NAB2 Represses Transcription by Interacting with the CHD4 Subunit of the Nucleosome Remodeling and Deacetylase (NuRD) Complex
2006; Elsevier BV; Volume: 281; Issue: 22 Linguagem: Inglês
10.1074/jbc.m600775200
ISSN1083-351X
AutoresRajini Srinivasan, Gennifer M. Mager, R. Matthew Ward, Joshua A. Mayer, John Svaren,
Tópico(s)RNA regulation and disease
ResumoEarly growth response (EGR) transactivators act as critical regulators of several physiological processes, including peripheral nerve myelination and progression of prostate cancer. The NAB1 and NAB2 (NGFI-A/EGR1-binding protein) transcriptional corepressors directly interact with three EGR family members (Egr1/NGFI-A/zif268, Egr2/Krox20, and Egr3) and repress activation of their target promoters. To understand the molecular mechanisms underlying NAB repression, we found that EGR activity is modulated by at least two repression domains within NAB2, one of which uniquely requires interaction with the CHD4 (chromodomain helicase DNA-binding protein 4) subunit of the NuRD (nucleosome remodeling and deacetylase) chromatin remodeling complex. Both NAB proteins can bind either CHD3 or CHD4, indicating that the interaction is conserved among these two protein families. Furthermore, we show that repression of the endogenous Rad gene by NAB2 involves interaction with CHD4 and demonstrate colocalization of NAB2 and CHD4 on the Rad promoter in myelinating Schwann cells. Finally, we show that interaction with CHD4 is regulated by alternative splicing of the NAB2 mRNA. Early growth response (EGR) transactivators act as critical regulators of several physiological processes, including peripheral nerve myelination and progression of prostate cancer. The NAB1 and NAB2 (NGFI-A/EGR1-binding protein) transcriptional corepressors directly interact with three EGR family members (Egr1/NGFI-A/zif268, Egr2/Krox20, and Egr3) and repress activation of their target promoters. To understand the molecular mechanisms underlying NAB repression, we found that EGR activity is modulated by at least two repression domains within NAB2, one of which uniquely requires interaction with the CHD4 (chromodomain helicase DNA-binding protein 4) subunit of the NuRD (nucleosome remodeling and deacetylase) chromatin remodeling complex. Both NAB proteins can bind either CHD3 or CHD4, indicating that the interaction is conserved among these two protein families. Furthermore, we show that repression of the endogenous Rad gene by NAB2 involves interaction with CHD4 and demonstrate colocalization of NAB2 and CHD4 on the Rad promoter in myelinating Schwann cells. Finally, we show that interaction with CHD4 is regulated by alternative splicing of the NAB2 mRNA. By virtue of their ability to regulate the early growth response (EGR) 3The abbreviations used are: EGR, early growth response; CHD, chromodomain helicase DNA-binding (protein); NCD, NAB conserved domain; CID, CHD4-interacting domain; HDAC, histone deacetylase; RAD, Ras homolog in diabetes; PHD, plant homeodomain; siRNA, short interfering RNA; DBD, DNA-binding domain; TSA, trichostatin A; HA, hemagglutinin; NuRD, nucleosome remodeling and deacetylase (domain); P11, postnatal day 11; RT, reverse transcription. family of transactivators, NAB (NGFI-A-binding protein) corepressors play an important role in regulating inflammation, nervous system function, and prostate cancer development. The NAB1 and NAB2 corepressors interact with a conserved domain found within Egr1 (also called NGFI-A/zif268), Egr2/Krox20, and Egr3 (1Russo M.W. Sevetson B.R. Milbrandt J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6873-6877Crossref PubMed Scopus (252) Google Scholar, 2Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Crossref PubMed Scopus (328) Google Scholar, 3Sevetson B.R. Svaren J. Milbrandt J. J. Biol. Chem. 2000; 275: 9749-9757Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). The remaining family member, Egr4/NGFI-C, shares substantial homology with other EGR family members but lacks the NAB interaction domain and is therefore resistant to NAB repression. Members of the EGR family play diverse physiological roles, including having both positive and negative effects on growth. For example, Egr1 null fibroblasts bypass senescence because of reduced expression of the p53 gene (4Krones-Herzig A. Adamson E. Mercola D. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 3233-3238Crossref PubMed Scopus (98) Google Scholar). On the other hand, EGR1 overexpression is also involved in the development of prostate cancer (5Thigpen A.E. Cala K.M. Guileyardo J.M. Molberg K.H. McConnell J.D. Russell D.W. J. Urol. 1996; 155: 975-981Crossref PubMed Scopus (59) Google Scholar, 6Eid M.A. Kumar M.V. Iczkowski K.A. Bostwick D.G. Tindall D.J. Cancer Res. 1998; 58: 2461-2468PubMed Google Scholar), as it regulates several growth factor genes (7Abdulkadir S.A. Qu Z. Garabedian E. Song S.K. Peters T.J. Svaren J. Carbone J.M. Naughton C.K. Catalona W.J. Ackerman J.J. Gordon J.I. Humphrey P.A. Milbrandt J. Nat. Med. 2001; 7: 101-107Crossref PubMed Scopus (155) Google Scholar, 8Svaren J. Ehrig T. Abdulkadir S.A. Ehrengruber M.U. Watson M.A. Milbrandt J. J. Biol. Chem. 2000; 275: 38524-38531Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 9Baron V. De Gregorio G. Krones-Herzig A. Virolle T. Calogero A. Urcis R. Mercola D. Oncogene. 2003; 22: 4194-4204Crossref PubMed Scopus (99) Google Scholar, 10Virolle T. Krones-Herzig A. Baron V. De Gregorio G. Adamson E.D. Mercola D. J. Biol. Chem. 2003; 278: 11802-11810Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). The other EGR family member that has been studied intensively is Egr2/Krox20. Targeted disruption of the mouse Egr2 gene resulted in defects in hindbrain segmentation, bone development, and peripheral nerve myelination by Schwann cells (11Schneider-Maunoury S. Topilko P. Seitanidou T. Levi G. Cohen-Tannoudji M. Pournin S. Babinet C. Charnay P. Cell. 1993; 75: 1199-1214Abstract Full Text PDF PubMed Scopus (413) Google Scholar, 12Swiatek P.J. Gridley T. Genes Dev. 1993; 7: 2071-2084Crossref PubMed Scopus (408) Google Scholar, 13Topilko P. Schneider-Maunoury S. Levi G. Baron-Van Evercooren A. Chennoufi A.B.Y. Seitanidou T. Babinet C. Charnay P. Nature. 1994; 371: 796-799Crossref PubMed Scopus (666) Google Scholar, 14Levi G. Topilko P. Schneider-Maunoury S. Lasagna M. Mantero S. Cancedda R. Charnay P. Development (Camb.). 1996; 122: 113-120Crossref PubMed Google Scholar). A number of Egr2 target genes in the hindbrain and Schwann cells have been identified, including several Hox family members, EphA4, and myelin-associated genes such as myelin protein zero and myelin basic protein (13Topilko P. Schneider-Maunoury S. Levi G. Baron-Van Evercooren A. Chennoufi A.B.Y. Seitanidou T. Babinet C. Charnay P. Nature. 1994; 371: 796-799Crossref PubMed Scopus (666) Google Scholar, 15Sham M.H. Vesque C. Nonchev S. Marshall H. Frain M. Gupta R.D. Whiting J. Wilkinson D. Charnay P. Krumlauf R. Cell. 1993; 72: 183-196Abstract Full Text PDF PubMed Scopus (275) Google Scholar, 16Nonchev S. Vesque C. Maconochie M. Seitanidou T. Ariza-McNaughton L. Frain M. Marshall H. Sham M.H. Krumlauf R. Charnay P. Development (Camb.). 1996; 122: 543-554Crossref PubMed Google Scholar, 17Seitanidou T. Schneider-Maunoury S. Desmarquet C. Wilkinson D.G. Charnay P. Mech. Dev. 1997; 65: 31-42Crossref PubMed Scopus (80) Google Scholar, 18Theil T. Frain M. Gilardi-Hebenstreit P. Flenniken A. Charnay P. Wilkinson D.G. Development (Camb.). 