Portal de Periódicos da CAPES

β-Arrestins Regulate Interleukin-8-induced CXCR1 Internalization

1999; Elsevier BV; Volume: 274; Issue: 23 Linguagem: Inglês

10.1074/jbc.274.23.16287

1083-351X

Jana Barlic, Masud H. Khandaker, Elizabeth S. Mahon, Joseph Andrews, Mark E. DeVries, Gordon Mitchell, Rahbar Rahimpour, Christopher M. Tan, Stephen S. G. Ferguson, David J. Kelvin,

T-cell and B-cell Immunology

The functional role of neutrophils during acute inflammatory responses is regulated by two high affinity interleukin-8 receptors (CXCR1 and CXCR2) that are rapidly desensitized and internalized upon binding their cognate chemokine ligands. The efficient re-expression of CXCR1 on the surface of neutrophils following agonist-induced internalization suggests that CXCR1 surface receptor turnover may involve regulatory pathways and intracellular factors similar to those regulating β2-adrenergic receptor internalization and re-expression. To examine the internalization pathway utilized by ligand-activated CXCR1, a CXCR1-GFP construct was transiently expressed in two different cell lines, HEK 293 and RBL-2H3 cells. While interleukin-8 stimulation promoted CXCR1 sequestration in RBL-2H3 cells, receptor internalization in HEK 293 cells required co-expression of G protein-coupled receptor kinase 2 and β-arrestin proteins. The importance of β-arrestins in CXCR1 internalization was confirmed by the ability of a dominant negative β-arrestin 1-V53D mutant to block internalization of CXCR1 in RBL-2H3 cells. A role for dynamin was also demonstrated by the lack of CXCR1 internalization in dynamin I-K44A dominant negative mutant-transfected RBL-2H3 cells. Agonist-promoted co-localization of transferrin and CXCR1-GFP in endosomes of RBL-2H3 cells confirmed that receptor internalization occurs via clathrin-coated vesicles. Our data provides a direct link between agonist-induced internalization of CXCR1 and a requirement for G protein-coupled receptor kinase 2, β-arrestins, and dynamin during this process. The functional role of neutrophils during acute inflammatory responses is regulated by two high affinity interleukin-8 receptors (CXCR1 and CXCR2) that are rapidly desensitized and internalized upon binding their cognate chemokine ligands. The efficient re-expression of CXCR1 on the surface of neutrophils following agonist-induced internalization suggests that CXCR1 surface receptor turnover may involve regulatory pathways and intracellular factors similar to those regulating β2-adrenergic receptor internalization and re-expression. To examine the internalization pathway utilized by ligand-activated CXCR1, a CXCR1-GFP construct was transiently expressed in two different cell lines, HEK 293 and RBL-2H3 cells. While interleukin-8 stimulation promoted CXCR1 sequestration in RBL-2H3 cells, receptor internalization in HEK 293 cells required co-expression of G protein-coupled receptor kinase 2 and β-arrestin proteins. The importance of β-arrestins in CXCR1 internalization was confirmed by the ability of a dominant negative β-arrestin 1-V53D mutant to block internalization of CXCR1 in RBL-2H3 cells. A role for dynamin was also demonstrated by the lack of CXCR1 internalization in dynamin I-K44A dominant negative mutant-transfected RBL-2H3 cells. Agonist-promoted co-localization of transferrin and CXCR1-GFP in endosomes of RBL-2H3 cells confirmed that receptor internalization occurs via clathrin-coated vesicles. Our data provides a direct link between agonist-induced internalization of CXCR1 and a requirement for G protein-coupled receptor kinase 2, β-arrestins, and dynamin during this process. A general characteristic of inflammatory responses is the migration of leukocytes from the blood to sites of injury or infection. A number of chemoattractants have been shown to cause the directed migration of leukocytes in vitro and in vivo. These include complement fragment C5a, formylated bacterial peptides (fMLP), arachidonic acid metabolites (LTB4), and a group of low-molecular weight pro-inflammatory cytokines known as chemokines (1Fernandez H.N. Henson P.M. Otani A. Hugli T.E. J. Immunol. 1978; 120: 109-115PubMed Google Scholar, 2Schiffmann E. Corcoran B.A. Wahl S.M. Proc. Natl. Acad. Sci. U. S. A. 1975; 72: 1059-1062Crossref PubMed Scopus (721) Google Scholar, 3Baggiolini M. Dewald B. Moser B. Adv. Immunol. 1994; 55: 97-179Crossref PubMed Scopus (2259) Google Scholar). The superfamily of chemokines is subdivided into different subsets based on the presence and positioning of highly conserved cysteine residues. The family, based on the configuration of the first two N-terminal located cysteines, is divided into CC, CXC, and CX3C subfamilies. All known neutrophil-targeted human chemokines belonging to the CXC subfamily (IL-8, 1The abbreviations used are: IL-8, interleukin-8; GPCR, guanine nucleotide-binding protein-coupled receptor; β2AR, β2-adrenergic receptor; GRK, G protein-coupled receptor kinases; GFP, green fluorescent protein; HEK, human embryonic kidney; RBL, rat basophilic leukemia; CCV, clathrin-coated vesicle; EMEM, Eagle's minimal essential medium; PBS, phosphate-buffered saline. 