Portal de Periódicos da CAPES

Catalytic Mechanism and Structure of Viral Flavin-dependent Thymidylate Synthase ThyX

2006; Elsevier BV; Volume: 281; Issue: 33 Linguagem: Inglês

10.1074/jbc.m600745200

1083-351X

Sébastien Graziani, Julie Bernauer, Stéphane Skouloubris, Marc Graille, Cong‐Zhao Zhou, Christophe Marchand, Paulette Decottignies, Herman van Tilbeurgh, Hannu Myllykallio, Ursula Liebl,

Porphyrin Metabolism and Disorders

By using biochemical and structural analyses, we have investigated the catalytic mechanism of the recently discovered flavin-dependent thymidylate synthase ThyX from Paramecium bursaria chlorella virus-1 (PBCV-1). Site-directed mutagenesis experiments have identified several residues implicated in either NADPH oxidation or deprotonation activity of PBCV-1 ThyX. Chemical modification by diethyl pyrocarbonate and mass spectroscopic analyses identified a histidine residue (His53) crucial for NADPH oxidation and located in the vicinity of the redox active N-5 atom of the FAD ring system. Moreover, we observed that the conformation of active site key residues of PBCV-1 ThyX differs from earlier reported ThyX structures, suggesting structural changes during catalysis. Steady-state kinetic analyses support a reaction mechanism where ThyX catalysis proceeds via formation of distinct ternary complexes without formation of a methyl enzyme intermediate. By using biochemical and structural analyses, we have investigated the catalytic mechanism of the recently discovered flavin-dependent thymidylate synthase ThyX from Paramecium bursaria chlorella virus-1 (PBCV-1). Site-directed mutagenesis experiments have identified several residues implicated in either NADPH oxidation or deprotonation activity of PBCV-1 ThyX. Chemical modification by diethyl pyrocarbonate and mass spectroscopic analyses identified a histidine residue (His53) crucial for NADPH oxidation and located in the vicinity of the redox active N-5 atom of the FAD ring system. Moreover, we observed that the conformation of active site key residues of PBCV-1 ThyX differs from earlier reported ThyX structures, suggesting structural changes during catalysis. Steady-state kinetic analyses support a reaction mechanism where ThyX catalysis proceeds via formation of distinct ternary complexes without formation of a methyl enzyme intermediate. All cellular organisms need thymidylate (dTMP) for the replication of their chromosomes, as dTMP is required for the biosynthesis of dTTP, a building block of DNA. Cells can produce thymidylate either de novo from dUMP or incorporate thymidine using thymidine kinase. The de novo pathway of dTMP synthesis requires a specific enzyme, thymidylate synthase, that methylates dUMP at position 5 of the pyrimidine ring. Two structurally and mechanistically distinct classes of thymidylate synthases exist. The well studied ThyA proteins (EC 2.1.1.45) catalyze the reductive methylation reaction of dUMP, with methylenetetrahydrofolate (CH2H4folate) 6The abbreviations used are: CH2H4folate, methylenetetrahydrofolate; PBCV-1, P. bursaria chlorella virus-1; DEPC, diethylpyrocarbonate; MALDI-TOF MS, matrix-assisted laser desorption ionization-time of flight mass spectrometry; r.m.s.d., root-mean-square distance. serving as one-carbon donor and as source of reductive power (reviewed in Ref. 1Carreras C.W. Santi D.V. Annu. Rev. Biochem. 1995; 64: 721-762Crossref PubMed Scopus (663) Google Scholar). On the other hand, the recently discovered ThyX (EC 2.1.1.148) family of thymidylate synthases contains FAD (2Myllykallio H. Lipowski G. Leduc D. Filee J. Forterre P. Liebl U. Science. 2002; 297: 105-107Crossref PubMed Scopus (221) Google Scholar) that is tightly bound by a novel fold (3Mathews I.I. Deacon A.M. Canaves J.M. McMullan D. Lesley S.A. Agarwalla S. Kuhn P. Structure (Camb.). 