Mutational analysis of BMP15 and GDF9 as candidate genes for premature ovarian failure
2006; Elsevier BV; Volume: 86; Issue: 4 Linguagem: Inglês
10.1016/j.fertnstert.2006.02.107
ISSN1556-5653
AutoresAshwini L. Chand, Anna P. Ponnampalam, Sarah E. Harris, Ingrid Winship, Andrew N. Shelling,
Tópico(s)Birth, Development, and Health
ResumoMutational screening of the bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) genes in a population with premature ovarian failure (POF) identified no new mutations. However, three single nucleotide polymorphisms in the BMP15 gene, two in the 5′ untranslated region (31T>G and 71C>G) and another in exon 1 (387G>A), were found to be common in both POF and control groups. Mutational screening of the bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) genes in a population with premature ovarian failure (POF) identified no new mutations. However, three single nucleotide polymorphisms in the BMP15 gene, two in the 5′ untranslated region (31T>G and 71C>G) and another in exon 1 (387G>A), were found to be common in both POF and control groups. Premature ovarian failure (POF) is a heterogeneous condition, defined as ovarian failure occurring before the age of 40 years. It is a common condition because it affects 1% of all women (1Coulam C.B. Adamson S.C. Annegers J.F. Incidence of premature ovarian failure.Obstet Gynecol. 1986; 67: 604-606PubMed Google Scholar). Two significant consequences of POF are the early loss of fertility and the clinical effects of low estrogen. Low levels of estrogen from a young age are thought to increase the risk of osteoporosis (2Luborsky J.L. Meyer P. Sowers M.F. Gold E.B. Santoro N. Premature menopause in a multi-ethnic population study of the menopause transition.Hum Reprod. 2003; 18: 199-206Crossref PubMed Scopus (288) Google Scholar). It is thought that POF occurs in instances where the ovary has lost its oocyte pool prematurely or when ovulation does not occur despite the presence of follicles (3Welt C.K. Hall J.E. Adams J.M. Taylor A.E. Relationship of estradiol and inhibin to the follicle-stimulating hormone variability in hypergonadotropic hypogonadism or premature ovarian failure.J Clin Endocrinol Metab. 2005; 90: 826-830Crossref PubMed Scopus (48) Google Scholar). This may mean that either the cohort of developing follicles undergoes atresia at accelerated rates or that the follicles become unresponsive to gonadotropin stimulation.The regulation of ovarian function is achieved by the concerted interaction of gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH), and local ovarian factors such as inhibins, activins, bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9), which are all members of the transforming growth factor β (TGFβ) superfamily (4Gougeon A. Inhibin, activin, follistatin, and transforming growth factor beta (TGF-beta): presence in the ovary and possible role in the regulation of folliculogenesis in primates.Contracept Fertil Sex. 1994; 22: 571-576PubMed Google Scholar, 5Findlay J.K. An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis.Biol Reprod. 1993; 48: 15-23Crossref PubMed Scopus (396) Google Scholar, 6Tong S. Wallace E.M. Burger H.G. Inhibins and activins: clinical advances in reproductive medicine.Clin Endocrinol (Oxf). 2003; 58: 115-127Crossref PubMed Scopus (34) Google Scholar, 7Mather J.P. Moore A. Li R.H. Activins, inhibins, and follistatins: further thoughts on a growing family of regulators.Proc Soc Exp Biol Med. 1997; 215: 209-222Crossref PubMed Scopus (244) Google Scholar, 8Knight P.G. Glister C. Potential local regulatory functions of inhibins, activins and follistatin in the ovary.Reproduction. 2001; 121: 503-512Crossref PubMed Scopus (249) Google Scholar, 9Findlay J.K. Drummond A.E. Dyson M.L. Baillie A.J. Robertson D.M. Ethier J.F. Recruitment and development of the follicle; the roles of the transforming growth factor-beta superfamily.Mol Cell Endocrinol. 