1The abbreviations used are: IL-8, interleukin-8; GPCR, guanine nucleotide-binding protein-coupled receptor; β2AR, β2-adrenergic receptor; GRK, G protein-coupled receptor kinases; GFP, green fluorescent protein; HEK, human embryonic kidney; RBL, rat basophilic leukemia; CCV, clathrin-coated vesicle; EMEM, Eagle's minimal essential medium; PBS, phosphate-buffered saline. GROα, GROβ, NAP-2, ENA78, and GCP-2) are defined by the presence of a glutamic acid-leucine-arginine motif (ELR motif) in the portion of the molecule that lies N-terminal to the first highly conserved cysteine, thus representing the ELR-CXC chemokine subclass of CXC chemokines (3Baggiolini M. Dewald B. Moser B. Adv. Immunol. 1994; 55: 97-179Crossref PubMed Scopus (2259) Google Scholar, 4Rollins B.J Blood. 1997; 90: 909-928Crossref PubMed Google Scholar, 5Murphy P.M. Cytokine Growth. Fact. Rev. 1996; 7: 47-64Crossref PubMed Scopus (281) Google Scholar). IL-8 and other neutrophil-directed chemokines stimulate neutrophils via specific seven-transmembrane guanine nucleotide-binding protein-coupled receptors (GPCRs) (5Murphy P.M. Cytokine Growth. Fact. Rev. 1996; 7: 47-64Crossref PubMed Scopus (281) Google Scholar, 7Kelvin D.J. Michiel D.F. Johnston J.A. Lloyd A.R. Sprenger H. Oppenheim J.J. Wang J.M. J. Leukocyte Biol. 1993; 54: 604-612Crossref PubMed Scopus (145) Google Scholar). The two human IL-8 receptors, CXCR1 and CXCR2, have 77% overall sequence homology. The two receptor subtypes differ notably in their N-terminal extracellular domains, as well as in their C-terminal intracellular domains, and possess differences in their ligand specificities. CXCR1 displays greater ligand specificity by binding to IL-8 and GCP-2 with high affinity, whereas CXCR2 binds with high affinity multiple CXC chemokines in addition to IL-8, including ENA 78, NAP-2, GROα, and GROβ (6Murphy P.M. Semin. Hematol. 1997; 34: 311-318PubMed Google Scholar, 7Kelvin D.J. Michiel D.F. Johnston J.A. Lloyd A.R. Sprenger H. Oppenheim J.J. Wang J.M. J. Leukocyte Biol. 1993; 54: 604-612Crossref PubMed Scopus (145) Google Scholar, 8Holmes W.E. Lee J. Kuang W.J. Rice G.C. Wood W.I. Science. 1992; 253: 1278-1280Crossref Scopus (907) Google Scholar, 9Lee J. Horuk R. Rice G.C. Bennett G.L. Camerato T. Wood W.I. J. Biol. Chem. 1992; 267: 16283-16287Abstract Full Text PDF PubMed Google Scholar). Binding of the ligand to high affinity IL-8 receptors initiates a variety of cellular responses, including calcium translocation, chemotaxis, alterations in cytoskeletal architecture as well as cellular morphology, degranulation, and respiratory burst activation (3Baggiolini M. Dewald B. Moser B. Adv. Immunol. 1994; 55: 97-179Crossref PubMed Scopus (2259) Google Scholar, 10Hammond M. Lapointe G. Feucht P.S. Hilt S. Gallegos C. Gardon C. J. Immunol. 1995; 155: 1428-1433PubMed Google Scholar, 11Sham R.L. Phatak P.D. Ihne T.P. Abboud C.N. Packman C.H. Blood. 1993; 82: 2546-2551Crossref PubMed Google Scholar, 12Camps M. Carrozi A. Schnabel P. Scheer A. Parker P.J. Gierschik P. Nature. 1992; 360: 684-686Crossref PubMed Scopus (513) Google Scholar). ELR-CXC chemokines are produced by a variety of cell types including monocytes, T lymphocytes, fibroblasts, and endothelial cells (3Baggiolini M. Dewald B. Moser B. Adv. Immunol. 1994; 55: 97-179Crossref PubMed Scopus (2259) Google Scholar, 5Murphy P.M. Cytokine Growth. Fact. Rev. 1996; 7: 47-64Crossref PubMed Scopus (281) Google Scholar, 6Murphy P.M. Semin. Hematol. 1997; 34: 311-318PubMed Google Scholar). It has been well documented that IL-8 receptors become rapidly desensitized and internalized upon agonist stimulation (13Samanta A.K. Oppenheim J.J. Matsushima K. J. Biol. Chem. 1990; 265: 183-189Abstract Full Text PDF PubMed Google Scholar, 14Chuntharapai A. Kim K.J. J. Immunol. 1995; 155: 2587-2594PubMed Google Scholar). The molecular mechanism(s) and cellular factors required for translocation of these agonist-occupied receptors from the membrane to cytosolic compartments are not well characterized. However, the rapid sequestration and re-expression of CXCR1 (14Chuntharapai A. Kim K.J. J. Immunol. 1995; 155: 2587-2594PubMed Google Scholar, 16Sabroe I. Williams T.J. Hebert C.A. Collins P.D. J. Immunol. 1997; 158: 1361-1369PubMed Google Scholar) is similar to the well described model of β2-adrenergic receptor (β2-AR) regulation. In the case of β2-AR, agonist binding induces a change in the receptor conformation, which is necessary for the interaction of the receptor with G protein-coupled receptor kinases (GRKs) (17Premont T.P. Inglese J. Lefkowitz R.J. FASEB J. 1995; 9: 175-182Crossref PubMed Scopus (469) Google Scholar, 19Ferguson S.S.G. Barak L.S. Zhang J. Caron M.G. Can. J. Physiol. Pharmacol. 1996; 74: 1095-1110Crossref PubMed Scopus (318) Google Scholar). GRK-mediated phosphorylation of the β2-AR C terminus promotes binding of arrestin proteins (β-arrestins) which when bound, elicit uncoupling of the receptor from its G protein (18Lohse M.J. Benovic J.L. Codina J. Caron M.G. Lefkowitz R.J. Science. 1990; 248: 1547-1550Crossref PubMed Scopus (900) Google Scholar, 19Ferguson S.S.G. Barak L.S. Zhang J. Caron M.G. Can. J. Physiol. Pharmacol. 