2003; 11: 677-690Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). FAD mediates hydride transfer from NADPH during catalysis (4Agrawal N. Lesley S.A. Kuhn P. Kohen A. Biochemistry. 2004; 43: 10295-10301Crossref PubMed Scopus (53) Google Scholar, 5Gattis S.G. Palfey B.A. J. Am. Chem. Soc. 2005; 127: 832-833Crossref PubMed Scopus (26) Google Scholar, 6Graziani S. Xia Y. Gurnon J.R. Van Etten J.L. Leduc D. Skouloubris S. Myllykallio H. Liebl U. J. Biol. Chem. 2004; 279: 54340-54347Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Consequently, in the reaction catalyzed by ThyX, CH2H4folate serves only as a carbon donor, leading to the prediction that tetrahydrofolate (and not dihydrofolate as is the case for ThyA) is produced (2Myllykallio H. Lipowski G. Leduc D. Filee J. Forterre P. Liebl U. Science. 2002; 297: 105-107Crossref PubMed Scopus (221) Google Scholar). This prediction has recently been confirmed by identifying tetrahydrofolate as a reaction product of Chlamydia trachomatis ThyX using high pressure liquid chromatography (7Griffin J. Roshick C. Iliffe-Lee E. McClarty G. J. Biol. Chem. 2005; 280: 5456-5467Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). The catalytic reaction of thymidylate synthase ThyA is a sequential ordered mechanism in which dUMP binding is followed by the entry of CH2H4folate, and subsequent ternary complex formation with dUMP and CH2H4folate simultaneously bound to the enzyme (8Daron H.H. Aull J.L. J. Biol. Chem. 1978; 253: 940-945Abstract Full Text PDF PubMed Google Scholar, 9Lorenson M.Y. Maley G.F. Maley F. J. Biol. Chem. 1967; 242: 3332-3344Abstract Full Text PDF PubMed Google Scholar). This was demonstrated by thorough steady-state kinetic measurements using varying concentrations of these two substrates of the ThyA reaction. Moreover, by using fluoro-dUMP in the reaction mixtures, this covalent ternary complex can readily be trapped for ThyA proteins (10Pogolotti Jr., A.L. Ivanetich K.M. Sommer H. Santi D.V. Biochem. Biophys. Res. Commun. 1976; 70: 972-978Crossref PubMed Scopus (47) Google Scholar). Although ThyX catalysis is of considerable interest for detecting and designing new anti-microbial compounds (2Myllykallio H. Lipowski G. Leduc D. Filee J. Forterre P. Liebl U. Science. 2002; 297: 105-107Crossref PubMed Scopus (221) Google Scholar), our understanding of the reaction mechanism of this enzyme is still incomplete. Several models propose that the catalytic cascade of different ThyX proteins starts with oxidation of NADPH (4Agrawal N. Lesley S.A. Kuhn P. Kohen A. Biochemistry. 2004; 43: 10295-10301Crossref PubMed Scopus (53) Google Scholar, 5Gattis S.G. Palfey B.A. J. Am. Chem. Soc. 2005; 127: 832-833Crossref PubMed Scopus (26) Google Scholar, 6Graziani S. Xia Y. Gurnon J.R. Van Etten J.L. Leduc D. Skouloubris S. Myllykallio H. Liebl U. J. Biol. Chem. 2004; 279: 54340-54347Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), a reaction step that does not occur during ThyA catalysis. We have proposed earlier that Paramecium bursaria chlorella virus-1 (PBCV-1) ThyX uses a reaction mechanism with the formation of a ternary complex of CH2H4folate and dUMP bound to the enzyme (6Graziani S. Xia Y. Gurnon J.R. Van Etten J.L. Leduc D. Skouloubris S. Myllykallio H. Liebl U. J. Biol. Chem. 2004; 279: 54340-54347Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). This proposal is compatible with a structural model where dUMP and CH2H4folate are simultaneously docked at the active site of ThyX from Thermotoga maritima (4Agrawal N. Lesley S.A. Kuhn P. Kohen A. Biochemistry. 