Processing, Stability, and Receptor Binding Properties of Oligomeric Envelope Glycoprotein from a Primary HIV-1 Isolate
2000; Elsevier BV; Volume: 275; Issue: 45 Linguagem: Inglês
10.1074/jbc.m003868200
ISSN1083-351X
AutoresIsabelle Staropoli, Chantal Chanel, Marc Girard, Ralf Altmeyer,
Tópico(s)Complement system in diseases
ResumoThe envelope glycoprotein of human immunodeficiency virus type 1 (HIV-1) is thought to exist on the virion surface as a trimer of non-covalently associated gp120/gp41 molecules. We expressed trimeric envelope glycoprotein from three primary, macrophage tropic HIV-1 isolates in baby hamster kidney cells and analyzed the furin-mediated cleavage, stability, and receptor binding properties of the oligomers. The envelope glycoprotein was secreted in a soluble form deleted of its transmembrane anchor and the intracytoplasmic domain (gp140). A mixture of trimers, dimers, and monomers of gp140 as well as monomeric gp120 was detected on polyacrylamide gels. Analysis by sucrose gradient centrifugation revealed that trimers and dimers were essentially composed of uncleaved gp140, whereas most of the gp120 was found in the monomeric fraction. To analyze the effect of the cleavage of gp140 to gp120/Δ41 on trimerization, we co-expressed the furin protease along with gp140. Surprisingly, furin expression changed the subcellular localization of the envelope glycoprotein, which became in majority sequestered in the major furin compartment, the trans-Golgi network, as judged by confocal laser microscopy. The envelope glycoprotein secreted from furin-co-expressing cells was almost completely cleaved to gp120 and Δgp41, but gp120 was found exclusively in the monomeric fraction, with a few residual oligomers being composed of uncleaved gp140. Secreted uncleaved gp140 trimers were purified to homogeneity and analyzed for their capacity to interact with cellular receptors CD4 and CC chemokine receptor 5 (CCR5). Receptor binding was analyzed on CD4- and CCR5-expressing cells as well as on peripheral blood mononuclear cells. Trimers showed greatly reduced binding to CD4 as compared with monomers. Neither monomers nor trimers bound directly to CCR5. In conclusion, our results show that the cleaved form of the envelope glycoprotein does not form stable trimers, suggesting that gp120/gp41 oligomers on the virion surface might be stabilized by a yet to be identified mechanism and that the virion might attach to CD4 via a monomeric form of gp120. These results are relevant to the development of an envelope-based vaccine against AIDS. The envelope glycoprotein of human immunodeficiency virus type 1 (HIV-1) is thought to exist on the virion surface as a trimer of non-covalently associated gp120/gp41 molecules. We expressed trimeric envelope glycoprotein from three primary, macrophage tropic HIV-1 isolates in baby hamster kidney cells and analyzed the furin-mediated cleavage, stability, and receptor binding properties of the oligomers. The envelope glycoprotein was secreted in a soluble form deleted of its transmembrane anchor and the intracytoplasmic domain (gp140). A mixture of trimers, dimers, and monomers of gp140 as well as monomeric gp120 was detected on polyacrylamide gels. Analysis by sucrose gradient centrifugation revealed that trimers and dimers were essentially composed of uncleaved gp140, whereas most of the gp120 was found in the monomeric fraction. To analyze the effect of the cleavage of gp140 to gp120/Δ41 on trimerization, we co-expressed the furin protease along with gp140. Surprisingly, furin expression changed the subcellular localization of the envelope glycoprotein, which became in majority sequestered in the major furin compartment, the trans-Golgi network, as judged by confocal laser microscopy. The envelope