1996; 74: 1095-1110Crossref PubMed Scopus (318) Google Scholar, 20Ferguson S.S.G. Downey III, W.E. Colapietro A.M. Barak L.S. Menard L. Caron M.G. Science. 1996; 271: 363-366Crossref PubMed Scopus (841) Google Scholar). Recent data suggests that the synergistic action of cellular GRKs and β-arrestins determines the kinetics of β2-AR internalization (21Menard L. Ferguson S.S.G. Zhang J. Lin F.T. Lefkowitz R.J. Caron M.G. Barak L.S. Mol. Pharmacol. 1997; 51: 800-808Crossref PubMed Scopus (213) Google Scholar). Moreover, it was demonstrated that β-arrestins serve as adaptor proteins, specifically targeting agonist-occupied receptors to clathrin-coated vesicles (CCVs) (19Ferguson S.S.G. Barak L.S. Zhang J. Caron M.G. Can. J. Physiol. Pharmacol. 1996; 74: 1095-1110Crossref PubMed Scopus (318) Google Scholar, 20Ferguson S.S.G. Downey III, W.E. Colapietro A.M. Barak L.S. Menard L. Caron M.G. Science. 1996; 271: 363-366Crossref PubMed Scopus (841) Google Scholar, 22Goodman O.B. Krupnick J.G. Santini F. Gurevich V.V. Penn R.B. Gagnon A.W. Keen J.H. Benovic J.L. Nature. 1996; 383: 447-450Crossref PubMed Scopus (1156) Google Scholar). A critical step in receptor-mediated endocytosis of β2-AR is the translocation of CCVs saturated with agonist-occupied receptor to the cytosol, which is a dynamin-regulated event (23Zhang J. Ferguson S.S.G. Barak L.S. Menard L. Caron M.G. J. Biol. Chem. 1996; 271: 18302-18305Abstract Full Text Full Text PDF PubMed Scopus (398) Google Scholar). Desensitized β2-ARs, internalized via CCVs, are thought to be resensitized in the acidified endosomal environment and recycled back to the cell surface to re-establish normal receptor signaling (24Zhang J. Barak L.S. Winkler K.E. Caron M.G. Ferguson S.S.G. J. Biol. Chem. 1997; 272: 27005-27014Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar). In the present work we examined the role of GRK2, β-arrestins, and dynamin in regulating CXCR1 internalization. For this purpose a CXCR1-green fluorescent protein (GFP) construct (CXCR1-GFP) was transiently expressed in human embryonic kidney 293 (HEK 293) and rat basophilic leukemia 2H3 (RBL-2H3) cell lines. We demonstrate that GRK2, β-arrestins, and dynamin are required for rapid agonist-induced internalization of CXCR1. HEK 293 and RBL-2H3 cell lines were obtained from American Type Culture Collection (Manassas, VA). Dulbecco's modified essential medium and Eagle's modified essential medium (EMEM) were purchased from Biowhittaker (Walkerswille, MD). Chemiluminescent substrates and horseradish peroxidase-coupled donkey anti-rabbit antibody were purchased from Amersham (Amersham International). The plasmid containing a variant of a green fluorescence protein (pEGFP-N1) and a green fluorescence protein directed polyclonal antibody were purchased from CLONTECH (Palo Alto, CA). Human recombinant interleukin-8 (IL-8) was obtained from R&D Systems (Minneapolis, MN) and 125I-IL-8 was obtained from Amersham. Texas Red-transferrin conjugates were purchased from Molecular Probes (Eugene, OR). RNA from human neutrophils was isolated using TriPureTM Isolation Reagent (Roche Molecular Biochemicals) and CXCR1 cDNA synthesized using SuperscriptTM II reverse transcriptase (Life Technologies, Inc.) according to the manufacturer's instructions. The coding sequence of CXCR1 was amplified using forward (AAGAGGACATGTCAAATATTACAGAT) and reverse (TTCATCGATGGTTTTCCGAGG) primers carrying EcoRI restriction enzyme recognition sequence. Polymerase chain reaction products were 5′ and 3′ terminal digested with EcoRI and cloned into pEGFP-N1 cloning vector. The final construct was sequenced through the region that was generated by polymerase chain reaction to confirm sequence fidelity. HEK 293 cells were grown in Dulbecco's modified essential medium whereas RBL-2H3 cells were grown in EMEM, both containing 10% fetal bovine serum and 1:100 dilution of penicillin/streptomycin (BioWhittaker) at 37 °C in a humidified atmosphere of 95% air and 5% CO2. HEK 293 cells were seeded 12 h prior to transfection in 35-mm glass bottom plates (MatTek Corp., Ashland, MA) at a density of 2 × 105cells per dish and RBL-2H3 cells were seeded at a density of 1 × 105 cells per dish 3 h prior to transfection. HEK 293 cells were transiently transfected with 5 μg of CXCR1-GFP and 7.5 μg of pcMV5 rat β-arrestin 1/pcMV5 rat β-arrestin 2, and/or 7.5 μg of pcDNA1-Amp rat GRK2. For RBL-2H3 cells, 3 h prior to transfection the cells were washed and incubated in serum-free EMEM and then transiently transfected with 5 μg of CXCR1-GFP alone or along with 5 μg of pcDNA1-Amp rat β-arrestin 1-V53D or 5 μg of pCB1 rat dynamin I-K44A. Cell lines were transfected with LipofectAMINE (Life Technologies, Inc.) following the manufacturer's instructions. Following transfection the cells were maintained in fresh complete medium for 12 h to recover. For stable transfections, RBL-2H3 cells were grown to 80% confluence in 100-mm dishes (Falcon) and transfected with 10 μg of CXCR1-GFP in 30 μl of LipofectAMINE. Three days after transfection, cells were