2002; 191: 35-43Crossref PubMed Scopus (141) Google Scholar, 10Richards J.S. Russell D.L. Ochsner S. Hsieh M. Doyle K.H. Falender A.E. et al.Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization.Recent Prog Horm Res. 2002; 57: 195-220Crossref PubMed Scopus (357) Google Scholar).The biological role of BMP15 involves the initiation of primary follicular growth from senescence (11Laitinen M. Vuojolainen K. Jaatinen R. Ketola I. Aaltonen J. Lehtonen E. et al.A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes during folliculogenesis.Mech Dev. 1998; 78: 135-140Crossref PubMed Scopus (182) Google Scholar, 12Aaltonen J. Laitinen M.P. Vuojolainen K. Jaatinen R. Horelli-Kuitunen N. Seppa L. et al.Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis.J Clin Endocrinol Metab. 1999; 84: 2744-2750Crossref PubMed Scopus (259) Google Scholar, 13Dube J.Y. Frenette G. Paquin R. Chapdelaine P. Tremblay J. Tremblay R.R. et al.Isolation from human seminal plasma of an abundant 16-kDa protein originating from the prostate, its identification with a 94-residue peptide originally described as beta-inhibin.J Androl. 1987; 8: 182-189PubMed Google Scholar, 14Jaatinen R. Laitinen M.P. Vuojolainen K. Aaltonen J. Louhio H. Heikinheimo K. et al.Localization of growth differentiation factor-9 (GDF-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B.Mol Cell Endocrinol. 1999; 156: 189-193Crossref PubMed Scopus (111) Google Scholar, 15Otsuka F. Yao Z. Lee T. Yamamoto S. Erickson G.F. Shimasaki S. Bone morphogenetic protein-15 Identification of target cells and biological functions.J Biol Chem. 2000; 275: 39523-39528Crossref PubMed Scopus (344) Google Scholar), whereas GDF9 is crucial for folliculogenesis from the primary follicular stage onward (16Dong J. Albertini D.F. Nishimori K. Kumar T.R. Lu N. Matzuk M.M. Growth differentiation factor-9 is required during early ovarian folliculogenesis.Nature. 1996; 383: 531-535Crossref PubMed Scopus (1297) Google Scholar). The GDF9 stimulates cumulus expansion, with the induction of hyaluronan synthase 2 (HAS2), cyclooxygenase 2 (COX2), and steroidogenic acute regulator protein (StAR) (17Elvin J.A. Clark A.T. Wang P. Wolfman N.M. Matzuk M.M. Paracrine actions of growth differentiation factor-9 in the mammalian ovary.Mol Endocrinol. 1999; 13: 1035-1048Crossref PubMed Google Scholar). A recent study has demonstrated inhibition of cumulus expansion following the inhibition of GDF9 expression by RNA interference (RNAi) in oocytes. Interestingly, the down-regulation of BMP15 in this in vitro system did not appear to have any effect on cumulus expansion (18Gui L.M. Joyce I.M. RNA interference evidence that growth differentiation factor-9 mediates oocyte regulation of cumulus expansion in mice.Biol Reprod. 2005; 72: 195-199Crossref PubMed Scopus (90) Google Scholar).Nevertheless, the importance of BMP15 as a fertility regulator is evident in Inverdale and Hanna female sheep, where the disruption in BMP15 gene expression affects ovulation rates in a dosage-sensitive manner (19Galloway S.M. McNatty K.P. Cambridge L.M. Laitinen M.P. Juengel J.L. Jokiranta T.S. et al.Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner.Nat Genet. 2000; 25: 279-283Crossref PubMed Scopus (832) Google Scholar). In both strains, the heterozygous (FecXI/FecX+) sheep have increased ovulation rates and multiple births, whereas the homozygous (FecXI/FecXI) mutant females have primary ovarian failure due to an arrest in follicle growth at the primary preantral stage (19Galloway S.M. McNatty K.P. Cambridge L.M. Laitinen M.P. Juengel J.L. Jokiranta T.S. et al.Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner.Nat Genet. 2000; 25: 279-283Crossref PubMed Scopus (832) Google Scholar). Similarly, naturally occurring mutations in the GDF9 gene in Belclare and Cambridge ewes exhibit differential ovulation rates in a dose-dependent manner (20Hanrahan J.P. Gregan S.M. Mulsant P. Mullen M. Davis G.H. Powell R. et al.Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries).Biol Reprod. 