glycoprotein secreted from furin-co-expressing cells was almost completely cleaved to gp120 and Δgp41, but gp120 was found exclusively in the monomeric fraction, with a few residual oligomers being composed of uncleaved gp140. Secreted uncleaved gp140 trimers were purified to homogeneity and analyzed for their capacity to interact with cellular receptors CD4 and CC chemokine receptor 5 (CCR5). Receptor binding was analyzed on CD4- and CCR5-expressing cells as well as on peripheral blood mononuclear cells. Trimers showed greatly reduced binding to CD4 as compared with monomers. Neither monomers nor trimers bound directly to CCR5. In conclusion, our results show that the cleaved form of the envelope glycoprotein does not form stable trimers, suggesting that gp120/gp41 oligomers on the virion surface might be stabilized by a yet to be identified mechanism and that the virion might attach to CD4 via a monomeric form of gp120. These results are relevant to the development of an envelope-based vaccine against AIDS. human immunodeficiency virus type 1 macrophage-tropic glycoprotein multiplicity of infection monoclonal antibody peripheral blood mononuclear cells Semliki Forest virus CC chemokine receptor macrophage inflammatory protein baby hamster kidney cells Glasgow's modified Eagle's medium fetal calf serum phosphate-buffered saline ethylene glycolbis(sulfosuccinimidylsucccinate) polyacrylamide gel electrophoresis fluorescein isothiocyanate post-infection The HIV-11 envelope glycoprotein is synthesized as an approximately 845–870-amino acid precursor in the rough endoplasmic reticulum. High-mannose sugar chains are added to asparagine residues to form the gp160 glycoprotein, which assembles into oligomers (1Wyatt R. Sodroski J. Science. 1998; 280: 1884-1888Crossref PubMed Scopus (1295) Google Scholar, 2Earl P.L. Doms R.W. Moss B. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 648-652Crossref PubMed Scopus (295) Google Scholar, 3Pinter A. Honnen W.J. Tilley S.A. Bona C. Zaghouani H. Gorny M.K. Zolla-Pazner S. J. Virol. 1989; 63: 2674-2679Crossref PubMed Google Scholar, 4Lu M. Blacklow S.C. Kim P.S. Nat. Struct. Biol. 1995; 2: 1075-1082Crossref PubMed Scopus (667) Google Scholar, 5Schawaller M. Smith G.E. Skehel J.J. Wiley D.C. Virology. 1989; 172: 367-369Crossref PubMed Scopus (120) Google Scholar, 6Weiss C.D. Levy J.A. White J.M. J. Virol. 1990; 64: 5674-5677Crossref PubMed Google Scholar). The gp160 oligomers are transported to the Golgi apparatus, where cleavage by the cellular protease furin (7Hallenberger S. Bosch V. Angliker H. Shaw E. Klenk H.D. Garten W. Nature. 1992; 360: 358-361Crossref PubMed Scopus (474) Google Scholar) or a related enzyme of the subtilisin family generates the mature envelope glycoproteins: gp120, the exterior envelope glycoprotein, and gp41, the transmembrane glycoprotein. The gp41 glycoprotein includes a fusion peptide and an ectodomain that is implicated in trimerization (8Weissenhorn W. Dessen A. Harrison S.C. Skehel J.J. Wiley D.C. Nature. 1997; 387: 426-430Crossref PubMed Scopus (1454) Google Scholar, 9Shugars D.C. Wild C.T. Greenwell T.K. Matthews T.J. J. Virol. 1996; 70: 2982-2991Crossref PubMed Google Scholar, 10Chan D.C. Fass D. Berger J.M. Kim P.S. Cell. 1997; 89: 263-273Abstract Full Text Full Text PDF PubMed Scopus (1822) Google Scholar), a membrane-spanning anchor, and a long cytoplasmic tail. Crystallization studies suggest that the core of the fusion-active envelope oligomer is a trimeric structure of 36 amino acids located toward the N terminus of gp41 (10Chan D.C. Fass D. Berger J.M. Kim P.S. Cell. 1997; 89: 263-273Abstract Full Text Full Text PDF PubMed Scopus (1822) Google Scholar). This sequence forms an interior, parallel coiled-coil trimer, whereas three helices of a sequence closer to the C terminus of gp41 pack in an oblique, antiparallel manner into highly conserved, hydrophobic grooves on the surface of this trimer. This structure resembles the low pH-induced conformation of influenza hemagglutinin. The gp120 and gp41 glycoproteins are held together by noncovalent interactions between the gp41 ectodomain and discontinuous structures composed of N- and C-terminal gp120 sequences (11Helseth E. Olshevsky U. Furman C. Sodroski J. J. Virol. 