2004; 43: 10295-10301Crossref PubMed Scopus (53) Google Scholar). However, a ping-pong mechanism involving the formation of a methyl enzyme as a reaction intermediate has been proposed for C. trachomatis ThyX proteins (7Griffin J. Roshick C. Iliffe-Lee E. McClarty G. J. Biol. Chem. 2005; 280: 5456-5467Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Fluoro dUMP does not seem to form a covalent intermediate with ThyX enzymes (11Leduc D. Graziani S. Lipowski G. Marchand C. Le Marechal P. Liebl U. Myllykallio H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 7252-7257Crossref PubMed Scopus (47) Google Scholar), complicating the analysis of the ThyX reaction. Consequently, it is currently unknown whether this discrepancy results from experimental differences or rather indicates that ThyX proteins from viral and cellular sources might use different reaction mechanisms. The goal of this work is to obtain detailed insight into the enzymatic mechanism of the highly active PBCV-1 ThyX protein using a combination of biochemical and structural approaches. We therefore identified and further investigated several residues required for substrate binding and/or catalysis of PBCV-1 ThyX. Moreover, we report the crystal structure of the PBCV-1 ThyX tetramer that provides a structural basis for the interpretation of the obtained functional data. We observed that the conformation of active site key residues of PBCV-1 ThyX is different from earlier reported ThyX structures, suggesting that the active site undergoes structural changes during catalysis. Our detailed steady-state kinetic analyses continue to indicate that ThyX uses a reaction mechanism where catalysis proceeds via formation of distinct ternary complexes. Bacterial Strains—The bacterial strains used in this study are Escherichia coli BL21 (F- ompT hsdSB (rB- mB-) gal dcm; Novagen) and the thymidine auxotroph DH5α (ΔthyA::Erm (12Demarre G. Guerout A.M. Matsumoto-Mashimo C. Rowe-Magnus D.A. Marliere P. Mazel D. Res. Microbiol. 2005; 156: 245-255Crossref PubMed Scopus (227) Google Scholar)). E. coli strains were grown at 37 °C in Luria Bertani or in M9 (Difco) minimal medium (3 g/liter Na2HPO4, 1.5 g/liter KH2PO4, 0.25 g/liter NH4Cl, and 0.15 g/liter NaCl) supplemented with 2 mm MgSO4, 0.1 mm CaCl2, and 0.3% glycerol. One hundred μg/ml ampicillin and 1 mm isopropyl β-d-thiogalactopyranoside were added for plasmid maintenance or protein induction, respectively. Complementation tests were performed as described previously (11Leduc D. Graziani S. Lipowski G. Marchand C. Le Marechal P. Liebl U. Myllykallio H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 7252-7257Crossref PubMed Scopus (47) Google Scholar). Molecular Genetic Techniques and Construction of Plasmids— The pVEX plasmid containing the thyX gene from PBCV-1 is a pGEX-2T derivative that has been described previously (6Graziani S. Xia Y. Gurnon J.R. Van Etten J.L. Leduc D. Skouloubris S. Myllykallio H. Liebl U. J. Biol. Chem. 2004; 279: 54340-54347Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Site-directed mutations were introduced using the QuikChange mutagenesis kit (Stratagene) with pVEX (T7tag-a674r6His) as template using the following primer couples (all sequences are indicated in 5′ to 3′ direction): CCACAAGCATGGTCAATC and CATAGGCGGTGTTCGTAACC for H53Q; CCACAAGAAGTGGTCAATC and CATAGGCGGTGTTCTTCACC for H53K; CGCCAGCGGAGCTTCCACTTC and CGAGTCCAAGAAGCGGTCGCC for H79Q; CGCAAGCGGAGCTTCCACTTC and GTCCAAGAAGCGTTCGCCTCG for H79K; CAGGCGTACGCATCTGTGATG and CGTACGCCTGGGAAAATTCCT for R90A; GGATCCAGTACATCGAACTGC and CCCTAACCTAGGTCATGTAGC for H177Q; GGATCAAGTACATCGAACTGC and CCCTAACCTAGTTCATGTAGC for H177K; CGAACTGGCGACTTCAAACGG and GCTTGACCGCTGAAGTTTGCC for R182A. The E190G substitution was obtained as described earlier (6Graziani S. Xia Y. Gurnon J.R. Van Etten