harvested, diluted, and replated in media supplemented with 1 mg/ml of Geneticin (Life Technologies, Inc.). The media was replaced every 4 days and stable transformants were isolated approximately 3 weeks after transfection. Clonal selection was confirmed by observation of cells under confocal microscope. RBL-2H3 cells were subcultured overnight in 6-well plates (1 × 106cells/well) in complete EMEM. Cells were washed twice with serum-free EMEM containing 1% bovine serum albumin and 25 mm HEPES (pH 7.2) and preincubated in the same media 1 h prior to125I-IL-8 treatment. Nontransfected RBL-2H3 and RBL-2H3 cells stably expressing CXCR1-GFP were stimulated with 50 nm125I-IL-8 (3000 Ci/mmol) at 4 and 37 °C for 45 min. The reaction was stopped with 1 ml of ice-cold PBS (pH 7.4) supplemented with 1% bovine serum albumin, the cells were washed with the same buffer three times and lysed in the lysis buffer (0.5% Nonidet P-40 and 0.5% Triton X-100 in PBS) on ice for 30 min. After incubation, the total volume of the well was transferred onto 10% sucrose, PBS cushion and pelleted at 10,000 rpm for 20 min. Equal volumes of the supernatant (100 μl) were aliquoted and the amount of125I-IL-8 in supernatants was measured using a γ-counter (LKB/Wallac, Turku, Finland). Incorporation of nonspecific radioactivity was determined in supernatants of nontransfected RBL-2H3 cells. Cells were seeded as described for the "Radioligand Sequestration Assay," washed, and preincubated in serum-free EMEM for 30 min. Nontransfected and RBL-2H3 cells stably expressing CXCR1-GFP were then stimulated with 50 nm IL-8 for 60 min at 37 °C. The reaction was terminated by placing 6-well plates on ice for 15 min. The amount of the secreted β-hexosaminidase was determined by incubating 50 μl of the overlaying medium with 50 μl of 1 mm p-(nitrophenyl)-N-acetyl-β-d-glucosamide in 0.1 m sodium citrate buffer (pH 4.5) at 37 °C for 1 h. At the end of the incubation 500 μl of a 0.1 mNa2CO3, NaHCO3 buffer (pH 4.5) was added and the absorbance was measured at 400 nm. Confocal microscopy was performed on a Bio-Rad MRC-600 confocal microscope under × 60 oil immersion objective, using a fluorescein isothiocyanate filter with the emission wavelength of 488 nm. Transiently transfected HEK 293 and RBL-2H3 cells were maintained in fresh complete media. For time course studies, the cells were treated with increasing concentrations of IL-8 (10, 25, 40, 50, and 75 nm) and events following agonist stimulation were observed in 5-min time intervals up to 90 min post-agonist stimulation. To determine the effect of de novo protein synthesis that occurs during the time of observation, RBL-2H3 cells transiently expressing CXCR1-GFP were first pretreated with cyclohexamide (10 ng/ml) for 45 min at 37 °C and then stimulated with 50 nm IL-8. Events following agonist treatment were observed under confocal microscope. For colocalization studies, RBL-2H3 cells transiently expressing CXCR1-GFP were stimulated with 50 nm IL-8 and labeled with Texas Red-transferrin conjugates (15 ng/ml) for 45 min at 37 °C. The reaction was terminated by washing the cells twice with ice-cold PBS (pH 7.4). The cells were fixed in 3.6% paraformaldehyde solution and confocal microscopy was performed as described above. HEK 293 cells transiently expressing CXCR1-GFP, CXCR1-GFP, and GRK2, and CXCR1-GFP, GRK2, and β-arrestin 1 were stimulated with 50 nm IL-8 for 45 min at 37 °C. The cells were washed twice with ice-cold PBS (pH 7.4), removed from plates by gentle washing, and pelleted at 100 rpm for 10 min. The cell pellet was resuspended in 3 ml of buffer A (10 mm Tris-HCl, pH 7.4, 2 mm EDTA), incubated on ice for 30 min and homogenized using a Dounce homogenizer. Nuclei were removed by centrifugation at 200 rpm for 10 min. The supernatant was loaded on a stepwise sucrose cushion (35 and 5% sucrose in PBS) and centrifuged at 35,000 rpm for 90 min at 4 °C. The supernatant was removed and the 35% sucrose interface fraction containing endosomes (the light vesicular fraction) was collected, diluted in buffer A, and re-centrifuged at 35,000 rpm for 45 min at 4 °C. The pellets were resuspended in 100 μl of buffer A containing 2 × SDS sample buffer and 100 μg of each protein sample was loaded onto SDS-polyacrylamide gel electrophoresis. Protein levels in the whole cell lysates of HEK 293 and RBL-2H3 cells were determined using Bio-Rad protein assay (Richmond, CA) with bovine serum albumin as a standard. Expression levels of β-arrestin 1, β-arrestin 2, and GRK 2 in HEK 293 and RBL-2H3 cells were examined using specific polyclonal antisera as described previously (20Ferguson S.S.G. Downey III, W.E. Colapietro A.M. Barak L.S. Menard L. Caron M.G. Science. 