1998; 125: 443-452Crossref PubMed Google Scholar, 19Nagarajan R. Svaren J. Le N. Araki T. Watson M. Milbrandt J. Neuron. 2001; 30: 355-368Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 20Le N. Nagarajan R. Wang J.Y. Araki T. Schmidt R.E. Milbrandt J. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 2596-2601Crossref PubMed Scopus (243) Google Scholar, 21LeBlanc S.E. Jang S.W. Ward R.M. Wrabetz L. Svaren J. J. Biol. Chem. 2006; 281: 5453-5460Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Several experiments in various systems have established that NAB corepressors are important regulators of EGR activity. NAB1 and NAB2 both repress EGR activation of several promoters (3Sevetson B.R. Svaren J. Milbrandt J. J. Biol. Chem. 2000; 275: 9749-9757Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 22Svaren J. Sevetson B.R. Golda T. Stanton J.J. Swirnoff A.H. Milbrandt J. EMBO J. 1998; 17: 6010-6019Crossref PubMed Scopus (69) Google Scholar, 23Houston P. Campbell C.J. Svaren J. Milbrandt J. Braddock M. Biochem. Biophys. Res. Commun. 2001; 283: 480-486Crossref PubMed Scopus (50) Google Scholar, 24Lucerna M. Mechtcheriakova D. Kadl A. Schabbauer G. Schafer R. Gruber F. Koshelnick Y. Muller H.D. Issbrucker K. Clauss M. Binder B.R. Hofer E. J. Biol. Chem. 2003; 278: 11433-11440Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 25Qu Z. Wolfraim L.A. Svaren J. Ehrengruber M.U. Davidson N. Milbrandt J. J. Cell Biol. 1998; 142: 1075-1082Crossref PubMed Scopus (59) Google Scholar, 26Mechta-Grigoriou F. Garel S. Charnay P. Development (Camb.). 2000; 127: 119-128Crossref PubMed Google Scholar). Interestingly, although EGR1 is overexpressed in prostate cancer (5Thigpen A.E. Cala K.M. Guileyardo J.M. Molberg K.H. McConnell J.D. Russell D.W. J. Urol. 1996; 155: 975-981Crossref PubMed Scopus (59) Google Scholar, 6Eid M.A. Kumar M.V. Iczkowski K.A. Bostwick D.G. Tindall D.J. Cancer Res. 1998; 58: 2461-2468PubMed Google Scholar), NAB2 expression is reduced in a majority of prostate cancer samples (27Abdulkadir S.A. Carbone J.M. Naughton C.K. Humphrey P.A. Catalona W.J. Milbrandt J. Hum. Pathol. 2001; 32: 935-939Crossref PubMed Scopus (59) Google Scholar). This observation is consistent with the idea that derepression of EGR1 activity is a progression factor in prostate cancer. The importance of NAB regulation is underscored by the identification of a recessive mutation in the NAB-binding domain of EGR2 (I268N) in a family affected with an inherited form of congenital hypomyelinating neuropathy (28Warner L.E. Mancias P. Butler I.J. McDonald C.M. Keppen L. Koob K.G. Lupski J.R. Nat. Genet. 1998; 18: 382-384Crossref PubMed Scopus (449) Google Scholar, 29Warner L.E. Svaren J. Milbrandt J. Lupski J.R. Hum. Mol. Genet. 1999; 8: 1245-1251Crossref PubMed Scopus (133) Google Scholar). Congenital hypomyelinating neuropathy resembles the non-myelinating phenotype of the peripheral nervous system observed in Egr2/Krox20-deficient mice (13Topilko P. Schneider-Maunoury S. Levi G. Baron-Van Evercooren A. Chennoufi A.B.Y. Seitanidou T. Babinet C. Charnay P. Nature. 1994; 371: 796-799Crossref PubMed Scopus (666) Google Scholar). Similarly, a double knock-out of the NAB1 and NAB2 genes causes early lethality and impaired myelination (30Le N. Nagarajan R. Wang J.Y. Svaren J. LaPash C. Araki T. Schmidt R.E. Milbrandt J. Nat. Neurosci. 