Isolation and Functional Characterization of Ca2+/H+ Antiporters from Cyanobacteria
2004; Elsevier BV; Volume: 279; Issue: 6 Linguagem: Inglês
10.1074/jbc.m310282200
ISSN1083-351X
AutoresRungaroon Waditee, Gazi Sakir Hossain, Yoshito Tanaka, Tatsunosuke Nakamura, Masamitsu Shikata, Jun Takano, Tetsuko Takabe, Teruhiro Takabe,
Tópico(s)Plant Stress Responses and Tolerance
ResumoGenome sequences of cyanobacteria, Synechocystis sp. PCC 6803, Anabaena sp. PCC 7120, and Thermosynechococcus elongatus BP-1 revealed the presence of a single Ca2+/H+ antiporter in these organisms. Here, we isolated the putative Ca2+/H+ antiporter gene from Synechocystis sp. PCC 6803 (synCAX) as well as a homologous gene from a halotolerant cyanobacterium Aphanothece halophytica (apCAX). In contrast to plant vacuolar CAXs, the full-length apCAX and synCAX genes complemented the Ca2+-sensitive phenotype of an Escherichia coli mutant. ApCAX and SynCAX proteins catalyzed specifically the Ca2+/H+ exchange reaction at alkaline pH. Immunological analysis suggested their localization in plasma membranes. The Synechocystis sp. PCC 6803 cells disrupted of synCAX exhibited lower Ca2+ efflux activity and a salt-sensitive phenotype. Overexpression of ApCAX and SynCAX enhanced the salt tolerance of Synechococcus sp. PCC 7942 cells. Mutagenesis analyses indicate the importance of two conserved acidic amino acid residues, Glu-74 and Glu-324, in the transmembrane segments for the exchange activity. These results clearly indicate that cyanobacteria contain a Ca2+/H+ antiporter in their plasma membranes, which plays an important role for salt tolerance. Genome sequences of cyanobacteria, Synechocystis sp. PCC 6803, Anabaena sp. PCC 7120, and Thermosynechococcus elongatus BP-1 revealed the presence of a single Ca2+/H+ antiporter in these organisms. Here, we isolated the putative Ca2+/H+ antiporter gene from Synechocystis sp. PCC 6803 (synCAX) as well as a homologous gene from a halotolerant cyanobacterium Aphanothece halophytica (apCAX). In contrast to plant vacuolar CAXs, the full-length apCAX and synCAX genes complemented the Ca2+-sensitive phenotype of an Escherichia coli mutant. ApCAX and SynCAX proteins catalyzed specifically the Ca2+/H+ exchange reaction at alkaline pH. Immunological analysis suggested their localization in plasma membranes. The Synechocystis sp. PCC 6803 cells disrupted of synCAX exhibited lower Ca2+ efflux activity and a salt-sensitive phenotype. Overexpression of ApCAX and SynCAX enhanced the salt tolerance of Synechococcus sp. PCC 7942 cells. Mutagenesis analyses indicate the importance of two conserved acidic amino acid residues, Glu-74 and Glu-324, in the transmembrane segments for the exchange activity. These results clearly indicate that cyanobacteria contain a Ca2+/H+ antiporter in their plasma membranes, which plays an important role for salt tolerance. Modulation of cytosolic Ca2+ levels is essential for adapted physiological responses and is determined by two opposite fluxes, Ca2+ influx via channels and Ca2+ efflux via active transporters (1Sze H. Liang F. Hwang I. Curran A.C. Harper J.F. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2000; 51: 433-4621Crossref PubMed Scopus (249) Google Scholar, 2Maser P. Thomine S. Schroeder J.I. Ward J.M. Hirschi K. Sze H. Talke I.N. Amtmann A. Maathuis F.J. Sanders D. Harper J.F. Tchieu J. Gribskov M. Persans M.W. Salt D.E. Kim S.A. Guerinot M.L. Plant Physiol. 2001; 126: 1646-1667Crossref PubMed Scopus (914) Google Scholar, 3Gaxiola R.A. Fink G.R. Hirschi K.D. Plant Physiol. 