1996; 271: 363-366Crossref PubMed Scopus (841) Google Scholar). Equivalent amounts (100 μg) of total cell protein were separated on a 10% polyacrylamide gel and transferred onto nitrocellulose membrane (Bio-Rad). The endogenous amounts of β-arrestin 1, β-arrestin 2, and GRK 2 were determined using anti-β-arrestin 2 and anti-GRK2 rabbit polyclonal sera at a dilution of 1:2500 and horseradish peroxidase-conjugated anti-rabbit secondary antibodies using the ECL system (Amersham) according to manufacturer's instructions. The amount of total β-arrestin 1, β-arrestin 2, and GRK 2 in RBL-2H3 cells were determined relative to their respective endogenous expression in HEK 293 cells. Amounts of CXCR1-GFP in the light vesicular subcellular fraction were determined using GFP-directed polyclonal antibody at dilution 1:1000 (CLONTECH). The relative membrane and cytosol luminosity was measured using SigmaScan Pro software. Data was statistically analyzed and plotted using Microsoft Excel software. Results are the average ± S.D. from three separate identical experiments. Cells transfected with CXCR1-GFP were positive for fusion protein expression within 24–36 h post-transfection as evidenced by robust membrane fluorescence in 15% of the RBL-2H3 and 70% of the HEK 293 cells visualized by confocal microscopy. In some transfected cells under nonstimulated conditions the CXCR1-GFP conjugate accumulated in the Golgi apparatus. Dose-response experiments indicated that maximal internalization of CXCR1-GFP occurred in a range of 40–75 nm IL-8. Over a 45-min time period, agonist-occupied CXCR1-GFP conjugates carried in specific membrane-associated vesicles, gradually translocated from the plasma membrane to the cytosol (Fig.1 A, i). Sequestration data acquired in RBL-2H3 cells showed a mean decrease of 61% in membrane luminosity and a 4.2-fold increase in cytosol fluorescence intensity in response to agonist stimulation over the 45-min time period (Fig. 1 B). Although there was a significant decrease of membrane luminosity in response to IL-8 treatment in RBL-2H3 cells transiently expressing the CXCR1-GFP construct not all of the expressed receptor was internalized 45 min post-stimulation. Pretreatment of RBL-2H3 cells transiently expressing the CXCR1-GFP fusion construct with cyclohexamide resulted in rapid CXCR1-GFP sequestration with no membrane fluorescence after 45 min post-stimulation, indicating that residual membrane fluorescence was due to de novo synthesis of CXCR1-GFP conjugates (data not shown). Unstimulated cells showed very little redistribution of CXCR1-GFP over the same time frame (Fig. 1 A, ii). Stably transfected CXCR1-GFP cells internalized 125I-IL-8 at 37 °C whereas at 4 °C, CXCR1-GFP transfected cells failed to internalize 125I-IL-8 (Fig. 1 C), indicating that internalization of CXCR1-GFP is an agonist and temperature-dependent process, which is similar to IL-8 receptor internalization observed in neutrophils (14Chuntharapai A. Kim K.J. J. Immunol. 1995; 155: 2587-2594PubMed Google Scholar). To assess whether CXCR1-GFP transduced functional responses, we performed β-hexosaminidase assays on IL-8 stimulated and unstimulated CXCR1-GFP stably transfected cells. IL-8 stimulation of CXCR1-GFP transfected cells resulted in a 13.4% release of hexosaminidase compared with a 4.8% release from untransfected RBL-2H3 cells stimulated with IL-8 (Fig. 1 D). Stimulation with MCP-1, a CC chemokine that does not bind CXCR1, did not induce hexosaminidase release. These results show that CXCR1-GFP expressed in RBL-2H3 cells retains several features of the wild type receptor expressed in neutrophils; the receptor can transduce signals that result in granule release, undergo agonist-induced internalization, and sequester IL-8. In contrast to RBL-2H3 cells, HEK 293 cells transiently expressing the fusion protein construct did not internalize CXCR1-GFP when stimulated with IL-8 (Fig. 2 A, i). Since previous studies (30Aramori I. Zhang J. Ferguson S.S.G. Bieniasz P.D. Cullen B.R. Caron M.G. EMBO J. 1997; 16: 4606-4616Crossref PubMed Scopus (224) Google Scholar) have demonstrated that HEK 293 cells require increased expression of β-arrestins and GRKs for internalization of some GPCRs we explored whether co-expression of these two classes of molecules with CXCR1-GFP could restore agonist-induced receptor internalization in HEK 293 cells. Co-expression of CXCR1-GFP with either GRK2 (Fig. 2 A,ii) or β-arrestin 1 alone (Fig. 2 A, iii) in HEK 293 cells failed to facilitate IL-8 induced CXCR1-GFP internalization. However, expression of CXCR1-GFP with GRK2 and β-arrestins together resulted in IL-8-induced receptor internalization (Fig. 2 A, iv) showing a 3.5-fold increase of cytosolic fluorescence and a 60% decrease in membrane fluorescence (Fig. 2 B). The increased cytosolic receptor fluorescence was associated with increased receptor labeling of the intracellular vesicles. Similar results were obtained with β-arrestin 2, another closely related member of the β-arrestin family, again co-expressed with GRK2 and CXCR1-GFP (Fig. 2 A,v). These results suggest that both GRKs and β-arrestins are required for CXCR1 internalization. Western analysis of GRK2, β-arrestin 1, and β-arrestin 2 from HEK 293 cells and RBL-2H3 cells (Fig. 3, A and B), shows a substantial difference in β-arrestin 1, β-arrestin 2, and GRK2 expression between HEK 293 cells and RBL-2H3 cells. The higher levels of GRK2 and β-arrestin 2 expression in RBL-2H3 cells likely explain why CXCR1-GFP undergoes agonist-induced internalization