2004; 70: 900-909Crossref PubMed Scopus (601) Google Scholar). The current study is a mutational analysis of the BMP15 and GDF9 genes in a cohort of women who have a clinical diagnosis of POF, with the specific aim of determining whether these are contributing factors in the pathogenesis of POF.For the purpose of this study, POF was defined as cessation of menses for a duration of ≥6 months before the age of 40 years, and an FSH concentration of >40 IU/L. Thirty-eight women with POF, who were karyotypically normal, were recruited for study in the Department of Obstetrics and Gynaecology, University of Auckland, Auckland, New Zealand. Procedures for genomic DNA extraction, polymerase chain reaction (PCR), single-strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP), and DNA sequencing were conducted as described previously (21Shelling A.N. Burton K.A. Chand A.L. van Ee C.C. France J.T. Farquhar C.M. et al.Inhibin: a candidate gene for premature ovarian failure.Hum Reprod. 2000; 15: 2644-2649Crossref PubMed Scopus (147) Google Scholar). The PCR primer sequences for GDF9 and BMP15 exons 1 and 2 were kindly provided by Dr. Ritvos, Ph.D. (University of Helsinki, Helsinki, Finland). Primer sequences for BMP15 exons 1 and 2 were derived from GenBank Sequence Reference AJ132405.For the screening of the 5′ untranslated region, GenBank Sequence AL359914 was used for reference. Primer sequences for Exon 1:F1 TTGTGTTGGGGCCTGTTGTT, R1 GGTACAACTCCAGCATGTACC;F2 GCTGCTAGAAGAATCCCCTG, R2 AACCCACCAATTCCCTTTT;Exon 2: F1 AATATTCATGTTAAGAGGTAAGA, R1 AGGAAGGGAAGTGGTTGGTT;F2 TCAATCTCTCCTGCCATGTGG, R2 TGTCCAAGGATGAAGAGCC;F3 TGGTCTTGAGCTCTGGCATG, R3 CTGATTTGGAAAGGGTGGAG;F4 CTCCGGAGAACCGAAAATAA, R4 CTCCCATTTGCCTCAATCA;RFLP Primers: F TATGAGGCAACTTTGGTCCAGGAGA, R TAAGAATACTGAGGAGGACCATCTTGAAAA; Mature peptide sequence primers:F TTGCCTTCTTGTTACTCTATTTCA, R GATTACTTGCAGCTTTAACACTGA; 5′ untranslated region:F1 AAGCTCCCCAGATGATTCCTATC, R1 CCATCCTACTTCCATGCCTCTAAT;F2 ATGGAAGTAGGATGGGAACAGG, R2 CCTCATAACTTGGCCTCTTTG;F3 ATGCTGCCTTGTCCCACCTTC, R3 GTGTTCCATGAAAAGCACGAGTTC.Primer sequences for GDF9 were derived from GenBank Sequence Reference AC004500 and are as follows:Exon 1: F1 TAGTCCACCCACACACCTGA, R1 CCAGAAGCCTGAGAACCAAG;F2 TTCCTCCTTTGGTTTTGCTG, R2 AAAGCTCTGGAGTCTGGCTG;F3 TTCTATCTGTTGGGCGAGGT, R3 CATCTTCCCTCCACCCAGT;Exon 2: F1 CTGCCTGTTGTGTTGACTGA, R1 TCTGAATCCATTTGTGTTTCTTTC;F2 CTCTCGGCAGAGCTCCATAC, R2 GGGGACACCAGAGTCATGTT;F3 TGAAAGACCAGCTGGAGCA, R3 TCAGATTGAAGGAAGCTGGG;F4 CGCAGAGGTCAGGAAACTGT, R4 GGTCTTGGCACTGAGGAGTC;F5 TCGGTATGGCTCTCCAGTTC, R5 AATATATCAAGCTTTCTCTTGAAGScreening for mutations in the two genes of interest was undertaken with a combination of SSCP and DNA sequencing techniques. Although SSCP does not detect every mutation, the fragments used were of optimal size and were run under different conditions, thereby maximizing the likelihood of finding variants. Once variants were identified, they were tested in the patient and control populations using RFLP (details from authors upon request). Calculation of allele and genotype frequencies and χ2 analysis were performed using the SHEsis software (22Shi Y.Y. He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci.Cell Res. 2005; 15: 97-98Crossref PubMed Scopus (1845) Google Scholar).No sequence variation was observed in exons 1 and 2 of the GDF9 gene in either POF subjects or the control cohort (data not shown). Mutational analysis of the DNA sequences encoding the BMP15 protein and 800 bp of the 5′ untranslated region identified three single nucleotide polymorphisms (SNPs) (Table 1). The 387G>A variant (exon 1) did not result in a change in amino acid sequence, and was identified in the POF and control populations. Although a there was a higher incidence of the SNP in the controls compared with the POF population, the difference was not statistically significant.TABLE 1Genotype frequency of common single nucleotide substitutions in the BMP15 gene in POF and control women.PositionControl (n = 51)POF (n = 38)GeneBMP15 31 T>G5′-flanking