2002; 129: 967-973Crossref PubMed Scopus (123) Google Scholar). For Ca2+ efflux, the primary pump Ca2+-ATPase and secondary transporter Ca2+ exchanger are believed to play important roles. When compared with other Ca2+ transporters, few studies have been focused on the molecular mechanisms of H+-coupled Ca2+ antiporter (4Shigaki T. Pittman J.K. Cheng N.H. Hirschi K.D. J. Biol. Chem. 2001; 276: 43152-43159Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar).Ca2+/H+ antiporters (CAXs) 1The abbreviations used are: CAXCa2+/H+ antiporterApCAXCAX from A. halophyticaAtCAXCAX from ArabidopsisSynCAXCAX from Synechocystis sp. PCC 6803SynNhaP1Na+/H+ antiporter from Synechocystis PCC 6803ScVCX1S. cerevisiae vacuolar antiporterTMtransmembrane.1The abbreviations used are: CAXCa2+/H+ antiporterApCAXCAX from A. halophyticaAtCAXCAX from ArabidopsisSynCAXCAX from Synechocystis sp. PCC 6803SynNhaP1Na+/H+ antiporter from Synechocystis PCC 6803ScVCX1S. cerevisiae vacuolar antiporterTMtransmembrane. have been cloned from bacteria, fungi, and plants, most of which are vacuolar CAXs (5Ivey D.M. Guffanti A.A. Zemsky J. Pinner E. Karpel R. Padan E. Schuldiner S. Krulwich A. J. Biol. Chem. 1993; 268: 11296-11303Abstract Full Text PDF PubMed Google Scholar, 6Cunningham K.W. Fink G.R. Mol. Cell. Biol. 1996; 16: 2226-2237Crossref PubMed Scopus (378) Google Scholar, 7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar). CAXs have in general 10–14 transmembrane (TM)-spanning domain with about 400 amino acid residues (2Maser P. Thomine S. Schroeder J.I. Ward J.M. Hirschi K. Sze H. Talke I.N. Amtmann A. Maathuis F.J. Sanders D. Harper J.F. Tchieu J. Gribskov M. Persans M.W. Salt D.E. Kim S.A. Guerinot M.L. Plant Physiol. 2001; 126: 1646-1667Crossref PubMed Scopus (914) Google Scholar, 3Gaxiola R.A. Fink G.R. Hirschi K.D. Plant Physiol. 2002; 129: 967-973Crossref PubMed Scopus (123) Google Scholar, 4Shigaki T. Pittman J.K. Cheng N.H. Hirschi K.D. J. Biol. Chem. 2001; 276: 43152-43159Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 5Ivey D.M. Guffanti A.A. Zemsky J. Pinner E. Karpel R. Padan E. Schuldiner S. Krulwich A. J. Biol. Chem. 1993; 268: 11296-11303Abstract Full Text PDF PubMed Google Scholar, 6Cunningham K.W. Fink G.R. Mol. Cell. Biol. 1996; 16: 2226-2237Crossref PubMed Scopus (378) Google Scholar, 7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar). CAXs contain a central hydrophilic motif rich in acidic amino acid residues that bisect the polypeptide into two approximately equal segments (5Ivey D.M. Guffanti A.A. Zemsky J. Pinner E. Karpel R. Padan E. Schuldiner S. Krulwich A. J. Biol. Chem. 1993; 268: 11296-11303Abstract Full Text PDF PubMed Google Scholar, 6Cunningham K.W. Fink G.R. Mol. Cell. Biol. 1996; 16: 2226-2237Crossref PubMed Scopus (378) Google Scholar, 7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar). Information on the molecular properties of CAX has been emerging from the studies on plant CAXs, especially from Arabidopsis (4Shigaki T. Pittman J.K. Cheng N.H. Hirschi K.D. J. Biol. Chem. 2001; 276: 43152-43159Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar, 8Ueoka-Nakanishi H. Nakanishi Y. Tanaka Y. Maeshima M. Eur. J. Biochem. 1999; 262: 417-425Crossref PubMed Scopus (59) Google Scholar, 9Hirschi K.D. Korenkov V.D. Wilganowski N.L. Wagner G.J. Plant Physiol. 2000; 124: 125-1338Crossref PubMed Scopus (390) Google Scholar, 10Pittman J.K. Hirschi K.D. Plant Physiol. 2001; 127: 1020-1029Crossref PubMed Scopus (98) Google Scholar, 11Pittman J.K. Shigaki T. Cheng N.H. Hirschi K.D. J. Biol. Chem. 2002; 277: 26452-26459Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 12Cheng N.H. Pittman J.K. Shigaki T. Hirschi K.D. Plant Physiol. 