in RBL-2H3 cells without the requirement for co-expression with GRKs or β-arrestins. To explore the role of β-arrestins in CXCR1-GFP internalization in RBL-2H3 cells we co-expressed CXCR1-GFP along with the β-arrestin 1-V53D dominant negative mutant in RBL-2H3 cells and stimulated with IL-8. In the presence of β-arrestin 1-V53D there was no redistribution of membrane fluorescence that followed IL-8 stimulation (Fig. 4, A,ii, and B). This was in sharp contrast to cells expressing CXCR1-GFP alone (Fig. 4 A, i) or cells expressing CXCR1-GFP and wild type β-arrestin 1 (data not shown), which showed marked receptor internalization following IL-8 stimulation. These observations complement the results obtained with HEK 293 cells and clearly demonstrate a role of β-arrestins in agonist-induced CXCR1 internalization. β-Arrestins are thought to act as scaffolding proteins in coupling GPCRs to CCVs (22Goodman O.B. Krupnick J.G. Santini F. Gurevich V.V. Penn R.B. Gagnon A.W. Keen J.H. Benovic J.L. Nature. 1996; 383: 447-450Crossref PubMed Scopus (1156) Google Scholar, 24Zhang J. Barak L.S. Winkler K.E. Caron M.G. Ferguson S.S.G. J. Biol. Chem. 1997; 272: 27005-27014Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar, 25Barak L.S. Ferguson S.S.G. Zhang J. Caron M.G. J. Biol. Chem. 1997; 272: 27497-27500Abstract Full Text Full Text PDF PubMed Scopus (394) Google Scholar, 26Kallal L. Gagnon A.W. Penn R.B. Benovic J.L. J. Biol. Chem. 1997; 273: 322-328Abstract Full Text Full Text PDF Scopus (151) Google Scholar). Agonist stimulation promotes the formation of CXCR1-GFP containing vesicles, which are pinched off from the plasma membrane and translocated into post-endocytic compartments (19Ferguson S.S.G. Barak L.S. Zhang J. Caron M.G. Can. J. Physiol. Pharmacol. 1996; 74: 1095-1110Crossref PubMed Scopus (318) Google Scholar, 24Zhang J. Barak L.S. Winkler K.E. Caron M.G. Ferguson S.S.G. J. Biol. Chem. 1997; 272: 27005-27014Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar,26Kallal L. Gagnon A.W. Penn R.B. Benovic J.L. J. Biol. Chem. 1997; 273: 322-328Abstract Full Text Full Text PDF Scopus (151) Google Scholar). The pinching or sealing off of the vesicles from the plasma membrane is dependent upon dynamin, a GTPase containing molecule (27Damke H. FEBS Lett. 1996; 389: 48-51Crossref PubMed Scopus (63) Google Scholar, 28Muhlberg A.B. Warnock D.E. Schmid S.L. EMBO J. 1997; 16: 6676-6683Crossref PubMed Scopus (198) Google Scholar, 29Damke H. Baba T. Warnock D.E. Schmid S.L. J. Cell Biol. 1994; 127: 915-934Crossref PubMed Scopus (1034) Google Scholar). The dominant negative dynamin I-K44A mutant has been utilized in determining whether GPCRs are internalized via a dynamin-dependent pathway involving CCVs. We explored whether CXCR1 required dynamin for agonist-induced receptor internalization by co-expressing CXCR1-GFP with the dynamin I-K44A dominant negative mutant. The expression of dynamin I-K44A successfully blocked redistribution of CXCR1-GFP from the membrane to the cytosol. Vesicles formed in cells expressing the dynamin I-K44A mutant simply did not pinch off from the inner surface of the plasma membrane (Fig.4 A, iii, 45 min). These results indicate that agonist-induced internalization of CXCR1 occurs via CCVs and requires functional β-arrestins and dynamin molecules. To further investigate and confirm the identity of membrane-derived vesicles that translocate agonist-occupied CXCR1-GFP from the membrane to post-endocytic compartments, we labeled RBL-2H3 cells transiently expressing the receptor-GFP construct with a Texas Red-transferrin conjugate. Transferrin has been shown to undergo receptor-mediated endocytosis through CCVs upon binding to its cognate transferrin receptor and it has been described as a significant endosomal marker (37Hirst J. Robinson M.S. Biochim. Biophys. Acta. 1998; 1404: 173-193Crossref PubMed Scopus (324) Google Scholar, 38Ponka P. Beaumont C. Richardson D.R. Semin. Hematol. 1998; 35: 35-54PubMed Google Scholar). Agonist stimulation promoted colocalization of CXCR1-GFP and dye-labeled transferrin conjugate within CCVs (Fig. 5,ii) whereas unstimulated RBL-2H3 cells transiently expressing CXCR1-GFP did not display any colocalization (Fig. 5, i). These results were further supported by isolation of the light vesicular (endosomal) subcellular fraction from transiently transfected HEK 293 cells expressing CXCR1-GFP and CXCR1-GFP, GRK2, and β-arrestin 1 that were stimulated or unstimulated with IL-8. A 9.5-fold increase in CXCR1-GFP was found in the light vesicular subcellular fraction isolated from IL-8 stimulated HEK 293 cells expressing CXCR1-GFP, GRK2, and β-arrestin 1 (Fig. 6, lane 4 versus lane 2). However, only a modest increase (3-fold) in CXCR1-GFP was found in the light vesicular subcellular fraction isolated from HEK 293 cells in the absence of transfected GRK2 and β-arrestin 1 (Fig. 6, lane 3 versus lane 1) indicating that GRK2 and β-arrestin 1 substantially enhance the efficiency of CXCR1 internalization. Together these results support a model for CXCR1 sequestration via clathrin-coated pits that are regulated by