J.L. Leduc D. Skouloubris S. Myllykallio H. Liebl U. J. Biol. Chem. 2004; 279: 54340-54347Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Protein Expression and Purification—The PBCV-1 wild-type and mutant ThyX proteins were expressed in either E. coli DH5α (ΔthyA) or BL21 at 37 °C in 800 ml of LB medium containing 100 μg/ml ampicillin. Protein expression was induced by adding 1 mm isopropyl β-d-thiogalactopyranoside to early exponential phase cultures (A600 ∼ 0.5) for 3 h. His-tagged proteins were purified from cell-free extracts by gravity-flow chromatography on nickel-nitrilotriacetic acid-agarose (Qiagen) and gel filtration using an S-200 column (Amersham Biosciences). Eluted proteins were stored at -80 °C in 50 mm HEPES, pH 7.0, supplemented with 10% glycerol. Protein samples were analyzed on 12.5% SDS-PAGE and were more than 95% pure. ThyX Activity Measurements—Tritium release assays for measuring PBCV-1 ThyX activity in vitro were performed essentially as described earlier for the Helicobacter pylori ThyX protein (11Leduc D. Graziani S. Lipowski G. Marchand C. Le Marechal P. Liebl U. Myllykallio H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 7252-7257Crossref PubMed Scopus (47) Google Scholar) with 37.5 pmol of enzyme in a 25-μl reaction mixture. Reactions were terminated after 3.5 min of incubation. Kinetic parameters were determined using nonlinear regression using the software package GRAPHPAD. Typical reactions contained 10 mm MgCl2, 0.5 mm NADPH, 60 μm FAD, 500 μm CH2H4folate, 12.5 μm dUMP, 10% glycerol in 50 mm HEPES, pH 7.5. The specific activity of the [5-3H]dUMP stock (Moravek) used in the experiments was 13.6 Ci/mmol. Activities of mutant proteins analyzed were compared with those of wild-type protein obtained in parallel experiments. In double titration experiments, the concentrations of dUMP and CH2H4folate were varied from 3 to 50 μm and from 3 to 100 μm, respectively; CH2H4folate and NADPH were varied from 3 to 100 μm and from 100 to 300 μm respectively, and the concentrations of dUMP and NADPH were varied from 3 to 100 μm and from 6.25-200 μm, respectively. Where indicated, deprotonation assays were also performed using enzyme treated with diethylpyrocarbonate (see below). NADPH oxidation activity of ThyX proteins was measured using a total volume of 100 μl. Reaction components were 50 μm dUMP, 10% glycerol, 1 mm MgCl2, 400 μm NADPH, 10 μm FAD. Control experiments established that the addition of 50 μm of CH2H4folate substantially inhibited NADPH oxidation activity. Activity was monitored by net decrease of absorbance at 340 nm using a CARY 50 spectrophotometer (Varian). An extinction coefficient of 6400 cm-1 at 340 nm (ϵ340) was used to quantify absorption changes. Note that this assay is different from the spectrophotometric assay established for ThyA proteins that catalyze the oxidation of tetrahydrofolate to dihydrofolate resulting in net increase in absorption at 340 nm. Fluorescence detection measurements of oxidation activity were performed at 340 nm excitation and 460 nm emission, using a Chameleon II multilabel plate reader (Hidex Oy, Finland). Under these experimental conditions, nonmodified PBCV-1 enzyme decreased fluorescence intensity 1250 arbitrary units/min (corresponding to 100% indicated in Table 2), whereas the activity of DEPC-treated enzyme was not detectable.TABLE 2Biochemical analyses of the PBCV-1 ThyX mutant proteins For the oxidation test, 100% (1.56 pmol/min NADPH oxidized) corresponds to the level of activity measured for wild-type protein in the presence of 200 μm NADPH, 1 mm MgCl2, 10% glycerol, 50 μm dUMP, 10 μm FAD together with 0.17 μm enzyme. CH2H4folate was found to inhibit oxidation activity and was not included in