2005; 8: 932-940Crossref PubMed Scopus (107) Google Scholar), indicating that NAB corepressors are required for peripheral nerve myelination. Although diverse physiological data have demonstrated that NAB corepressors play a critical role in regulation of EGR activity, the molecular mechanism by which these corepressors act has remained elusive. NAB1 and NAB2 share a high degree of homology (2Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Crossref PubMed Scopus (328) Google Scholar) and are able to homo- and heteromultimerize with each other (22Svaren J. Sevetson B.R. Golda T. Stanton J.J. Swirnoff A.H. Milbrandt J. EMBO J. 1998; 17: 6010-6019Crossref PubMed Scopus (69) Google Scholar). NAB1 and NAB2 are nuclear proteins, and they repress when tethered to active promoters by fusion to a Gal4 DNA-binding domain (DBD) (31Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Crossref PubMed Scopus (96) Google Scholar). Therefore, we hypothesized that NAB proteins recruit other proteins in order to regulate EGR activity. We now show that the C-terminal domain of NAB2 interacts with the chromodomain helicase DNA-binding protein 4 (CHD4) subunit of the nucleosome remodeling and deacetylase (NuRD) complex and that this interaction is required for repression by this domain. Yeast Two-hybrid Screen—The yeast two-hybrid screen (32Fields S. Song O. Nature. 1989; 20Google Scholar) was performed in the Molecular Interaction Facility, University of Wisconsin Biotechnology Center. Mouse embryonic and brain libraries in pGAD-T7Rec (BD Biosciences) were screened with a construct containing amino acids 130–525 of the NAB2 protein fused to the GAL4 DNA-binding domain in pBUTE (a kanamycin-resistant version of GAL4 bait vector pGBDUC1). Approximately 18 million clones were screened via mating in yeast strain PJ694. After isolation of prey plasmids from positive pools, 18 plasmids were positive after retransformation into the bait-containing strain. Of these, two contained clones of mouse CHD4. Plasmids—Segments of the CHD4 (containing amino acids 1281–1915) and CHD3-(Δ1–1311) genes were cloned in-frame with an N-terminal 3× FLAG epitope in the pcDNA3.1 vector (Invitrogen). Human HA-NAB2 (containing amino acids 34–525) was generated by introducing a C-terminal HA epitope. Deletion of amino acids 251 to 353 in HA-NAB2 was used to create NAB2ΔNCD2 (NCD1+CID), and NAB2ΔCID (NCD1+NCD2) lacks amino acids 386–525. The last 18 amino acids are excluded in the construct NAB2Δ507–525. The CID construct consists of amino acids 357–525, including the nuclear localization sequence to permit nuclear translocation. For NAB2 constructs lacking NCD1, translation initiation occurred at Met-141. A naturally occurring splice variant of NAB2 lacks amino acids 426–489 (exon 6 of NAB2). The indicated NAB2 segments were fused to the Gal4 DBD in pM1 (33Sadowski I. Ptashne M. Nucleic Acids Res. 1989; 177539Crossref PubMed Scopus (472) Google Scholar). The altered specificity version of Egr2 was generated by mutagenesis of the second zinc finger from SRSDHLTTHIR to SQSVHLQSHSR, as described for Egr1 (34Choo Y. Castellanos A. Garcia-Hernandez B. Sanchez-Garcia I. Klug A. J. Mol. Biol. 1997; 273: 525-532Crossref PubMed Scopus (48) Google Scholar). The corresponding reporter plasmid was created by inserting nine repeats of an altered EGR2 binding site (GCGTGAGCG) into the pGL2 vector (Promega) containing the adenovirus E1B TATA element. For mammalian two-hybrid experiments, amino acids 1281–1915 of CHD4 were fused to the Gal4 DNA-binding domain in the pM1 vector. The NAB2VP16 construct was created by fusing the VP16 activation domain to the C terminus of NAB2, as described for the NAB1-VP16 construct (31Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Crossref PubMed Scopus (96) Google Scholar). Constructs for NAB1ΔNCD1-(Δ2–210), the luciferase reporter containing the thymidine kinase promoter with five upstream Gal4 binding sites, and the Gal4 reporter containing a minimal TATA element have been described previously (31Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Crossref PubMed Scopus (96) Google Scholar). Coimmunoprecipitation Analysis—QT6 (Quail fibroblast) or 293T cells were cultured as described previously (35Apel E.D. Roberds S.L. Campbell K.P. Merlie J.P. Neuron. 