1991; 65: 2119-2123Crossref PubMed Google Scholar). When they reach the infected cell surface, a fraction of these envelope glycoprotein complexes is incorporated into budding virus particles. gp120/gp41 complexes on the virion surface as well as at the plasma membrane of infected cells are functional as they can mediate fusion with CD4+/CCR5+ cells. Given their non-covalent association, these complexes can disassemble, releasing gp120 and exposing the previously buried gp41 ectodomain. Most of the surface-exposed elements of the mature, oligomeric envelope glycoprotein complex (reviewed in Ref. 12Wyatt R. Kwong P.D. Desjardins E. Sweet R.W. Robinson J. Hendrickson W.A. Sodroski J.G. Nature. 1998; 393: 705-711Crossref PubMed Scopus (1070) Google Scholar), such as the CD4 (13Lasky L.A. Nakamura G. Smith D.H. Fennie C. Shimasaki C. Patzer E. Berman P. Gregory T. Capon D.J. Cell. 1987; 50: 975-985Abstract Full Text PDF PubMed Scopus (602) Google Scholar) and coreceptor binding domains (14Thali M. Moore J.P. Furman C. Charles M. Ho D.D. Robinson J. Sodroski J. J. Virol. 1993; 67: 3978-3988Crossref PubMed Google Scholar, 15Trkola A. Dragic T. Arthos J. Binley J.M. Olson W.C. Allaway G.P. Cheng-Mayer C. Robinson J. Maddon P.J. Moore J.P. Nature. 1996; 384: 184-187Crossref PubMed Scopus (952) Google Scholar) as well as major neutralization epitopes, are contained on the gp120 glycoprotein (16Trkola A. Purtscher M. Muster T. Ballaun C. Buchacher A. Sullivan N. Srinivasan K. Sodroski J. Moore J.P. Katinger H. J. Virol. 1996; 70: 1100-1108Crossref PubMed Google Scholar). Evidence from studies of virion-associated (5Schawaller M. Smith G.E. Skehel J.J. Wiley D.C. Virology. 1989; 172: 367-369Crossref PubMed Scopus (120) Google Scholar, 6Weiss C.D. Levy J.A. White J.M. J. Virol. 1990; 64: 5674-5677Crossref PubMed Google Scholar) or recombinant (2Earl P.L. Doms R.W. Moss B. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 648-652Crossref PubMed Scopus (295) Google Scholar, 17Altmeyer R. Mordelet E. Girard M. Vidal C. Virology. 1999; 259: 314-323Crossref PubMed Scopus (16) Google Scholar, 18VanCott T.C. Veit S.C. Kalyanaraman V. Earl P. Birx D.L. J. Immunol. Methods. 1995; 183: 103-117Crossref PubMed Scopus (36) Google Scholar, 19Hallenberger S. Tucker S.P. Owens R.J. Bernstein H.B. Compans R.W. Virology. 1993; 193: 510-514Crossref PubMed Scopus (39) Google Scholar) envelope glycoprotein support the idea that the HIV envelope glycoprotein is a trimer or tetramer. However, these studies did not show purified trimeric envelope complexes composed of cleaved gp120/gp41. HIV entry requires the interaction of the gp120 subunit of the envelope glycoprotein with specific receptors: the CD4 glycoprotein (13Lasky L.A. Nakamura G. Smith D.H. Fennie C. Shimasaki C. Patzer E. Berman P. Gregory T. Capon D.J. Cell. 1987; 50: 975-985Abstract Full Text PDF PubMed Scopus (602) Google Scholar, 20Dalgleish A.G. Beverley P.C. Clapham P.R. Crawford D.H. Greaves M.F. Weiss R.A. Nature. 1984; 312: 763-767Crossref PubMed Scopus (2556) Google Scholar, 21Klatzmann D. Champagne E. Chamaret S. Gruest J. Guetard D. Hercend T. Gluckman J.C. Montagnier L. Nature. 