2002; 128: 1245-1254Crossref PubMed Scopus (107) Google Scholar, 13Pittman J.K. Sreevidya C.S. Shigaki T. Ueoka-Nakanishi H. Hirschi K.D. Plant Physiol. 2002; 130: 1054-1062Crossref PubMed Scopus (51) Google Scholar, 14Cheng N.H. Hirschi K.D. J. Biol. Chem. 2003; 278: 6503-6509Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 15Cheng N.H. Pittman J.K. Barkla B.J. Shigaki T. Hirschi K.D. Plant Cell. 2003; 15: 347-364Crossref PubMed Scopus (179) Google Scholar). Four Arabidopsis CAXs (AtCAX1–4) were identified by their ability to sequester Ca2+ into yeast vacuoles in Saccharomyces cerevisiae mutants deleted of the vacuolar Ca2+-ATPase and Ca2+/H+ antiporter (ScVCX1) (7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar, 9Hirschi K.D. Korenkov V.D. Wilganowski N.L. Wagner G.J. Plant Physiol. 2000; 124: 125-1338Crossref PubMed Scopus (390) Google Scholar, 12Cheng N.H. Pittman J.K. Shigaki T. Hirschi K.D. Plant Physiol. 2002; 128: 1245-1254Crossref PubMed Scopus (107) Google Scholar, 14Cheng N.H. Hirschi K.D. J. Biol. Chem. 2003; 278: 6503-6509Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). It was shown that AtCAX1, AtCAX3, and AtCAX4 specifically transport Ca2+, whereas AtCAX2 transports Ca2+, Mn2+, and Cd2+ (7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar, 9Hirschi K.D. Korenkov V.D. Wilganowski N.L. Wagner G.J. Plant Physiol. 2000; 124: 125-1338Crossref PubMed Scopus (390) Google Scholar, 14Cheng N.H. Hirschi K.D. J. Biol. Chem. 2003; 278: 6503-6509Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). In these vacuolar type AtCAXs, the presence of an N-terminal autoinhibition domain and a 9-amino-acid region required for Ca2+ transport (Ca2+ domain) has been reported (9Hirschi K.D. Korenkov V.D. Wilganowski N.L. Wagner G.J. Plant Physiol. 2000; 124: 125-1338Crossref PubMed Scopus (390) Google Scholar, 10Pittman J.K. Hirschi K.D. Plant Physiol. 2001; 127: 1020-1029Crossref PubMed Scopus (98) Google Scholar, 11Pittman J.K. Shigaki T. Cheng N.H. Hirschi K.D. J. Biol. Chem. 2002; 277: 26452-26459Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 12Cheng N.H. Pittman J.K. Shigaki T. Hirschi K.D. Plant Physiol. 2002; 128: 1245-1254Crossref PubMed Scopus (107) Google Scholar, 13Pittman J.K. Sreevidya C.S. Shigaki T. Ueoka-Nakanishi H. Hirschi K.D. Plant Physiol. 2002; 130: 1054-1062Crossref PubMed Scopus (51) Google Scholar, 14Cheng N.H. Hirschi K.D. J. Biol. Chem. 2003; 278: 6503-6509Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). By contrast, little is known about H+-coupled Ca2+ efflux antiporters. Hitherto, a plasma membrane Ca2+/H+ antiporter gene (chaA) has only been isolated from Escherichia coli (5Ivey D.M. Guffanti A.A. Zemsky J. Pinner E. Karpel R. Padan E. Schuldiner S. Krulwich A. J. Biol. Chem. 1993; 268: 11296-11303Abstract Full Text PDF PubMed Google Scholar). In ChaA, neither an N-terminal autoinhibition domain nor a 9-amino-acid region was reported. ChaA has been shown to catalyze both Na+/H+ and Ca2+/H+ exchange reactions at alkaline pH (16Ohyama T. Igarashi K. Kobayashi H. J. Bacteriol. 1995; 176: 4311-4315Crossref Google Scholar). Essentially nothing is known about molecular properties of Ca2+/H+ antiporters from other organisms, especially those on plasma membranes.Recent genome sequences of cyanobacteria, Synechocystis sp. PCC 6803, Anabaena sp. PCC 7120, and Thermosynechococcus elongatus BP-1 suggest the presence of a single putative Ca2+/H+ antiporter gene (17Kaneko T. Sato S. Kotani H. Tanaka A. Asamizu E. Nakamura Y. Miyajima N. Hirosawa M. Sugiura M. Sasamoto S. Kimura T. Hosouchi T. Matsuno A. Muraki A. Nakazaki N. Naruo K. Okumura S. Shimpo S. Takeuchi