TT33 (64.7%)23 (60.5%) TG15 (29.4%)9 (23.7%) GG3 (5.9%)6 (15.8%)BMP15 71 C>G5′-flanking CC34 (66.6%)24 (63.2%) CG14 (27.5%)13 (34.2%) GG3 (5.9%)1 (2.6%)BMP15 387 G>AExon 1 GG47 (92.2%)36 (94.7%) GA1 (2.0%)1 (2.6%) AA3 (5.9%)1 (2.6%)Note: GenBank Sequence AJ132405 was used as the reference for SNP location. BMP = bone morphogenetic protein; POF = premature ovarian failure; SNP = single nucleotide polymorphism.Chand. SNPs in BMP15 and GDF9 genes and POF. Fertil Steril 2006. Open table in a new tab Two nucleotide substitutions were identified in the 5′ untranslated region, 49 nucleotides from the translation start site (31T>G), and 9 nucleotides from the translation start site (71C>G) (NCBI GenBank Sequence Reference: AJ132405). The comparison of genotype and allelic frequencies in the two populations did not indicate a statistical significance. Search of the NCBI Nucleotide Sequence Database revealed the presence of both sequence variants (AF082349:715G and AJ132405:71C). Both 31T>G and 71C>G nucleotide variants were found to occur as heterozygotes and homozygotes; however, genotype frequencies were not significantly different both patient and control groups.Although the findings of the current study are similar to that of the observations of an earlier report demonstrating a lack of sequence variation in the GDF9 and BMP15 genes in 15 POF subjects studied from a Japanese population (23Takebayashi K. Takakura K. Wang H. Kimura F. Kasahara K. Noda Y. Mutation analysis of the growth differentiation factor-9 and -9B genes in patients with premature ovarian failure and polycystic ovary syndrome.Fertil Steril. 2000; 74: 976-979Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), the current study was conducted with a larger and predominantly Caucasian population (n = 38). Recently, a heterozygous nonconservative missense mutation (BMP15 Y235C) in the region encoding the BMP15 propeptide region was reported (24Di Pasquale E. Beck-Peccoz P. Persani L. Hypergonadotropic ovarian failure associated with an inherited mutation of human bone morphogenetic protein-15 (BMP15) gene.Am J Hum Genet. 2004; 75: 106-111Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar). The carrier had prepubertal onset of hypergonadotropic ovarian failure characterized by primary amenorrhea and ovarian hypoplasia. In contrast, the mutational analysis of this region in our study did not demonstrate any sequence variation in this region. The phenotype of primary amenorrhoea and dysgenesis of the ovaries, which was exhibited by the carrier of the Y235C mutation, is far more severe than the extent of ovarian failure exhibited in the New Zealand patient group. It was concluded that DNA variations in the GDF9 and BMP15 genes are rare in the New Zealand population.Premature ovarian failure is a highly heterogeneous condition caused by autoimmune (25Luborsky J. Llanes B. Roussev R. Coulam C. Ovarian antibodies, FSH and inhibin B: independent markers associated with unexplained infertility.Hum Reprod. 2000; 15: 1046-1051Crossref PubMed Scopus (28) Google Scholar) or genetic (26Mattison D.R. Evans M.I. Schwimmer W.B. White B.J. Jensen B. Schulman J.D. Familial premature ovarian failure.Am J Hum Genet. 1984; 36: 1341-1348PubMed Google Scholar) disorders, permanent damage to the ovaries (following chemotherapy, irradiation, or surgery), and exposure to environmental toxicants (27Matikainen T. Perez G.I. Jurisicova A. Pru J.K. Schlezinger J.J. Ryu H.Y. et al.Aromatic hydrocarbon receptor-driven Bax gene expression is required for premature ovarian failure caused by biohazardous environmental chemicals.Nat Genet. 2001; 28: 355-360Crossref PubMed Scopus (379) Google Scholar). However, for the majority of cases, the causes remain unknown. Disorders linked to the X chromosome, such as Fragile X and Turner’s syndrome, are associated with POF (28Conway G.S. Hettiarachchi S. Murray A. Jacobs P.A. Fragile X premutations in familial premature ovarian failure.Lancet. 