1984; 312: 767-768Crossref PubMed Scopus (1746) Google Scholar) and members of the chemokine receptor family (22Doranz B.J. Rucker J. Yi Y.J. Smyth R.J. Samson M. Peiper S.C. Parmentier M. Collman R.G. Doms R.W. Cell. 1996; 85: 1149-1158Abstract Full Text Full Text PDF PubMed Scopus (1682) Google Scholar, 23Deng H. Liu R. Ellmeier W. Choe S. Unutmaz D. Burkhart M. Di Marzio P. Marmon S. Sutton R.E. Hill C.M. Davis C.B. Peiper S.C. Schall T.J. Littman D.R. Landau N.R. Nature. 1996; 381: 661-666Crossref PubMed Scopus (3186) Google Scholar, 24Feng Y. Broder C.C. Kennedy P.E. Berger E.A. Science. 1996; 272: 872-877Crossref PubMed Scopus (3614) Google Scholar). Binding to CD4 is a major determinant of HIV tropism in vivo, illustrated by the presence of CD4 on the surface of the main target cells,e.g. T lymphocytes, monocytes, macrophages, dendritic cells, and brain microglia. Binding of gp120 to CD4 results in a conformational change in gp120, which contributes to the formation or exposure of the binding site for the coreceptor (25Kwong P.D. Wyatt R. Robinson J. Sweet R.W. Sodroski J. Hendrickson W.A. Nature. 1998; 393: 648-659Crossref PubMed Scopus (2492) Google Scholar, 26Rizzuto C.D. Wyatt R. Hernandez-Ramos N. Sun Y. Kwong P.D. Hendrickson W.A. Sodroski J. Science. 1998; 280: 1949-1953Crossref PubMed Scopus (751) Google Scholar). The major coreceptor for syncytium-inducing strains appearing at the late stages of AIDS progression as well as T-cell line-adapted strains is CXCR4, a receptor for the CXC chemokine stroma cell-derived factor (SDF) 1α (27Oberlin E. Amara A. Bachelerie F. Bessia C. Virelizier J.L. Arenzana-Seisdedos F. Schwartz O. Heard J.M. Clark-Lewis I. Legler D.F. Loetscher M. Baggiolini M. Moser B. Nature. 1996; 382: 833-835Crossref PubMed Scopus (1470) Google Scholar), although all primary M-tropic strains of HIV-1 described to date have been shown to be capable of using CC chemokine receptor (CCR) 5 (28Zhang Y.J. Dragic T. Cao Y.Z. Kostrikis L. Kwon D.S. Littman D.R. Kewalramani V.N. Moore J.P. J. Virol. 1998; 72: 9337-9344Crossref PubMed Google Scholar, 29Zhang L.Q. He T. Huang Y.X. Chen Z.W. Guo Y. Wu S. Kunstman K.J. Brown R.C. Phair J.P. Neumann A.U. Ho D.D. Wolinsky S.M. J. Virol. 1998; 72: 9307-9312Crossref PubMed Google Scholar), a receptor for the β-chemokines macrophage inflammatory protein (MIP) 1α and β and RANTES (regulated upon activation, normal T cell-expressed and -secreted) (23Deng H. Liu R. Ellmeier W. Choe S. Unutmaz D. Burkhart M. Di Marzio P. Marmon S. Sutton R.E. Hill C.M. Davis C.B. Peiper S.C. Schall T.J. Littman D.R. Landau N.R. Nature. 1996; 381: 661-666Crossref PubMed Scopus (3186) Google Scholar). These binding events result in the exposure of the previously hidden fusion peptide of gp41 and its penetration into the target cell membrane (30Chan D.C. Kim P.S. Cell. 1998; 93: 681-684Abstract Full Text Full Text PDF PubMed Scopus (1106) Google Scholar), leading to fusion of the virion with the plasma membrane. We report here on the production, purification, and characterization of soluble trimeric envelope glycoprotein from primary macrophage-tropic isolates of HIV-1. Purified trimers are important tools to study the interaction of native envelope with cellular receptors and to analyze their immunogenic potential in view of the development of an anti-HIV subunit vaccine. All enzymes and kits used for molecular cloning were purchased from Roche Molecular Biochemicals and Biolabs. cDNAs corresponding to the gp140 sequences of three different HIV-1 primary isolates, the receptors CD4 and CCR5, and furin convertase were amplified by polymerase chain reaction using the following primer pairs: gp140BX08 (plasmid p133.3 (31Verrier F.C. Charneau P. Altmeyer R. Laurent S. Borman A.M. Girard M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9326-9331Crossref PubMed Scopus (39) Google Scholar)), 5′-GCGCGGATCCGAAGTCATGAAAGTGAAGGAGACC-3′ and 5′-CGCGGGATCCGCTCTAGATTAGTGATGGTGATGGTGATGATTTGTTATGTTGAACCAATT-3′; gp140BX17 (plasmid pTAdvBX17, a gift of Sentob Saragosti), 5′-CCATCGATATGAGAGCGAGGGAGATACAGAGG-3′ and 5′-TCCCCCCGGGTTAGTGATGGTGATGGTGATGATACCATAGCCAATGTGATATGTC-3′; gp140E402 (plasmid pSP72–90CR402 (32Gao F. Robertson D.L. Morrison S.G. Hui H. Craig S. Decker J. Fultz P.N. Girard M. Shaw G.M. Hahn B.H. Sharp P.M. J. Virol. 