C. Wada T. Watanabe A. Yamada M. Yasuda M. Tabata S. DNA Res. 1996; 30: 109-136Crossref Scopus (2108) Google Scholar, 18Kaneko T. Nakamura Y. Wolk C.P. Kuritz T. Sasamoto S. Watanabe A. Iriguchi M. Ishikawa A. Kawashima K. Kimura T. Kishida Y. Kohara M. Matsumoto M. Matsuno A. Muraki A. Nakazaki N. Shimpo S. Sugimoto M. Takazawa M. Yamada M. Yasuda M. Tabata S. DNA Res. 2001; 31: 205-213Crossref Scopus (579) Google Scholar, 19Nakamura Y. Kaneko T. Sato S. Ikeuchi M. Katoh H. Sasamoto S. Watanabe A. Iriguchi M. Kawashima K. Kimura T. Kishida Y. Kiyokawa C. Kohara M. Matsumoto M. Matsuno A. Nakazaki N. Shinpo S. Sugimoto M. Takeuchi C. Yamada M. Tabata S. DNA Res. 2002; 31: 123-130Crossref Scopus (257) Google Scholar). Cyanobacteria are oxygen-evolving photosynthetic prokaryotes that can acclimate to a wide range of environmental changes (20Marin K. Suzuki I. Yamaguchi K. Ribbeck K. Yamamoto H. Kanesaki Y. Hagemann M. Murata N. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 9061-9066Crossref PubMed Scopus (137) Google Scholar, 21Waditee R. Hibino T. Nakamura T. Incharoensakdi A. Takabe T. ..Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4109-4114Crossref PubMed Scopus (116) Google Scholar). Although the role of Ca2+ for stress responses in prokaryotic cells has not been clearly demonstrated, direct evidence of Ca2+ signaling in cyanobacteria has become available recently (22Torrecilla I. Leganes F. Bonilla I. Fernandez-Pinas F. Plant Physiol. 2000; 123: 161-176Crossref PubMed Scopus (75) Google Scholar). Therefore, it was interesting to characterize the putative Ca2+/H+ antiporter of cyanobacteria. Here, we isolated the CAX genes from Synechocystis sp. PCC 6803 (synCAX) and from a halotolerant cyanobacterium Aphanothece halophytica (apCAX). It is shown that SynCAX and ApCAX are localized on plasma membranes and catalyze the efflux of Ca2+, but not of Na+. The exchange activity between Ca2+ and H+ is essential for salt tolerance at alkaline pH in which the acidic amino acid residues in TM segments are involved.MATERIALS AND METHODSStrains and Culture Conditions—A. halophytica cells were grown photoautotropically in BG11 liquid medium plus 18 mm NaNO3 and Turk Island salt solution at 28 °C as described previously (23Ishitani M. Takabe T. Kojima K. Takabe T. Aust. J. Plant Physiol. 1993; 20: 693-703Crossref Scopus (22) Google Scholar, 24Hibino T. Kaku N. Yoshikawa H. Takabe T. Takabe T. Plant Mol. Biol. 1999; 40: 409-418Crossref PubMed Scopus (30) Google Scholar). Synechocystis sp. PCC 6803 and Synechococcus sp. PCC 7942 cells were grown at 30 °C under continuous fluorescent white light (40 microeinsteins m-2 s-1) in BG11 liquid medium supplemented with 10 mm HEPES-KOH and bubbled with 3% CO2. The cells with the disrupted synCAX gene were grown in the same conditions as the wild type except for supplementation with chloramphenicol (150 μg·ml-1). E. coli TO114 cells were grown at 37 °C in LBK medium or Tris-E medium (25Brockman R.W. Heppel L.A. Biochemistry. 1968; 7: 2554-2562Crossref PubMed Scopus (79) Google Scholar). Ampicillin, erythromycin, kanamycin, and chloramphenical were used at final concentrations of 50, 160, 30, and 30 μg ml-1, respectively.Construction of Expression Vectors for ApCAX and SynCAX—The apCAX gene was amplified from genomic DNA of A. halophytica by the primer set, ApCa/H-F1 and ApCa/H-R1. The sequences of all the primers are shown in Table I. The synCAX (slr1336) was amplified from genomic DNA of Synechocystis sp. PCC 6803 by the primer set, SynCa/H-F1 and SynCa/H-R1. PCR products for apCAX and synCAX, were ligated into the EcoRV restriction site of pBSK+ (Stratagene, La Jolla, CA) and sequenced. The resulting plasmids were designated as pAp-CAX-SK and pSynCAX-SK, respectively. The plasmid pApCAX-SK was digested with NcoI and BamHI, whereas plasmid pSynCAX-SK was digested with BamHI. The resulting fragments were ligated into the corresponding sites of pTrcHis2C (Invitrogen). The generated plasmids, pApCAX and pSynCAX, fused in-frame to six histidines at the C-terminal, were transformed first to E. coli DH5α cells and then to E. coli T0114 cells in which the nhaA, nhaB, and chaA genes were deleted (16Ohyama T. Igarashi K. Kobayashi H. J. Bacteriol. 1995; 176: 4311-4315Crossref Google Scholar, 26Waditee R. Hibino T. Tanaka Y. Nakamura T. Incharoensakdi A. Takabe T. J. Biol. Chem. 2001; 276: 36931-36938Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). The preparation of an expression vector for the Na+/H+ antiporter from Synechocystis sp. PCC 6803 (SynNhaP1) was described previously (27Hamada A. Hibino T. Nakamura T. Takabe T. Plant Physiol. 2001; 125: 437-446Crossref PubMed Scopus (71) Google Scholar).Table IPrimers used for isolation and expression of Ca2+/H+ antiporter genesPrimers5′–3′Base pairsApCa/H-F1TTATATGTTGAATAAAAATACGATCTTTTTT31 merApCa/H-R1CTGGATCCACCAATTTCAGGAACAACA27 merSynCa/H-F1ATGGATCCCAAAAGTAAGATTTTTCTTG28 merSynCa/H-R1ACGGATCCACCAGGGTGGGATGAAA25 merpACYCcml-FATCGGCACGTAAGAGGTTCCAACT24 merpACYCcml-RGCTTTCGAATTTCTGCCATTCATC24 merE74DQH-FGGCAATGCGACCCSAMCTGATTTTAGCGT28 merE74DQH-RACGCTAAAATCAGKTSGGTCGCATTGCC28 merE324DQH-FAATCCCTTTKAMTTAGTGGCAGTAGCCG28 merE324DQH-RCGGATACTGCCACTAAKTSAAAGGGATT28 merApCa/HProFAACCATGGCATCCGTTTTGGGTTAATG27 merApCa/HProRCACCATGGAAGTTTTATGATTTCAAATAAG30 merSynCa/HProFTTGGATCCGCGAATTTTTGACAACCTT27 merSynCa/HProRGTGGATCCATCCTGGCGATCGCCAT25 merHisBamHIGTGGATCCTCAATGATGATGATGATG26 mer Open table in a new tab For the construction of an expression vector for ApCAX in cyanobacteria, the promoter region of ApCAX ∼400 bp was amplified from the genomic DNA of A. halophytica using the primer sets, ApCa/HProF and ApCa/HproR, and ligated into the NcoI site of pApCAX. After checking the orientation of the promoter, the full length of ApCAX containing both the promoter and a His tag was amplified by the primer set, ApCa/HproF and HisBamHI, blunt-ended, and ligated into the BamHI-digested site of the E. coli/Synechococcus shuttle vector, pUC303-Bm (21Waditee R. Hibino T. Nakamura T. Incharoensakdi A. Takabe T. ..Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4109-4114Crossref PubMed Scopus (116) Google Scholar). The resulting plasmid was used to transform Synechococcus sp. PCC7942 cells (21Waditee R. Hibino T. Nakamura T. Incharoensakdi A. Takabe T. ..Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4109-4114Crossref PubMed Scopus (116) Google Scholar). Essentially, the same method was used for Syn-CAX. In this case, the promoter region was amplified using the primer set, SynCa/HProF and SynCa/HproR.Site-directed Mutagenesis of apCAX—Changes of amino acids, Glu-74 and Glu-324, in ApCAX to Asp, Gln, and His were carried out by the PCR method as described previously (28Waditee R. Hibino T. Tanaka Y. Nakamura T. Incharoensakdi A. Hayakawa S. Futsuhara Y. Kawamitsu Y. Takabe T. Takabe T. J. Biol. Chem. 2002; 277: 18373-18382Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Briefly, for the case of Glu-74 mutants, two fragments were amplified by the primer sets, ApCa/H-F1 and E74DQH-R and E74DQH-F and ApCa/H-R, using the pApCAX-SK as the template. After removing the primer sets, two PCR-amplified fragments were mixed, heated, and annealed and were then used as the templates for amplification by the primer