reaction mixtures for oxidation tests. Deprotonation activities were measured as described under “Experimental Procedures.” ND, not determined; –, not detected (less than 3% of the value observed for the wild-type protein).SubstitutionComplementationOxidation activityDeprotonation activity kcat (min–1)/(kcat/Km) (min–1 μm–1)dUMPCH2H4folateNADPHWild type++++100%15.2/(0.43)2.6/(0.11)2.3/(0.09)H53Q– (protein insoluble)ND–––H53K– (protein insoluble)ND–––H79Q++94%8.4/(0.19)1.47/(0.05)3.2/(0.09)H79K–ND–––R90A–56%–––H177Q++31%4.6/(0.09)1.15/(0.05)4.3/(0.045)H177K–9.5%–––R182A–20%–––E190G––––– Open table in a new tab Chemical Modification of PBCV-1 ThyX with DEPC and Reversal of Reaction with Hydroxylamine—DEPC has been used to analyze the functional role of histidine residues in a number of proteins, although under certain conditions nonspecific reactions with serine and threonine residues can occur. In the presence of DEPC, histidine residues yield an N-carbethoxyhistidyl derivative that is reversible upon addition of hydroxylamine (NH2OH). In the experiments shown, DEPC was freshly diluted with absolute ethanol before each use. Its concentration was determined by reaction with imidazole as described (13Miles E.W. Methods Enzymol. 1977; 47: 431-442Crossref PubMed Scopus (814) Google Scholar). Modification of PBCV-1 ThyX was performed at 25 °C for 20 min in 980-μl final volume containing 15 μm PBCV-1 ThyX wild-type protein (15 nmol), 50 mm potassium phosphate buffer, pH 7.0, and 250 μm DEPC (the final concentration of ethanol never exceeded 3% (v/v)). A control experiment was performed under the same conditions without DEPC. 54 μl of 1 m hydroxylamine hydrochloride (adjusted to pH 7.0) was added to 490 μl of DEPC-treated PBCV-1 ThyX wild type and control solutions, and the reaction was carried out at 25 °C for 20 min. DEPC and hydroxylamine were removed by size exclusion chromatography using a 5-ml Sephadex G-25 desalting column (Amersham Biosciences) equilibrated in 50 mm potassium phosphate buffer, pH 7.0. Samples were routinely concentrated to 80 μl in a Microcon YM10 concentrator (Amicon) before proteolytic digestion and mass spectrometry. Proteolytic Digestion and MALDI-TOF Mass Spectrometry— 1 μl of trypsin (1 mg/ml) was added to 15 μl (∼1 nmol) of concentrated control protein and DEPC-inactivated ThyX before and after hydroxylamine treatment. The digestion was carried out for 5 h at 37°C in 50 mm potassium phosphate buffer, pH 7.0, in a final volume of 25 μl. Peptide mass fingerprints were recorded in reflector positive ion mode (accelerating voltage 20 kV, grid voltage 73%, guide wire 0.002%, delay 200 ns) on a Voyager DE-STR MALDI-TOF mass spectrometer (PerSeptive-Applied Biosystems) equipped with a 337 nm nitrogen laser using a close external calibration covering the range 750-4000 Da. 1 μl of peptide solutions was mixed with 3 μl of 50% acetonitrile, 0.3% trifluoroacetic acid, and 6 μl of saturated solution of μ-cyano-4-hydroxycinnamic acid in 30% acetonitrile, 0.3% trifluoroacetic acid. 1.3 μl of this premix was then deposited onto the sample plate and allowed to dry at room temperature. Chemicals—CH2H4folate was a generous gift of Dr. Moser (Eprova). FAD, dUMP, DEPC, and hydroxylamine were purchased from Sigma. Crystallization and Structure Determination—Protein samples were stored in 0.1 m Tris-HCl, pH 8.5. Protein crystals were grown at 18 °C from a 1:1 μl mixture of 10 mg/ml protein solution with 10% PEG 400, 0.1 m MgCl2, 18% isopropyl alcohol, and 5% PEG MME 550. The best crystals were obtained for the protein incubated with 1 mm FAD before crystallization. For data collection, crystals were transferred to a cryo-solution consisting of 30% PEG 400, 0.1 m MgCl2, 18% isopropyl alcohol, 5% PEG MME 550 and subsequently flash-cooled in liquid nitrogen. Diffraction data were collected at 100 K on the ID14-EH2 beam line (ESRF, Grenoble, France). These data were processed using XDS package (14Kabsch W. J. Appl. Crystallogr. 