1996; 70: 7013-7029Crossref PubMed Google Scholar)), 5′-CGCGCCTCGAGCGGGATCCATGGCTCGCTCGGTGACCCTAGTCTTTCTGGTGCTTGTCTCACTGACCGGCTTGTATGCTATCCAGAAATCAGACAACTTGTGGGTTACAGTT-3′ and 5′-CGGCTAGCCGGATCCTTAGTGATGGTGATGGTGATGCCTTGTTATGTCAAACCAATTCCA-3′; human CD4 (plasmid pT4B (33Maddon P.J. Dalgleish A.G. McDougal J.S. Clapham P.R. Weiss R.A. Axel R. Cell. 1986; 47: 333-348Abstract Full Text PDF PubMed Scopus (1500) Google Scholar, 34Littman D.R. Maddon P.J. Axel R. Cell. 1988; 55: 541Abstract Full Text PDF PubMed Scopus (22) Google Scholar)), 5′-ATATGGATCCATGAACCGGGGAGTC-3′ and 5′-ATATGGATCCTCAAATGGGGCTACATGTC-3′; human furin convertase (plasmid pGEMhfur, a gift of Maxime Moulard), 5′-ATATTGCGCGCATGGAGCTGAGGCCCTGG-3′ and 5′- ATATTATGCATTCAGAGGGCGCTCTGGT-3′. The CCR5 cDNA was excised byBamHI digestion directly from a pCI (CLONTECH, Palo Alto, CA)-based plasmid coding for a CCR5-enhanced green fluorescent fusion protein (35Amara A. Gall S.L. Schwartz O. Salamero J. Montes M. Loetscher P. Baggiolini M. Virelizier J.L. Arenzana-Seisdedos F. J. Exp. Med. 1997; 186: 139-146Crossref PubMed Scopus (517) Google Scholar). Polymerase chain reaction fragments coding for the envelope sequences and CD4 were digested with BamHI, polymerase chain reaction fragments amplified from pGEMhfur were digested with BssHII and NsiI, and the SFV vector plasmid pSFV-1 (36Berglund P. Sjoberg M. Garoff H. Atkins G.J. Sheahan B.J. Liljeström P. Biotechnology. 1993; 11: 916-920Crossref PubMed Scopus (252) Google Scholar, 37Liljeström P. Garoff H. Biotechnology. 1991; 9: 1356-1361Crossref PubMed Scopus (731) Google Scholar) or pSFV-2 (38Meanger J. Peroulis I. Mills J. Biotechniques. 1997; 23: 432-434Crossref PubMed Scopus (14) Google Scholar) was digested with XbaI and ClaI (140BX17), BssHII and NsiI (hfurine), orBamHI (140BX08, 140E402, CD4, CCR5). Fragments were purified and ligated with cut pSFV-1 or pSFV-2, resulting in plasmids pSFVΔenvBX08, pSFVΔenvBX17, pSFVΔenvE402, pSFVCD4, pSFVCCR5, and pSFVhfur. Plasmid pSFVlacZ was a gift from Peter Liljeström and Henrik Garoff (37Liljeström P. Garoff H. Biotechnology. 1991; 9: 1356-1361Crossref PubMed Scopus (731) Google Scholar). BHK-21 cells were grown in tissue culture flasks (Falcon) at 37 °C, 5% CO2, in GMEM medium (Life Technologies, Inc.) supplemented with 20 mm Hepes (Life Technologies, Inc.), tryptose phosphate broth (10%), 100 units/ml penicillin, 100 μg/ml streptomycin, and 5% fetal calf serum (FCS; Life Technologies, Inc.). Recombinant defective SFV particles were synthesized as described previously (36Berglund P. Sjoberg M. Garoff H. Atkins G.J. Sheahan B.J. Liljeström P. Biotechnology. 1993; 11: 916-920Crossref PubMed Scopus (252) Google Scholar, 37Liljeström P. Garoff H. Biotechnology. 1991; 9: 1356-1361Crossref PubMed Scopus (731) Google Scholar). Briefly, plasmids pSFV-helper2, pSFVΔenvBX08, pSFVΔenvBX17, pSFVΔenvE402, pSFVCD4, pSFVCCR5, pSFVlacZ, and pSFVhfur were digested with SpeI or SphI (pSFVΔenvE402), purified, and in vitrotranscribed using SP6 RNA polymerase in a buffer containing cap analog. After analysis of RNAs on agarose gels, pSFV-helper2-derived RNA was admixed to equal quantities of RNA derived from plasmids pSFVΔenvBX08, pSFVΔenvBX17, pSFVΔenvE402, pSFVCD4, or pSFVCCR5. The RNA mixtures were added to 8 × 106 BHK-21 cells in 800 μl of PBS and immediately transferred to a 0.4-cm electroporation cuvette (Eurogentec). The RNA-cell mixture was subjected to two 0.4-ms pulses at 830 V and 25 microfarads in a Bio-Rad gene pulser and plated into 75-cm2 flasks in GMEM medium containing 5% FCS. 24 h later the supernatant containing recombinant defective SFV particles was harvested, concentrated by ultracentrifugation, and separated into aliquots. Before infection aliquots were activated by chymotrypsin digestion. For infection with recombinant SFV, cells were washed with serum-free GMEM and incubated with dilutions of viral particles in 2% GMEM for 1 h at 37 °C followed by incubation in 5% FCS GMEM. At 6 h post-infection, the medium was replaced by 0% FCS GMEM for standard protein purification and by 0% FCS methionine free-DMEM containing 35S-labeled methionine for the production of radiolabeled gp140. Synthesis of gp140 was continued up to 24 h post-infection. Supernatants of SFVΔenv-infected BHK cells were harvested at 24 h post-infection, centrifuged at low speed to pellet cellular debris, and concentrated approximately 30-fold in Vivaspin concentration units (cut off 100 kDa). To cross-link gp140 oligomers, the supernatant was incubated with 5 mm ethylene glycolbis(sulfosuccinimidylsucccinate) (sulfo-EGS) (Pierce) in 20 mm Hepes for 30 min at room temperature. The reaction was stopped by incubation in 50 mm Tris-HCl (pH 7.5) for 15 min at room temperature. Sucrose gradients (5–20%) were prepared as described previously (2Earl P.L. Doms R.W. Moss B. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 648-652Crossref PubMed Scopus (295) Google Scholar). Approximately 600 μl of concentrated untreated or cross-linked supernatant was carefully added to the top of the gradient followed by ultracentrifugation in a SW41 rotor at 37,000 rpm for 18 h at 4 °C. Fractions were collected at 2 ml/min from the bottom of the tube using a capillary hooked on a peristaltic pump (Gilson). Fractions were deposited on SDS-PAGE gradient gels and analyzed by Western blot. Protein concentration was determined by Western blot using gp140MN as a standard. If necessary, corresponding fractions were pooled, diluted in PBS, and concentrated in low binding Centriplus® units (Amicon). All samples were taken up in 1× Laemmli buffer and 300 mm β-mercaptoethanol, and 20 mm dithiothreitol was added under reducing conditions. gp140s were separated on 4–12% SDS-PAGE gradient gels (Novex). Gels containing 35S-labeled proteins were fixed in 45% methanol and 10% acetic acid, dried, and exposed to a PhosphorImager screen (Storm 220, Molecular Dynamics). Intensity of labeled bands was analyzed by ImageQuant software (Molecular Dynamics). Western blot was performed by transferring proteins to a polyvinylidene difluoride membrane (Bio-Rad). Membranes were saturated in Tris-buffered saline with Tween containing 5% skim milk before incubation with mouse anti-gp120 monoclonal antibodies (mAb) (V3) K24 (2 μg/ml) or F5.5 (2 μg/ml) (Laboratoire d'Ingénierie des Anticorps, Institut Pasteur), mouse anti-gp41 mAb 41A (2 μg/ml) (Laboratoire d'Ingénierie des Anticorps), or human anti-gp120 mAbs 2G12 (2 μg/ml) (16Trkola A. Purtscher M. Muster T. Ballaun C. Buchacher A. Sullivan N. Srinivasan K. Sodroski J. Moore J.P. Katinger H. J. Virol. 1996; 70: 1100-1108Crossref PubMed Google Scholar) and 670-D (2 μg/ml) (39Zolla-Pazner S. O'Leary J. Burda S. Gorny M.K. Kim M. Mascola J. McCutchan F. J. Virol. 