sets, ApCa/H-F1 and ApCa/H-R1. PCR products were ligated into the EcoRV restriction site of pBSK+ and sequenced. The mutants E74D, E74Q, and E74H were transferred to pTrcHis2C and used for the transformation of TO114. The mutants E324D, E324Q, and E324H were constructed essentially by the same method.Ca2+/H+ Antiporter Activity—TO114 cells were grown in LBK medium containing ampicillin, erythromycin, kanamycin, and chloramphenical. When the A620 reached 0.6–0.8, 0.5 mm isopropyl-β-d-thiogalactopyranoside was added. Cells were allowed to grow for a further 3 h and then harvested by centrifugation. Everted membranes were prepared using a French press as described previously (27Hamada A. Hibino T. Nakamura T. Takabe T. Plant Physiol. 2001; 125: 437-446Crossref PubMed Scopus (71) Google Scholar, 29Nakamura T. Komano Y. Unemoto T. Biochim. Biophys. Acta. 1995; 1230: 170-176Crossref PubMed Scopus (32) Google Scholar). The antiporter activity was assayed based upon the establishment of ΔpH (TM pH gradient) by the addition of salt to the reaction mixture, which contained 10 mm Tris-Cl (titrated with HCl to the indicated pH), 140 mm choline chloride or 140 mm KCl, 1 μm acridine orange, and membrane vesicles (50–75 μg of protein) in a volume of 2 ml. The ΔpH was monitored with acridine orange fluorescence, which was obtained by excitation at 492 nm and emission at 525 nm. Before the addition of salt, Tris-dl-lactate (2 mm) was added to initiate fluorescence quenching (Q) due to respiration. Lactate energized the vesicles, which then accumulated H+ internally, causing the accumulation of dye whose fluorescence was thereby quenched. Upon the addition of salt, fluorescence increased due to the excretion of H+ by the antiporters and consequent leakage of the dye. The changes in fluorescence (ΔQ) were monitored. Then, NH4Cl was added to dissipate the ΔpH.Disruption of synCAX—The synCAX in Synechocystis sp. PCC6803 was disrupted by insertion of the chloramphenical resistance gene (cmlr). The DNA fragment, ∼0.8 kbp, covering cmlr was amplified by the primer set, pACYCcml-F and pACYCcml-R, using pACYC184 (New England Biolabs, Beverly, MA) as a template. The PCR product was subcloned into the EcoRV restriction site of pBSK+ and then digested with HincII and SmaI of pBSK+. The blunt-ended fragment of cmlr was ligated into the NcoI site at position 543 bp of synCAX in pSynCAXSK+, which was prepared by partial digestion with NcoI and blunting. Insertion of the cmlr cassette into the correct site was confirmed by DNA sequencing. The cmlr-containing synCAX was transferred to Synechocystis sp. PCC6803 by electroporation (500 V, 48 ohms, and 125 microfarads) using an Electrocell Manipulator (model 600 M; BTX). The disrupted mutants were selected on BG11 medium containing 0.5% agar supplemented with chloramphenical at a final concentration of 150 μg/ml.Detection of Ca2+ Efflux and Membrane Potential—To prepare the Ca2+-loading cells, both the wild type and disrupted cells were incubated for 1 h with 50 mm Ca2+ in buffer A (20 mm HEPES and 140 mm KCl) at various pH values (30Tsujibo H. Rosen B.P. J. Biol. Chem. 1983; 154: 854-858Google Scholar, 31Nazarenko L.V. Andreev I.M. Lyukevich A.A. Pisareva T.V. Los D.A. Microbiology (Read.). 2003; 149: 1147-1153Crossref PubMed Scopus (34) Google Scholar). Ca2+-loaded cells were diluted 10-fold in buffer A and then transferred to the assay medium containing Ca2+ indicator (2 ml) (20 mm HEPES, pH 7.2, 3 mm MgSO4, 27 μm arsenazo III) (31Nazarenko L.V. Andreev I.M. Lyukevich A.A. Pisareva T.V. Los D.A. Microbiology (Read.). 