1995; 15: 115-126Abstract Full Text PDF PubMed Scopus (199) Google Scholar), plated at a density of 5 × 105 cells/ml, and transfected using LT-1 (Mirus) transfection reagent according to manufacturer's protocol. Bluescript plasmid (Stratagene) was included as needed to make a total of 2 μg/well/6-well plate. After 48 h, cells were washed once in phosphate-buffered saline and extracted with lysis buffer containing 6% glycerol, 20 mm Tris, pH 7.5, 5 mm MgCl2, 0.1% Nonidet P-40, and 200 mm NaCl, with the addition of Complete Mini protease inhibitors (Roche Applied Science) for 10 min at room temperature. The lysates were centrifuged at 10,000 × g for 15 min at 4°C. 50 μl (or 200 μl; see Fig. 2C) of the supernatant was mixed with 25 μl of anti-HA rat monoclonal affinity matrix (Roche Applied Science) in lysis buffer containing 100 mm NaCl (final concentration). After incubation for 2 h at room temperature on a rocking platform, the matrix was washed five times with 250 μl of binding buffer. The reciprocal immunoprecipitation used M2 anti-FLAG-agarose beads (Sigma) according to the manufacturer's recommendations. After the final wash, proteins were eluted by boiling for 2 min in 1× Laemmli buffer prior to immunoblotting using antibodies directed against the FLAG epitope (M2, Sigma), HA epitope (rat monoclonal from Roche Applied Science or rabbit polyclonal from Sigma), or CHD3/4 (BD Biosciences 611846). Other antibodies used were: α-tubulin (Santa Cruz sc-5546), CHD3/4 (Santa Cruz sc-11378), and Egr2 (Covance PRB236P). Membranes were incubated with peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories) and detected using West Pico or West Dura chemiluminescence detection reagents (Pierce). Cell Culture and Transfections—For reporter assays, JEG3 cells (human trophoblast cell line) were cultured in minimal essential medium supplemented with 5% bovine growth serum. Transfections were carried out in duplicate in 12-well plates seeded with 3 × 104 cells/well. Unless otherwise indicated, cells were transfected with 250 ng of the indicated luciferase reporter plasmid, 100 ng of a LacZ reporter driven by a cytomegalovirus promoter, the indicated expression plasmids, and pBluescript as required to make a total of 1 μg of DNA/well using LT-1 transfection reagent (Mirus). After 48 h, cells were harvested, and the level of luciferase activity was measured and normalized to β-galactosidase activity, which was measured using the GalactoLight Plus kit (Applied Biosystems). A custom SMARTpool mixture of four short interfering RNAs (siRNAs) directed against human CHD4 and the control siRNA (siCONTROL nontargeting siRNA 1) were purchased from Dharmacon. JEG3 or 293 cells were transfected with 62.5 pm siRNA using Lipofectamine 2000 as recommended by the manufacturer (Invitrogen). For reporter assays in the presence of siRNA, JEG3 cells were simultaneously transfected with siRNA and the plasmids described above using Lipofectamine 2000. Luciferase and β-galactosidase assays were then carried out 48 h later as described above. Primary rat Schwann cells were cultured and infected as described (19Nagarajan R. Svaren J. Le N. Araki T. Watson M. Milbrandt J. Neuron. 2001; 30: 355-368Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar) using recombinant adenoviruses prepared using the AdEasy system (36He T.C. Zhou S. da Costa L.T. Yu J. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2509-2514Crossref PubMed Scopus (3256) Google Scholar). After 48 h, purified RNA was analyzed by quantitative RT-PCR using SYBR Green dye as described (8Svaren J. Ehrig T. Abdulkadir S.A. Ehrengruber M.U. Watson M.A. Milbrandt J. J. Biol. Chem. 2000; 275: 38524-38531Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar) on a TaqMan 7000 sequence detection system (Applied Biosystems). Relative amounts of the human and rat RAD genes were determined using the Comparative Ct method (37Livak K.J. Schmittgen T.D. Methods (San Diego). 2001; 25: 402-408Crossref PubMed Scopus (127155) Google Scholar) and normalized to the relative levels of 18 S rRNA. Primer sequences are available upon request. PCR—Primers flanking the exon 6 region of NAB2 (GGTTGGAGAACAGAGTCACAATGA and GGCAGCGGTCCAGCAA) were used to amplify the full-length and alternately spliced forms of NAB2 from cDNA prepared from various mouse tissues. Chromatin Immunoprecipitation Assays—All experiments were performed in strict accordance with experimental protocols approved by the University of Wisconsin School of Veterinary Medicine. After euthanasia of Sprague-Dawley rat pups at postnatal day 11 (P11), sciatic nerves were dissected (pooled from seven pups) and immediately minced in phosphate-buffered saline containing 1% formaldehyde for 25 min at room temperature. Nerves were washed in phosphate-buffered saline, resuspended in 150 mm NaCl, 10% glycerol, 50 mm Tris, pH 8.0 (with a 1:1000 dilution of Sigma protease inhibitor mixture), and homogenized using the Tissue Tearor (biospec). Triton X-100 was added to 0.3%, and the lysate was sonicated in the presence of 100 mg of glass beads, alternating 10-s pulses with 50 s of cooling for a total of 20 min. Sonicated chromatin (containing 300 μg of protein as determined by the Bio-Rad protein assay) was used for each immunoprecipitation, and 10% of this amount was saved as an input. Lysates were incubated with 2 μg of anti-Egr2/Krox20 (Covance), anti-Nab2 (Santa Cruz), anti-CHD3/4 rabbit polyclonal (Santa Cruz sc-11378), or normal rabbit IgG (Upstate) control antibody. Immune complexes were collected with 25 μl of a protein G-agarose slurry (Pierce) blocked with herring sperm DNA (Fisher) and 0.5 mg of bovine serum albumin. Beads were washed in low salt buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris 8.1, 150 mm NaCl) and high salt buffer (same buffer containing 500 mm NaCl) followed by 0.25 m LiCl, 1% IGEPAL, 1% deoxycholic acid, 1 mm EDTA, 10 mm Tris, pH 8.1. All buffers contained a 1:1000 dilution of Sigma Protease inhibitor mixture. Complexes were eluted with 1% SDS, 0.1 m NaHCO3, and 200 mm NaCl. Cross-links were reversed by heating at 65 °C for 5 h, and DNA was purified using the QIAquick PCR purification kit (Qiagen). Quantitative PCR was performed on the same samples in duplicate. Values are expressed as percent recovery relative to the input DNA. Sequence analysis of the Rad gene identified potential Egr2 sites conforming to the previously defined consensus Egr2 binding site (38Swirnoff A.H. Milbrandt J. Mol. Cell. Biol. 1995; 15: 2275-2287Crossref PubMed Scopus (304) Google Scholar). Primers used for analysis are: Rad -1470, ACCCCCACCACAGTCATTGT and CTTTGGGACAGGAACTTGCTCT; Rad–130, GGGTAAGGGCTGGTAGAGGTTT and CGCTGGATCGCGGTTCT; IMG2a, GAAATTCTGCCCTGCACTTCC and GCTTTGCATTGAGGGAGGATC. CHD4 Interacts with NAB2—NAB1 and NAB2 contain two highly conserved domains called NAB conserved domains 1 and 2 (NCD1 and NCD2). NCD1 is necessary for interaction with EGR proteins and is also required for multimerization