1995; 346: 309-310Abstract PubMed Google Scholar). Furthermore, specific regions are deemed important for ovarian function and are located on long arm of the X chromosome (Xq): proximally Xq13.3-q21.3 (termed POF2) (29Sala C. Arrigo G. Torri G. Martinazzi F. Riva P. Larizza L. et al.Eleven X chromosome breakpoints associated with premature ovarian failure (POF) map to a 15-Mb YAC contig spanning Xq21.Genomics. 1997; 40: 123-131Crossref PubMed Scopus (111) Google Scholar) (30Powell C.M. Taggart R.T. Drumheller T.C. Wangsa D. Qian C. Nelson L.M. et al.Molecular and cytogenetic studies of an X autosome translocation in a patient with premature ovarian failure and review of the literature.Am J Med Genet. 1994; 52: 19-26Crossref PubMed Scopus (141) Google Scholar) or distally on Xq26-q28 (termed POF1) (31Tharapel A.T. Anderson K.P. Simpson J.L. Martens P.R. Wilroy Jr, R.S. Llerena Jr, J.C. et al.Deletion (X)(q26.1-q28) in a proband and her mother: molecular characterization and phenotypic-karyotypic deductions.Am J Hum Genet. 1993; 52: 463-471PubMed Google Scholar, 32Marozzi A. Manfredini E. Tibiletti M.G. Furlan D. Villa N. Vegetti W. et al.Molecular definition of Xq common-deleted region in patients affected by premature ovarian failure.Human Genetics. 2000; 107: 304-311Crossref PubMed Scopus (96) Google Scholar). Other X chromosomal genes that may cause POF include DIAPH2, which is thought to affect cell divisions required for ovarian follicle formation (33Bione S. Sala C. Manzini C. Arrigo G. Zuffardi O. Banfi S. et al.A human homologue of the Drosophila melanogaster diaphanous gene is disrupted in a patient with premature ovarian failure: evidence for conserved function in oogenesis and implications for human sterility.Am J Hum Genet. 1998; 62: 533-541Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar); the FSH primary response homolog 1 (FSHPRH1) gene at Xq22, which is potentially involved in the response of gonadal tissues to FSH (34Roberts R.G. Kendall E. Vetrie D. Bobrow M. Sequence and chromosomal location of a human homologue of LRPR1, an FSH primary response gene.Genomics. 1996; 37: 122-124Crossref PubMed Scopus (16) Google Scholar); and the ZFX gene encoding a zinc-finger protein, DFFRX, which possibly has a role oocyte proliferation and gonadal degeneration in Turner’s syndrome (35Jones M.H. Furlong R.A. Burkin H. Chalmers I.J. Brown G.M. Khwaja O. et al.The Drosophila developmental gene fat facets has a human homologue in Xp11.4 which escapes X-inactivation and has related sequences on Yq11.2.Hum Mol Genet. 1996; 5: 1695-1701Crossref PubMed Scopus (125) Google Scholar).Several autosomal genetic mutations reportedly have a significant correlation with POF. These include mutations in the inhibin α subunit (21Shelling A.N. Burton K.A. Chand A.L. van Ee C.C. France J.T. Farquhar C.M. et al.Inhibin: a candidate gene for premature ovarian failure.Hum Reprod. 2000; 15: 2644-2649Crossref PubMed Scopus (147) Google Scholar, 36Marozzi A. Porta C. Vegetti W. Crosignani P.G. Tibiletti M.G. Dalpra L. et al.Mutation analysis of the inhibin alpha gene in a cohort of Italian women affected by ovarian failure.Hum Reprod. 2002; 17: 1741-1745Crossref PubMed Scopus (93) Google Scholar, 37Dixit H. Deendayal M. Singh L. Mutational analysis of the mature peptide region of inhibin genes in Indian women with ovarian failure.Hum Reprod. 2004; 19: 1760-1764Crossref PubMed Scopus (68) Google Scholar), the FSH receptor (38Aittomaki K. Lucena J.L. Pakarinen P. Sistonen P. Tapanainen J. Gromoll J. et al.Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure.Cell. 1995; 82: 959-968Abstract Full Text PDF PubMed Scopus (818) Google Scholar, 39Beau I. Touraine P. Meduri G. Gougeon A. Desroches A. Matuchansky C. et al.A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor.J Clin Invest. 1998; 102: 1352-1359Crossref PubMed Scopus (228) Google Scholar, 40Touraine P. Beau I. Gougeon A. Meduri G. Desroches A. Pichard C. et al.New natural inactivating mutations of the follicle-stimulating hormone receptor: correlations between receptor function and phenotype.Mol Endocrinol. 