2003; 149: 1147-1153Crossref PubMed Scopus (34) Google Scholar). Ca2+ efflux from the Synechocystis sp. PCC 6803 cells was monitored by the absorbance change of arsenazo III with a Hitachi 557 spectrophotometer in double wavelength mode (650–720 nm). The plasma membrane potential of Synechocystis cells was assayed with the potential-sensitive cyanide dye diS-C3-(5) (31Nazarenko L.V. Andreev I.M. Lyukevich A.A. Pisareva T.V. Los D.A. Microbiology (Read.). 2003; 149: 1147-1153Crossref PubMed Scopus (34) Google Scholar). The assay medium (1 ml) had the same composition as that used for the detection of Ca2+ efflux, but it was supplemented with 1 μm diS-C3-(5). The fluorescence was measured by excitation at 620 nm and emission at 670 nm with a Shimadzu RF-5300PC spectrofluorophotometer.Other Methods—The nucleotide sequences were determined using an ABI310 genetic analyzer (Applied Biosystems, Foster City, CA). Cellular ions were determined by Shimadzu Personal Ion Analyzer PIA-1000. SDS-PAGE and Western blotting analysis were carried out as described previously (27Hamada A. Hibino T. Nakamura T. Takabe T. Plant Physiol. 2001; 125: 437-446Crossref PubMed Scopus (71) Google Scholar, 28Waditee R. Hibino T. Tanaka Y. Nakamura T. Incharoensakdi A. Hayakawa S. Futsuhara Y. Kawamitsu Y. Takabe T. Takabe T. J. Biol. Chem. 2002; 277: 18373-18382Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). An antibody raised against His6 (His6-His tag) was obtained from R&D systems (Minneapolis, MN). Protein was determined by Lowry's method as described (27Hamada A. Hibino T. Nakamura T. Takabe T. Plant Physiol. 2001; 125: 437-446Crossref PubMed Scopus (71) Google Scholar). Chlorophyll a was extracted by 90% methanol in dim light and calculated from the absorbance at 665 nm (21Waditee R. Hibino T. Nakamura T. Incharoensakdi A. Takabe T. ..Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4109-4114Crossref PubMed Scopus (116) Google Scholar, 32Tandeau de Marsac N. Houmard J. Methods Enzymol. 1988; 167: 318-328Crossref Scopus (265) Google Scholar). For the preparation of phycobiliproteins, Synechocystis sp. PCC6803 cells were sonicated, streptomycin sulfate (1%) was added, and homogenate was centrifuged (32Tandeau de Marsac N. Houmard J. Methods Enzymol. 1988; 167: 318-328Crossref Scopus (265) Google Scholar). Using the resulting supernatant, the phycobiliprotein content was determined spectrophotometrically. Plasma membranes were prepared by a discontinuous sucrose density gradient centrifugation method (33Murata N. Omata T. Methods Enzymol. 1988; 167: 245-251Crossref Scopus (89) Google Scholar).Computer Analysis—The hydropathy profile of proteins was predicted by the computer-assisted procedure according to the method of Kyte and Doolittle (34Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17009) Google Scholar). The possible TM structure of ApCAX was predicted by the computer program TopPredII (35Hofmann K. Stoffel W. Comput. Appl. Biosci. 1992; 8: 331-337PubMed Google Scholar).RESULTSCloning of Putative Ca2+/H+ Antiporter Genes from A. halophytica and Synechocystis Cells—From the shotgun clones of A. halophytica, one open reading frame homologous to the syn-CAX was found. Its gene was isolated by a PCR method and sequenced as described under "Materials and Methods." The predicted gene product ApCAX consists of 373 amino acids with a molecular mass of 39,710 Da (Fig. 1A). The ClustalW analysis of seven kinds of CAXs (Fig. 1B) showed highest homology to the CAX from Synechocystis sp. PCC 6803 (SynCAX) (69%) and then to vacuolar antiporters from Saccharomyces cerevisiae (ScVCX1) (43%), Neurospora crassa (NcCAX) (40%), Vigna ra- diata (VrCAX) (39%), and