of NAB proteins (2Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Crossref PubMed Scopus (328) Google Scholar, 22Svaren J. Sevetson B.R. Golda T. Stanton J.J. Swirnoff A.H. Milbrandt J. EMBO J. 1998; 17: 6010-6019Crossref PubMed Scopus (69) Google Scholar). Repression by NAB1 was shown to require NCD2 as well as other regions near the C terminus (31Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Crossref PubMed Scopus (96) Google Scholar). To identify interacting proteins that might mediate repression by NAB2, we employed a yeast two-hybrid screen of mouse brain and embryonic libraries for proteins that interact with amino acids 130–525 of NAB2. This screen identified two independent clones of a C-terminal portion of CHD4 (Fig. 1A). CHD4 is an ATP-dependent, nucleosome remodeling subunit of the NuRD complex, which has been shown to repress promoters to which it is targeted (reviewed in Refs. 39Becker P.B. Horz W. Annu. Rev. Biochem. 2002; 71: 247-273Crossref PubMed Scopus (625) Google Scholar, 40Feng Q. Zhang Y. Curr. Top. Microbiol. Immunol. 2003; 274: 269-290PubMed Google Scholar, 41Bowen N.J. Fujita N. Kajita M. Wade P.A. Biochim. Biophys. Acta. 2004; 1677: 52-57Crossref PubMed Scopus (252) Google Scholar). None of the other interacting clones encoded NuRD subunits. Additional evidence for NAB2/CHD4 interaction was provided by a mammalian two-hybrid analysis (Fig. 1B), in which the CHD4 C terminus was fused to the Gal4 DBD and NAB2 was fused to the VP16 activation domain. Cotransfection of these two constructs with a luciferase reporter containing Gal4 binding sites resulted in a significant increase in luciferase activity compared with transfection of either construct alone. The potential interaction between CHD4 and NAB2 was tested independently in vivo using a coimmunoprecipitation assay with epitope-tagged versions of NAB2 and the CHD4 C terminus (CHD4Δ1–1280). The CHD4 construct was immunoprecipitated by the anti-HA antibody only in the presence of the HA-tagged NAB2 (Fig. 1C). Conversely, co-immunoprecipitation of NAB2 by anti-FLAG was dependent on expression of FLAG-tagged CHD4 (Fig. 1D). Identification of the CHD4-interacting Domain of NAB2—Deletion analysis of NAB1 implicated the NCD2 domain and the extreme C terminus in transcriptional repression (31Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Crossref PubMed Scopus (96) Google Scholar). Based on these studies, HA-tagged versions of NAB2 were generated that contained a deletion of the NCD2 domain, the C terminus (amino acids 386–525), or the C-terminal 18 amino acids (Fig. 2A). To eliminate the possibility that any of these proteins might interact indirectly with CHD4 as a result of multimerizing with endogenous NAB proteins, the NCD1 domain was deleted from these constructs. Interestingly, analysis of these mutant proteins revealed that the NCD2 domain was not essential for interaction with CHD4 (Fig. 2B). Deletion of the 18 amino acids at the C terminus of the NAB2 protein also failed to disrupt interaction with CHD4. However, removal of amino acids 386–525 of the NAB2 protein prevented interaction with CHD4. Furthermore, expression of amino acids 386–525, together with the nuclear localization signal, was sufficient for interaction with CHD4. This C-terminal region of NAB2 was therefore designated as the CID (CHD4-interacting domain). We also tested whether NAB2 could interact with endogenous CHD4 by transfecting cells with the indicated NAB2 constructs in the absence of transfected CHD4. After immunoprecipitation of NAB2 with anti-HA, we were able to detect associated CHD3/CHD4, which was not observed using a NAB2 construct in which the CID was deleted (Fig. 2C). NAB/CHD Interaction Is Conserved among Family Members—The antibody used in the endogenous assay in Fig. 2C detects both CHD3 and CHD4. CHD4 shares several regions of homology with CHD3, including not only the ATPase, PHD, and chromodomains but also other regions within the C terminus (42Thompson P.M. Gotoh T. Kok M. White P.S. Brodeur G.M. Oncogene. 