1999; 13: 1844-1854Crossref PubMed Google Scholar), LH receptor (41Takahashi K. Ozaki T. Kanasaki H. Miyazaki K. Successful pregnancy in a woman with ovarian failure associated with mutation in the beta-subunit of luteinizing hormone.Horm Res. 2001; 55: 258-263Crossref PubMed Scopus (13) Google Scholar, 42Latronico A.C. Anasti J. Arnhold I.J. Mendonca B.B. Domenice S. Albano M.C. et al.A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty.J Clin Endocrinol Metab. 1995; 80: 2490-2494Crossref PubMed Google Scholar, 43Misrahi M. Meduri G. Pissard S. Bouvattier C. Beau I. Loosfelt H. et al.Comparison of immunocytochemical and molecular features with the phenotype in a case of incomplete male pseudohermaphroditism associated with a mutation of the luteinizing hormone receptor.J Clin Endocrinol Metab. 1997; 82: 2159-2165Crossref PubMed Scopus (85) Google Scholar, 44Toledo S.P. Brunner H.G. Kraaij R. Post M. Dahia P.L. Hayashida C.Y. et al.An inactivating mutation of the luteinizing hormone receptor causes amenorrhea in a 46,XX female.J Clin Endocrinol Metab. 1996; 81: 3850-3854Crossref PubMed Scopus (178) Google Scholar), and the Forkhead transcription factor FOXL2 (45Harris S.E. Chand A.L. Winship I.M. Gersak K. Aittomaki K. Shelling A.N. Identification of novel mutations in FOXL2 associated with premature ovarian failure.Mol Hum Reprod. 2002; 8: 729-733Crossref PubMed Scopus (154) Google Scholar). On the basis of current knowledge on genes with proven roles in female reproductive system, it has been suggested that up to 30% of all POF cases may be attributed to a genetic cause (46Vegetti W. Grazia Tibiletti M. Testa G. de Lauretis Y. Alagna F. Castoldi E. et al.Inheritance in idiopathic premature ovarian failure: analysis of 71 cases.Human Reproduction. 1998; 13: 1796-1800Crossref PubMed Scopus (118) Google Scholar).The current study did not demonstrate a contribution of BMP15 and GDF9 genes in the pathogenesis of POF in the New Zealand population. The identification of the BMP15 Y235C in a patient with hypergonadotropic ovarian failure in the Italian population, but not in the New Zealand or the Japanese population, suggests that it is a rare event. We suggest the POF may be due to defects in several genes, with each mutation affecting only a small number of patients. However, the ultimate understanding of the contribution of ovary-specific genes and pathways will eventually enable early detection or prediction of those at risk for developing POF. Premature ovarian failure (POF) is a heterogeneous condition, defined as ovarian failure occurring before the age of 40 years. It is a common condition because it affects 1% of all women (1Coulam C.B. Adamson S.C. Annegers J.F. Incidence of premature ovarian failure.Obstet Gynecol. 1986; 67: 604-606PubMed Google Scholar). Two significant consequences of POF are the early loss of fertility and the clinical effects of low estrogen. Low levels of estrogen from a young age are thought to increase the risk of osteoporosis (2Luborsky J.L. Meyer P. Sowers M.F. Gold E.B. Santoro N. Premature menopause in a multi-ethnic population study of the menopause transition.Hum Reprod. 2003; 18: 199-206Crossref PubMed Scopus (288) Google Scholar). It is thought that POF occurs in instances where the ovary has lost its oocyte pool prematurely or when ovulation does not occur despite the presence of follicles (3Welt C.K. Hall J.E. Adams J.M. Taylor A.E. Relationship of estradiol and inhibin to the follicle-stimulating hormone variability in hypergonadotropic hypogonadism or premature ovarian failure.J Clin Endocrinol Metab. 