1993; 26: 795-800Crossref Scopus (3232) Google Scholar). The crystals belong to the P21212 space group with predicted two molecules per asymmetric unit and a solvent content of 51%. Molecular replacement was done using the program Molrep (15Vagin A. Teplyakov A. J. Appl. Crystallogr. 1997; 30: 1022-1025Crossref Scopus (4152) Google Scholar) and coordinates of the previously solved crystal structure of TSCP (TM0449) from T. maritima (Protein Data Bank code 1kq4 (3Mathews I.I. Deacon A.M. Canaves J.M. McMullan D. Lesley S.A. Agarwalla S. Kuhn P. Structure (Camb.). 2003; 11: 677-690Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar)). In the resulting model, the two monomers of ThyX had an Rfactor of 58.8% for data in the 20 to 4 Å range. However, by applying symmetry operations, the biologically active tetramer previously observed for TM0449 is reconstituted (3Mathews I.I. Deacon A.M. Canaves J.M. McMullan D. Lesley S.A. Agarwalla S. Kuhn P. Structure (Camb.). 2003; 11: 677-690Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar), indicating that this model is correct. This was further confirmed by automated refinement and rebuilding of the model using the program ARP/wARP (16Perrakis A. Morris R. Lamzin V.S. Nat. Struct. Biol. 1999; 6: 458-463Crossref PubMed Scopus (2564) Google Scholar), which led to automatic construction of 83% of the model and significant improvement of the Rfree. The structure was refined using the program Refmac (17Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. Sect. D. Biol. Crystallogr. 1997; 53: 240-255Crossref PubMed Scopus (13869) Google Scholar) and manually rebuilt with Turbo Frodo (18Roussel A. Cambillau C. Silicon Graphics Geometry Partner Directory. Silicon Graphics, Mountain View, CA1989Google Scholar). As some regions were found to adopt different conformations, NCS restraints were not used during refinement. The final model (the intact protein is made of 222 amino acids including the hexahistidine tag) contains residues 1-35, 39-89, and 124-216 for chain A and 1-88 and 125-215 for chain B. In addition, two FAD and 247 water molecules have been built. All these residues are well defined in the 2Fo - Fc electron density map and fall within the allowed region of the Ramachandran plot, as defined by Procheck (19Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar). Statistics for data collection and refinement are reported in Table 1.TABLE 1Data collection statistics Values in parentheses are for the highest resolution shell.Data collection statisticsSpace groupP21212Wavelength0.933 ÅUnit cell parameters a = 69.264 Å b = 76.991 Å c = 93.437 Å α = 90° β = 90° γ = 90°Resolution20.0-2.3 ÅNo. of reflections109,258No. of unique reflections22,844Multiplicity4.8RsymaRsym = ΣhΣi|Ihi – Ih|/ΣhΣi Ihi, where Ihi is the ith observation of the reflection h, and Ih is the mean intensity of reflection h (%)9.1 (32.7)Completeness (%)99.2 (97.4)I/σ(I)14.1 (5.9)Refinement statisticsReflections (working/test)21,351/1121R/Rfree (%)bRfactor = Σ|||Fo| – |Fc|||/|Fo|. Rfree was calculated with a small fraction (5%) of randomly selected reflections21.3/26.2Non-hydrogens atoms3200R.m.s.d. bonds (Å)0.010R.m.s.d. angles (°)1.310Mean B-factor (Å2)43.050Ramachandran plotMost favored91.4%Allowed8.6%a Rsym = ΣhΣi|Ihi – Ih|/ΣhΣi Ihi, where Ihi is the ith observation of the reflection h, and Ih is the mean intensity of reflection hb Rfactor = Σ|||Fo| – |Fc|||/|Fo|. Rfree was calculated with a small fraction (5%) of randomly selected reflections