1995; 69: 3807-3815Crossref PubMed Google Scholar). Bound primary antibodies were revealed with species-specific peroxidase-labeled secondary antibodies (Vector) using diaminobenzidine as substrate. BHK cells were infected with SFVCD4 or SFVCCR5 for 12 h and fixed with 4% paraformaldehyde before incubation with PBS containing 5% normal horse serum. Subsequently, cells were incubated with mAb Q4120 directed against CD4 (40Healey D. Dianda L. Moore J.P. McDougal J.S. Moore M.J. Estess P. Buck D. Kwong P.D. Beverley P.C. Sattentau Q.J. J. Exp. Med. 1990; 172: 1233-1242Crossref PubMed Scopus (173) Google Scholar) or mAb 182 directed against CCR5 (R&D Systems). Specific binding was detected by FITC-labeled secondary antibodies. BHK cells were infected separately (MOI 5) or co-infected with SFVΔenvBX08 (MOI 5) and SFVhfur (MOI 1) for 12 h and then fixed with 4% paraformaldehyde at 4 °C for 15 min and permeabilized by incubation with 0.1% Triton in PBS at room temperature for 4 min. Then cells were washed 3 times with PBS and incubated with 5% normal horse serum in PBS. Subsequently, cells were incubated simultaneously with human mAb 2G12 (2 μg/ml) and mouse mAb MON-152 (1 μg/ml) directed against human furin (Alexis Biochemicals, San Diego, CA). Specific binding was detected by simultaneous incubation with anti-human IgG FITC-labeled antibody and anti-mouse IgG biotin-labeled antibody + avidin-rhodamine-labeled antibody (Vector). Labeled cells were analyzed with a Zeiss confocal laser microscope. For binding studies, BHK cells were infected at a MOI 5 with SFVCD4, SFVCCR5, or SFVlacZfor 12 h, washed 2× with GMEM 0% FCS, and incubated with ligands for 30 min at 37 °C. After incubation with ligand, cells were washed 3 times with serum-free medium and incubated in lysis buffer (1% SDS, 500 mm NaCl, 10 mm EDTA, 1%Triton X-100 with 1% sodium deoxycholate, 200 mm Tris-HCl, pH 7.5), and cell-associated radioactivity was counted in biodegradable counting scintillant (Amersham Pharmacia Biotech) in a liquid scintillation counter (Rackbeta, Amersham Pharmacia Biotech). Purified unlabeled gp120IIIB (Medical Research Council) or gp140MN (Aventis-Pasteur) were incubated on cells at 1 to 20 μg/ml in serum-free medium, washed, and fixed with methanol for 5 min at −20 °C. To detect bound glycoprotein, cells were incubated with mAb K24 at 2 μg/ml followed by incubation with125I-labeled anti-mouse IgG F(ab′)2 fragment. Radiolabeled secondary antibody was detached by incubation in lysis buffer.35S-Labeled purified oligomers and monomers of gp140 were incubated on cell monolayers at various concentrations for 30 min at 37 °C, after which the cells were washed, lysed, and counted. BHK cells infected with SFVCCR5 or SFVlacZ were incubated with125I-labeled MIP-1β (12000 cpm; PerkinElmer Life Sciences) alone or together with various concentrations of cold MIP-1β for 30 min at 37 °C and then washed, lysed, and counted. Human PBMC used for binding studies were isolated according to standard procedures on Ficoll-Paque® (Amersham Pharmacia Biotech) cushions, stimulated with 1 μg/ml phytohemagglutinin (Murex) for 3 days. PBMC (106 cells) were incubated with35S-labeled gp140BX08 monomers and dimers or trimers at various concentrations in a total volume of 200 μl of PBS for 30 min at 37 °C. Control cells were preincubated for 30 min with 10 μg/ml mAb Q4120 directed against CD4. Binding was further controlled by preincubating 35S-labeled gp140BX08 monomers, dimers, or trimers at 1 μg/ml with soluble CD4 at 20 μg/ml. Soluble envelope glycoproteins (gp140) from three different HIV-1 isolates corresponding to clades A, B, and E were cloned and expressed in the Semliki Forest virus expression system (36Berglund P. Sjoberg M. Garoff H. Atkins G.J. Sheahan B.J. Liljeström P. Biotechnology. 1993; 11: 916-920Crossref PubMed Scopus (252) Google Scholar, 38Meanger J. Peroulis I. Mills J. Biotechniques. 