GRKs, β-arrestins, and dynamin.Figure 6Presence of high CXCR1-GFP amounts in the endosomal subcellular fraction isolated from HEK 293 cells transiently expressing CXCR1-GFP, GRK2, and β-arrestin 1. A, amounts of CXCR1-GFP in light vesicular subcellular fractions isolated from HEK 293 cells transiently expressing CXCR1-GFP (lanes 1 and 3) and CXCR1-GFP, GRK2, and β-arrestin 1 (lanes 2 and4) pre- and post-stimulation were detected using GFP-directed polyclonal antibody.View Large Image Figure ViewerDownload (PPT) Agonist-dependent regulation of chemokine receptor desensitization, internalization, and sequestration is an important mechanism for regulating leukocyte responsiveness to chemokine stimulation. Several studies have demonstrated that exposure of neutrophils to high concentrations of ELR-CXC chemokines renders the exposed neutrophils unresponsive to additional homologous chemokine stimulation. The refractory state of neutrophils following stimulation with high chemokine concentrations appears to be dependent upon desensitization, internalization, and sequestration of CXCR1, CXCR2, or both IL-8 receptor subtypes. Initial studies using radiolabeled IL-8 showed that IL-8-binding sites were rapidly lost from the neutrophil surface following stimulation of high concentrations of IL-8 (13Samanta A.K. Oppenheim J.J. Matsushima K. J. Biol. Chem. 1990; 265: 183-189Abstract Full Text PDF PubMed Google Scholar). These initial studies were later confirmed by additional work utilizing monoclonal antibodies directed at the external domains of CXCR1 and CXCR2, that demonstrated a rapid loss of CXCR1 and CXCR2 following stimulation of neutrophils with high concentrations of ELR-CXC chemokines (14Chuntharapai A. Kim K.J. J. Immunol. 1995; 155: 2587-2594PubMed Google Scholar, 33Khandaker M.H. Xu L. Rahimpour R. Mitchell G. DeVries M. Pickering J.G. Singhal S.K. Feldmann R.D. Kelvin D.J. J. Immunol. 1998; 161: 1930-1938PubMed Google Scholar). Recent studies by Richardson et al. (32Richardson R.M. Ali H. Pridgen B.C. Haribabu B. Snyderman R. J. Biol. Chem. 1998; 273: 10690-10695Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) have demonstrated that phosphorylation of critical serine residues in the C-terminal region of CXCR1 is important for internalization of the receptor following agonist stimulation. Our work here compliments these observations by demonstrating that GRK2 is necessary for internalization of CXCR1 in HEK 293 cells (Fig. 2 A, iv and v). GRK2 is a serine-threonine kinase and a member of a multigene family whose members regulate GPCR function and internalization by phosphorylating serine/threonine residues located within the cytoplasmic regions of various receptors (17Premont T.P. Inglese J. Lefkowitz R.J. FASEB J. 1995; 9: 175-182Crossref PubMed Scopus (469) Google Scholar). GRK2 is abundantly expressed in human peripheral leukocytes (Ref.31Chuang T.T. Sallese M. Ambrosini G. Paruti G. De Blasi A. J. Biol. Chem. 1991; 267: 6886-6892Google Scholar and data not shown) and may represent the endogenous kinase responsible for CXCR1 phosphorylation in neutrophils. Alternatively one of the other members of the GRK family (GRK1 and 3–5) may serve the same function in regulating phosphorylation of CXCR1 in neutrophils. CCR5, a member of the CC chemokine family of receptors (4Rollins B.J Blood. 1997; 90: 909-928Crossref PubMed Google Scholar), is preferentially phosphorylated by GRK2 and GRK3 indicating that GRK phosphorylation likely represents a common feature of both CC and CXC chemokine receptor regulation (30Aramori I. Zhang J. Ferguson S.S.G. Bieniasz P.D. Cullen B.R. Caron M.G. EMBO J. 1997; 16: 4606-4616Crossref PubMed Scopus (224) Google Scholar). While GRK phosphorylation represents a critical step in regulating the desensitization and internalization of a subset of GPCRs, it is the β-arrestin proteins which facilitate the translocation of GPCRs from the plasma membrane to CCVs. Our data in the present study places β-arrestins as central regulators of CXCR1 internalization in response to agonist stimulation. This has been substantiated using two separate cells lines displaying two different phenotypes. HEK 293 cells which have low expression of β-arrestins require expression of β-arrestin 1 or β-arrestin 2 for agonist induced internalization. In sharp contrast to HEK 293 cells, RBL-2H3 cells express higher levels of β-arrestins and do not require additional expression of β-arrestins for CXCR1 internalization (Fig. 3 A). However, agonist-induced internalization of CXCR1 could be blocked by co-expressing the dominant negative β-arrestin 1-V53D mutant in RBL-2H3 cells (Fig. 4, A, ii, and B). These experiments provide strong evidence for β-arrestin regulation of agonist-induced CXCR1 internalization. Additionally, it is also clear from our studies that cellular factors other than GRK2 and β-arrestin are involved in the CXCR1 internalization machinery. Dynamins have been previously described as key proteins involved in the pinching off or sealing of CCVs from the membrane by stimulating GTP/GDP exchange which facilitates endocytic vesicle release (27Damke