Open table in a new tab Structure of PBCV-1 ThyX—The crystal structure of the PBCV-1 ThyX protein complexed to its FAD cofactor was solved by molecular replacement using the T. maritima TM0449 structure (hereafter designated TmThyX) as starting model and refined to 2.3 Å resolution. As shown in Fig. 1A, the PBCV-1 ThyX monomer adopts the same hammerhead shark-shaped structure as T. maritima and Mycobacterium tuberculosis ThyX (named MtbThyX) with approximate dimensions 30 × 35 × 70 Å3 (3Mathews I.I. Deacon A.M. Canaves J.M. McMullan D. Lesley S.A. Agarwalla S. Kuhn P. Structure (Camb.). 2003; 11: 677-690Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 20Sampathkumar P. Turley S. Ulmer J.E. Rhie H.G. Sibley C.H. Hol W.G. J. Mol. Biol. 2005; 352: 1091-1104Crossref PubMed Scopus (63) Google Scholar). The monomer is made of a central α/β domain consisting of a curved four-stranded anti-parallel β-sheet (β1, β2, β4, and β3) and six helices (α1, α2, α3, α6, α7, and α8) packed against the same face of the sheet. Two additional long α-helices (α4 and α5) form a distinct domain on top of the core. The r.m.s.d. value between PBCV-1 and TmThyX or MtbThyX monomers is 1.5 or 1.95 Å, respectively (values calculated for 160-170 Cα atoms). The differences between these structures reside mainly in small variations in the orientation of the helices that are not in direct contact with the β-sheet of the central core domain (α1, α2, α8, α4, and α5). Although only two PBCV-1 ThyX monomers (chains A and B) are present in the asymmetric unit (r.m.s.d. between these two chains is 0.27 Å for all main chain atoms), a homotetramer similar to the one described previously for TmThyX and MtbThyX can be obtained by applying the space group symmetry operations (Fig. 1B, r.m.s.d. between the tetrameric forms of T. maritima and PBCV-1 ThyX is 3.81 Å for Cα atoms only) (3Mathews I.I. Deacon A.M. Canaves J.M. McMullan D. Lesley S.A. Agarwalla S. Kuhn P. Structure (Camb.). 2003; 11: 677-690Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 20Sampathkumar P. Turley S. Ulmer J.E. Rhie H.G. Sibley C.H. Hol W.G. J. Mol. Biol. 2005; 352: 1091-1104Crossref PubMed Scopus (63) Google Scholar). The homotetramer has approximate dimensions of 50 × 60 × 85 Å3. As observed previously, the tetramer is mostly formed by stacking of helices from the core domains as well as by pairwise interaction of the long helices α4 and α5 that are detached from the core domain. FAD Binding Mode—The purified PBCV-1 ThyX protein is characterized by a yellow color, indicating that the oxidized form of the flavin cofactor remains tightly bound to this viral protein during all the purification steps (3Mathews I.I. Deacon A.M. Canaves J.M. McMullan D. Lesley S.A. Agarwalla S. Kuhn P. Structure (Camb.). 2003; 11: 677-690Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 20Sampathkumar P. Turley S. Ulmer J.E. Rhie H.G. Sibley C.H. Hol W.G. J. Mol. Biol. 2005; 352: 1091-1104Crossref PubMed Scopus (63) Google Scholar). Similarly to other structures of ThyX proteins, the FAD cofactors lie in large clefts at the interface between the four monomers and adopt an elongated conformation. The FAD molecules are deeply buried because only 15% from each FAD molecule surface remains solvent-accessible. This accessible region corresponds to the isoalloxazine (flavin) ring of the FMN moiety where the redox chemistry takes place. On the opposite side of the FAD cofactor, the ribityl and AMP parts are strongly fixed onto the protein and fully buried. Surprisingly, superposition of the T. maritima and M. tuberculosis structures of flavin-dependent thymidylate synthase ThyX onto the PBCV-1 ThyX-FAD complex shows that the FAD adenosine ring adopts a different conformation