Arabidopsis thaliana (AtCAX1) (38%), and lowest homology to E. coli ChaA (35%). These facts indicate that ApCAX shows high homology to the cyanobacterial antiporters and considerable homology to those from vacuolar CAXs and ChaA. It would be noted that ApCAX showed lower homology to E. coli ChaA than it showed to vacuolar CAXs. It is also evident that vacuolar CAXs have longer N-terminal sequences than those of prokaryotic CAXs (Fig. 1A). Analysis of the hydropathy plot and the TM prediction program predicted 11 putative TM-spanning segments in these CAXs (Fig. 1, A and C). All CAXs contain a central hydrophilic motif, rich in acidic amino acid residues (Fig. 1, A and C).Construction of Expression Vectors for apCAX and synCAX, and Their Expression in E. coli—Expression vectors for ApCAX and SynCAX were constructed as described under "Materials and Methods" (Fig. 2A). Western blotting analysis indicated that ApCAX and SynCAX could be expressed in E. coli with reasonable size and similar expression levels, which would provide the basis for functional comparison of these CAXs (Fig. 2B).Fig. 2Expression of ApCAX and SynCAX in E. coli. ApCAX and SynCAX were expressed in TO114, and everted membranes were prepared. ApCAX and SynCAX were detected with the antibody raised against the His6-His tag.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Complementation Test in E. coli TO114 —It has been reported that plant vacuolar CAXs such as AtCAX1–4 could not complement the Ca2+-sensitive phenotype of a yeast vacuolar mutant deleted of the vacuolar Ca2+-ATPase and Ca2+/H+ antiporter (ScVCX1) when expressed at full length (7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar, 9Hirschi K.D. Korenkov V.D. Wilganowski N.L. Wagner G.J. Plant Physiol. 2000; 124: 125-1338Crossref PubMed Scopus (390) Google Scholar, 12Cheng N.H. Pittman J.K. Shigaki T. Hirschi K.D. Plant Physiol. 2002; 128: 1245-1254Crossref PubMed Scopus (107) Google Scholar, 14Cheng N.H. Hirschi K.D. J. Biol. Chem. 2003; 278: 6503-6509Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar) but did complement the yeast mutant when expressed with an N-terminal deletion (7Hirschi K.D. Zhen R.G. Cunningham K.W. Rea P.A. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8782-87868Crossref PubMed Scopus (238) Google Scholar, 9Hirschi K.D. Korenkov V.D. Wilganowski N.L. Wagner G.J. Plant Physiol. 2000; 124: 125-1338Crossref PubMed Scopus (390) Google Scholar, 12Cheng N.H. Pittman J.K. Shigaki T. Hirschi K.D. Plant Physiol. 2002; 128: 1245-1254Crossref PubMed Scopus (107) Google Scholar, 13Pittman J.K. Sreevidya C.S. Shigaki T. Ueoka-Nakanishi H. Hirschi K.D. Plant Physiol. 2002; 130: 1054-1062Crossref PubMed Scopus (51) Google Scholar, 14Cheng N.H. Hirschi K.D. J. Biol. Chem. 2003; 278: 6503-6509Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). In AtCAX1, the autoinhibition domain contains 36 amino acid residues. Therefore, we examined whether ApCAX and SynCAX could complement the salt-sensitive phenotype of E. coli mutant TO114 cells. Due to the absence of the nhaA, nhaB, and chaA genes, TO114 cells could not grow if the medium contained 100 mm CaCl2 (Fig. 3A), 200 mm NaCl (Fig. 3B), or 4 mm LiCl (Fig. 3C) (16Ohyama T. Igarashi K. Kobayashi H. J. Bacteriol. 1995; 176: 4311-4315Crossref Google Scholar, 26Waditee R. Hibino T. Tanaka Y. Nakamura T. Incharoensakdi A. Takabe T. J. Biol. Chem. 2001; 276: 36931-36938Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 27Hamada A. Hibino T. Nakamura T. Takabe T. Plant Physiol. 2001; 125: 437-446Crossref PubMed Scopus (71) Google Scholar). However, the TO114 cells expressing ApCAX a
Referência(s)