2003; 22: 1002-1011Crossref PubMed Scopus (138) Google Scholar). In addition, CHD3 has been found in NuRD-like complexes (43Xue Y. Wong J. Moreno G.T. Young M.K. Cote J. Wang W. Mol. Cell. 1998; 2: 851-861Abstract Full Text Full Text PDF PubMed Scopus (797) Google Scholar, 44Tong J.K. Hassig C.A. Schnitzler G.R. Kingston R.E. Schreiber S.L. Nature. 1998; 395: 917-921Crossref PubMed Scopus (552) Google Scholar, 45Schultz D.C. Friedman J.R. Rauscher III, F.J. Genes Dev. 2001; 15: 428-443Crossref PubMed Scopus (408) Google Scholar), suggesting that its molecular role is at least partially redundant to that of CHD4. To test a potential interaction of CHD3 with NAB2, a comparable portion of the C-terminal domain of CHD3 (CHD3Δ1–1311) was epitope-tagged and found to associate with NAB2 (Fig. 3A) in a coimmunoprecipitation assay. In addition, NAB1 and NAB2 share a considerable degree of homology, and in functional assays, we have never observed any substantial differences in their ability to repress EGR-mediated transcription (2Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Crossref PubMed Scopus (328) Google Scholar, 3Sevetson B.R. Svaren J. Milbrandt J. J. Biol. Chem. 2000; 275: 9749-9757Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). As shown in Fig. 3B, NAB1 can also interact with CHD4, suggesting that NAB1 and NAB2 share the capacity to repress transcription by interacting with CHD3 and CHD4. Disruption of NAB2 Function by Dominant Negative CHD4 Constructs—There have been several biochemical characterizations of mammalian NuRD complexes, but none of these studies has identified NAB2 as a stably associated subunit (43Xue Y. Wong J. Moreno G.T. Young M.K. Cote J. Wang W. Mol. Cell. 1998; 2: 851-861Abstract Full Text Full Text PDF PubMed Scopus (797) Google Scholar, 44Tong J.K. Hassig C.A. Schnitzler G.R. Kingston R.E. Schreiber S.L. Nature. 1998; 395: 917-921Crossref PubMed Scopus (552) Google Scholar, 46Zhang Y. LeRoy G. Seelig H.P. Lane W.S. Reinberg D. Cell. 1998; 95: 279-289Abstract Full Text Full Text PDF PubMed Scopus (688) Google Scholar, 47Zhang Y. Ng H.H. Erdjument-Bromage H. Tempst P. Bird A. Reinberg D. Genes Dev. 1999; 13: 1924-1935Crossref PubMed Scopus (935) Google Scholar, 48Humphrey G.W. Wang Y. Russanova V.R. Hirai T. Qin J. Nakatani Y. Howard B.H. J. Biol. Chem. 2001; 276: 6817-6824Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). Accordingly, the observed coimmunoprecipitation of transfected NAB2 and CHD4 might reflect a more transient association involved in NuRD recruitment to EGR target genes rather than a stable complex. Therefore, we proceeded to test whether endogenous CHD4 is a functional requirement for repression by NAB2. Dominant negative CHD4 mutants were used to test the involvement of CHD4 in repression by NAB2. We tested whether expression of the CHD4 C terminus (CHD4Δ1–1280) could interfere with NAB repression in a dominant negative manner, because it binds to NAB2 but lacks the ATPase and other domains required for CHD4 function. In addition, we created a full-length dominant negative CHD4 protein by mutating a conserved lysine (Lys-750) in the ATPase domain (referred to as CHD4K750C). Analogous mutations have been successfully used to create dominant negatives to study ATPase-dependent chromatin remodeling comple
Referência(s)