H. FEBS Lett. 1996; 389: 48-51Crossref PubMed Scopus (63) Google Scholar, 28Muhlberg A.B. Warnock D.E. Schmid S.L. EMBO J. 1997; 16: 6676-6683Crossref PubMed Scopus (198) Google Scholar). In contrast to the angiotensin II type 1A receptor, which is able to undergo dynamin-independent endocytosis (23Zhang J. Ferguson S.S.G. Barak L.S. Menard L. Caron M.G. J. Biol. Chem. 1996; 271: 18302-18305Abstract Full Text Full Text PDF PubMed Scopus (398) Google Scholar), our studies indicate that in the presence of dynamin I-K44A mutant, CCVs saturated with agonist-occupied receptor are not released from the membrane into the cytosolic compartment (Fig. 4 A, iii). Thus CXCR1 appears to undergo internalization and sequestration through a dynamin-driven and clathrin-dependent internalization pathway similar to several other GPCRs (20Ferguson S.S.G. Downey III, W.E. Colapietro A.M. Barak L.S. Menard L. Caron M.G. Science. 1996; 271: 363-366Crossref PubMed Scopus (841) Google Scholar, 26Kallal L. Gagnon A.W. Penn R.B. Benovic J.L. J. Biol. Chem. 1997; 273: 322-328Abstract Full Text Full Text PDF Scopus (151) Google Scholar, 30Aramori I. Zhang J. Ferguson S.S.G. Bieniasz P.D. Cullen B.R. Caron M.G. EMBO J. 1997; 16: 4606-4616Crossref PubMed Scopus (224) Google Scholar). This is supported by two additional pieces of data, agonist-promoted colocalization of transferrin and CXCR1-GFP in endosomal vesicles of RBL-2H3 cells (Fig. 5) and redistribution of CXCR1-GFP to the light vesicular fraction following IL-8 stimulation in HEK 293 cells transiently expressing CXCR1-GFP, GRK2, and β-arrestin 1 (Fig. 6). Even though CXCR1 and CXCR2 display 77% amino acid identity and elicit several similar functional responses they appear to have divergent pathways for internalization and recycling. Chuntharapai et al. (14Chuntharapai A. Kim K.J. J. Immunol. 1995; 155: 2587-2594PubMed Google Scholar) showed that CXCR1 but not CXCR2 was recycled back to the plasma membrane following agonist-induced internalization. The mechanism for the divergence of CXCR1 and CXCR2 recycling is presently unknown, although differences in the C-terminal region may play a role in how the two proteins undergo intracellular trafficking (15Prado N.P. Suzuki H. Wilkinson N. Cousins B. Navarro J. J. Biol. Chem. 1996; 271: 19186-19190Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). In this context CXCR1 and CXCR2 may have differential requirements for β-arrestin proteins, which target CXCR1 and CXCR2 to different intracellular compartments. Preliminary data in our laboratory suggests that CXCR2 internalization is regulated differently from CXCR1 in HEK293 cells. The precise role of β-arrestins in regulating CXCR1 and CXCR2 recycling awaits further investigations. It is interesting to note that β-arrestins can function as signaling molecules since studies have implicated a role for β-arrestins in the activation of tyrosine kinases (36Luttrell L.M. Ferguson S.S.G. Daaka Y. Miller W.E. Maudsley S.R. Della Rocca G.J. Lin F.-T. Kawakatsu Owada K. Luttrell D.K. Caron M.G. Lefkowitz R.J. Science. 1999; 283: 655-661Crossref PubMed Scopus (1255) Google Scholar). Thus, it is conceivable that some of the functional responses elicited by CXCR1 are due to signals transduced by β-arrestins coupling to the CXCR1 receptor. While there are at least five independent mechanisms for endocytotic internalization including the clathrin- and non-clathrin-coated pits, micropinocytosis, caveolae, and phagocytosis, GPCRs appear to utilize only two: clathrin-dependent and dynamin-independent endocytotic pathways (23Zhang J. Ferguson S.S.G. Barak L.S. Menard L. Caron M.G. J. Biol. Chem. 1996; 271: 18302-18305Abstract Full Text Full Text PDF PubMed Scopus (398) Google Scholar, 34Oh P. McIntosh D.P. Schnitzer J.E. J. Cell Biol. 1998; 141: 101-114Crossref PubMed Scopus (553) Google Scholar, 35Henley J.R. Krueger E.W.A. Oswald B.J. McNiven M.A. J. Cell Biol. 1998; 141: 85-99Crossref PubMed Scopus (619) Google Scholar). We present here a previously undescribed model for CXCR1 chemokine receptor internalization whereby we have demonstrated that GRK2, β-arrestin, and dynamin are necessary molecules for the entry of CXCR1 into the cell. Upon IL-8 binding, GRK2 phosphorylates C-terminal serine-threonine residues on CXCR1 allowing β-arrestins to couple phosphorylated receptor to cytoplasmic complexes containing clathrin. Furthermore, our data demonstrates that dynamin is required to pinch off CCVs containing CXCR1 and allow vesicular entry of the activated receptor into the cell. The importance of chemokine receptor internalization may be to serve as a mechanism of reducing the chemotactic activity of leukocytes under conditions of high exposure to inflammatory stimuli thereby preventing their continued migration and departure from the site of inflammation. These studies provide insight into the biochemical factors involved in chemokine receptor entry into the cell and thus may further our understanding of the inflammatory process. We thank Dr. Bruce M. Gill for critical review of this paper and Anne Leaist for excellent technical assistance.