to the left of the immunoblot indicate the migration of AGS3. Each lane contains 100 μg of protein. DDT, DDT1-MF2 cells; DDT-AGS3, DDT1-MF2 cells stably transfected with rat AGS3. B, immunofluorescent analysis of AGS3 distribution in DDT1-MF2 cells stably transfected with AGS3. Cells were fixed and processed as described under "Experimental Procedures." Confocal microscopy was used to evaluate images through different planes of the cells, and the micrograph shown is the image taken from approximately the middle plane of the cells. The large rounded area in the middle of the cell devoid of signal corresponds to the cell nucleus as defined by propidium iodide staining. This image was generated with a Bio-Rad MRC-100 laser scanning confocal imaging system (magnification, ×63; 30% laser power; gain, 1250; IRS, 0.7). This figure is representative of five to seven images obtained by different fixation methods and using different antibody concentrations. Only very weak immunofluorescence signals were detected in nontransfected DDT1-MF2 cells as expected from the relative strengths of the signals for control and AGS3-transfected cells observed by immunoblotting in A. No immunofluorescent signal was detected in control or AGS3 transfectants in the absence of any primary antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We previously reported that the carboxyl-terminal 74 amino acids of AGS3 were active in the yeast functional screen and that this peptide fragment directly bound to Gαi (4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). We thus asked if full-length AGS3 was complexed with Gαi3 in lysates of rat brain or DDT1-MF2 cells stably transfected with AGS3. As AGS3 preferentially regulated Gαi2 and Gαi3 in the yeast functional assay (4Takesono A. Cismowski M.J. Ribas C. Bernard M. Chung P. Hazard III, S. Duzic E. Lanier S.M. J. Biol. Chem. 1999; 274: 33202-33205Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar), we first approached this issue by immunoprecipitation of Gαi3. Approximately 30% of brain lysate Gαi3 was immunoprecipated with a Gαi3 carboxyl terminus antibody. Immunoblots of membrane transfers containing Gαi3immunoprecipitates indicated that AGS3 coimmunoprecipitated with Gαi in a nucleotide-dependent manner (Fig.4). The absence of Gβ in the GTPγS-treated samples provided internal controls for G-protein activation and subunit dissociation by added GTPγS/Mg2+. Immunoprecipitation experiments were also conducted with the AGS3 antisera P-32. Although AGS3 was effectively immunoprecipitated by the P-32 antisera in each cell/tissue extract, coimmunoprecipitation of Gαi3 was variab
Referência(s)