in the PBCV-1 enzyme (Fig. 1, C and D). In PBCV-1 ThyX, two adenosine moieties bound to two distinct monomers are stacked together (mean distance of 3.6 Å between adenosine rings) and sandwiched inbetween two histidine rings (His177 from chain A and B′, distances of 4.1 and 3.5 Å, respectively), thus forming a four-layered ring stack. In Tm- and MtbThyX, the corresponding adenosines point away from each other and lie on the side chain from the residue directly following the RHR signature, His98 (MtbThyX) and Ile81 (TmThyX). In PBCV-1 ThyX, the pocket that is equivalent to the Mtb- and TmThyX AMP-binding site is blocked by the side chains from His83 from monomer A and Glu58, Thr171, Arg173, and Asp174 from monomer B. The phosphoribityl binding mode exhibits a high degree of similarity with structures described previously and hence will not be described here. The tricyclic isoalloxazine carries the reactive moiety of FAD. In the absence of bound dUMP, the isoalloxazine ring in PBCV-1 ThyX is solvent-accessible on its si-face, and the re-face packs onto the His53 side chain, involving this residue in hydrophobic packing interactions. In the Mtb- and TmThyX structures, the ring of the corresponding histidine and the isoalloxazine ring are not stacked but bound in a perpendicular direction at the edge of this ring. Comparison of the residues homologous to His53 in these three enzymes shows that in PBCV-1 ThyX, helix α2, which precedes the loop bearing His53, has slipped along the helical axis by about 2.7 Å, resulting in a more buried position for His53 (Fig. 1D). In addition, the isoalloxazine pyrimidine ring makes five hydrogen bonds with residues originating from three different monomers (A, A′, and B′). The interaction of the N-η1 atom from the invariant Arg78 residue (corresponding to the first arginine residue of the RHR sequence motif, characteristic of ThyX proteins) with the O-2 atom of the FAD molecule is of interest from a catalytic point of view. The presence of a largely conserved and positively charged residue near this part of the FAD was suggested to be functionally relevant either in modulating the redox potential of the cofactor or in stabilizing the anionic form of the reduced flavin (21Fraaije M.W. Mattevi A. Trends Biochem. Sci. 2000; 25: 126-132Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). The four remaining hydrogen bonds are made by the Ser55 hydroxyl group (monomer B′) with FAD N-1, the Glu86 amide group (monomer A′) with FAD O-2 as well as the Gln85 O-ϵ2, and the Glu86 carbonyl oxygen (both from monomer A′) with FAD N-3 (Fig. 1E). Identification of Functionally Important ThyX Residues Using a Structure-based Sequence Alignment—To identify functionally important ThyX residues, we first performed a structure-based sequence alignment of a diverse set of ThyX proteins (Fig. 2). A number of conserved ThyX residues have been characterized previously using site-directed mutagenesis approaches (7Griffin J. Roshick C. Iliffe-Lee E. McClarty G. J. Biol. Chem. 2005; 280: 5456-5467Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 11Leduc D. Graziani S. Lipowski G. Marchand C. Le Marechal P. Liebl U. Myllykallio H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 7252-7257Crossref PubMed Scopus (47) Google Scholar, 20Sampathkumar P. Turley S. Ulmer J.E. Rhie H.G. Sibley C.H. Hol W.G. J. Mol. Biol. 2005; 352: 1091-1104Crossref PubMed Scopus (63) Google Scholar). For instance, in H. pylori ThyX, mutation of the histidine residue equivalent to PBCV-1 ThyX His53 results in no detectable activity, although the protein is folded, as it is still able to bind FAD (11Leduc D. Graziani S. Lipowski G. Marchand C. Le Marechal P. Liebl U. Myllykallio H. Proc. Natl. Acad. S