1997; 23: 432-434Crossref PubMed Scopus (14) Google Scholar). The expressed sequences, which include the entire gp120 region and the extracellular domain of gp41, correspond to gp160: amino acids 1 to 692 of isolate BX17, amino acids 1 to 666 of isolate BX08, and amino acids 1 to 679 of isolate E402. Envelope glycoproteins were expressed in BHK cells infected with recombinant vectors SFVΔenvBX17, SFVΔenvBX08, or SFVΔenvE402. gp140 could be detected in infected cells (data not shown) and in supernatants at approximately 1 to 5 μg/106 cells. Five different forms of the envelope glycoprotein could be visualized by SDS-PAGE under non-reducing conditions. The size of these different molecules was calculated based on migration of molecular weight markers identifying the main forms as trimers and dimers as well as monomers of uncleaved gp140, cleaved gp120, and Δgp41 (Fig.1 A). Oligomerization patterns of gp140 from the different isolates were very similar, although the gp140BX17 and gp140E402 bands migrated slightly faster than gp140BX08, possibly due to reduced glycosylation of these envelopes. Furthermore, cleavage of gp140BX17 and gp140E402 seemed to be less efficient, as demonstrated by the low level of gp120 in supernatants (Fig. 1 A). When supernatants from gp140BX08-secreting cells were analyzed on sucrose gradients (5 to 20%), different oligomeric and monomeric forms could be resolved. In addition to the main molecular entities (trimers, dimers, monomers), the existence of intermediate forms between monomers and dimers and dimers and trimers could be observed. Oligomers with a higher molecular weight than trimers, possibly tetramers, could also be detected (Fig. 1 B). About half of the secreted glycoprotein was present in the cleaved form (gp120). To find out whether gp140BX08 was secreted from cells as oligomers and subsequently disassembled into monomers before harvest of the supernatant at 24 h post-infection (p.i.), we performed the following time-course experiment. Secreted oligomers were collected in 3-h intervals until 36 h p.i. Samples from different time points were analyzed by SDS-PAGE and immunoprecipitated with mAbs F5.5 and 41A (data not shown). At all time points, the supernatant was composed of a mixture of different forms of envelope glycoprotein-containing trimers, dimers, and monomers at the same ratio. No increase of monomeric forms was found in samples corresponding to the late time points (24–36 h p.i.) compared with samples from early time points (0–6 h p.i.), suggesting that monomers did not stem from disassembled oligomers but were already secreted as monomers. Mixed preparations of oligomers and monomers of gp140BX08, gp140BX17, and gp140E402 were probed with monoclonal antibodies known for their specificity for either linear or conformation-dependent epitopes. gp140BX08 and gp140E402, but not gp140BX17, could be immunoprecipitated by anti-V3-loop mAbs K24 and F5.5. All three isolates could be immunoprecipitated by anti-CD4 binding site antibody 110K as well as conformation-dependent antibodies 2G12 (16Trkola A. Purtscher M. Muster T. Ballaun C. Buchacher A. Sullivan N. Srinivasan K. Sodroski J. Moore J.P. Katinger H. J. Virol. 1996; 70: 1100-1108Crossref PubMed Google Scholar) and 670D (39Zolla-Pazner S. O'Leary J. Burda S. Gorny M.K. Kim M. Mascola J. McCutchan F. J. Virol. 1995; 69: 3807-3815Crossref PubMed Google Scholar), suggesting that oligomers possessed a native conformation (data not shown). Consequently, recognition of gp140 or gp120 by 2G12 and 670D was greatly diminished when proteins were denatured and analyzed under reducing conditions. To identify whether oligomers were composed of uncleaved gp140BX08 or cleaved gp120/Δgp41, sucrose gradient fractions corresponding to trimers or dimers were treated with reducing agents and subjected to SDS-PAGE analysis. This experiment revealed that the trimers did not contain gp120 and that they were exclusively made of uncleaved gp140 (Fig. 1 C). Monomeric Δgp41 was not detected because of filtration of th
Referência(s)