2005; 90: 826-830Crossref PubMed Scopus (48) Google Scholar). This may mean that either the cohort of developing follicles undergoes atresia at accelerated rates or that the follicles become unresponsive to gonadotropin stimulation. The regulation of ovarian function is achieved by the concerted interaction of gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH), and local ovarian factors such as inhibins, activins, bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9), which are all members of the transforming growth factor β (TGFβ) superfamily (4Gougeon A. Inhibin, activin, follistatin, and transforming growth factor beta (TGF-beta): presence in the ovary and possible role in the regulation of folliculogenesis in primates.Contracept Fertil Sex. 1994; 22: 571-576PubMed Google Scholar, 5Findlay J.K. An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis.Biol Reprod. 1993; 48: 15-23Crossref PubMed Scopus (396) Google Scholar, 6Tong S. Wallace E.M. Burger H.G. Inhibins and activins: clinical advances in reproductive medicine.Clin Endocrinol (Oxf). 2003; 58: 115-127Crossref PubMed Scopus (34) Google Scholar, 7Mather J.P. Moore A. Li R.H. Activins, inhibins, and follistatins: further thoughts on a growing family of regulators.Proc Soc Exp Biol Med. 1997; 215: 209-222Crossref PubMed Scopus (244) Google Scholar, 8Knight P.G. Glister C. Potential local regulatory functions of inhibins, activins and follistatin in the ovary.Reproduction. 2001; 121: 503-512Crossref PubMed Scopus (249) Google Scholar, 9Findlay J.K. Drummond A.E. Dyson M.L. Baillie A.J. Robertson D.M. Ethier J.F. Recruitment and development of the follicle; the roles of the transforming growth factor-beta superfamily.Mol Cell Endocrinol. 2002; 191: 35-43Crossref PubMed Scopus (141) Google Scholar, 10Richards J.S. Russell D.L. Ochsner S. Hsieh M. Doyle K.H. Falender A.E. et al.Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization.Recent Prog Horm Res. 2002; 57: 195-220Crossref PubMed Scopus (357) Google Scholar). The biological role of BMP15 involves the initiation of primary follicular growth from senescence (11Laitinen M. Vuojolainen K. Jaatinen R. Ketola I. Aaltonen J. Lehtonen E. et al.A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes during folliculogenesis.Mech Dev. 1998; 78: 135-140Crossref PubMed Scopus (182) Google Scholar, 12Aaltonen J. Laitinen M.P. Vuojolainen K. Jaatinen R. Horelli-Kuitunen N. Seppa L. et al.Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis.J Clin Endocrinol Metab. 1999; 84: 2744-2750Crossref PubMed Scopus (259) Google Scholar, 13Dube J.Y. Frenette G. Paquin R. Chapdelaine P. Tremblay J. Tremblay R.R. et al.Isolation from human seminal plasma of an abundant 16-kDa protein originating from the prostate, its identification with a 94-residue peptide originally described as beta-inhibin.J Androl. 1987; 8: 182-189PubMed Google Scholar, 14Jaatinen R. Laitinen M.P. Vuojolainen K. Aaltonen J. Louhio H. Heikinheimo K. et al.Localization of growth differentiation factor-9 (GDF-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B.Mol Cell Endocrinol. 1999; 156: 189-193Crossref PubMed Scopus (111) Google Scholar, 15Otsuka F. Yao Z. Lee T. Yamamoto S. Erickson G.F. Shimasaki S. Bone morphogenetic protein-15 Identification of target cells and biological functions.J Biol Chem. 2000; 275: 39523-39528Crossref PubMed Scopus (344) Google Scholar), whereas GDF9 is crucial for folliculogenesis from the primary follicular stage onward (16Dong J. Albertini D.F. Nishimori K. Kumar T.R. Lu N. Matzuk M.M. Growth differentiation factor-9 is required during early ovarian folliculogenesis.Nature. 1996; 383: 531-535Crossref PubMed Scopus (1297) Google Scholar). The GDF9 stimulates cumulus expansion, with the induction of hyaluronan synthase 2 (HAS2), cyclooxygenase 2 (COX2), and steroidogenic acute regulator protein (StAR) (17Elvin J.A. Clark A.T. Wang P. Wolfman N.M. Matzuk M.M. Paracrine actions of growth differentiation factor-9 in the mammalian ovary.Mol Endocrinol. 1999; 13: 1035-1048Crossref PubMed Google Scholar). A recent study has demonstrated inhibition of cumulus expansion following the inhibition of GDF9 expression by RNA interference (RNAi) in oocytes. Interestingly, the down-regulation of BMP15 in this in vitro system did not appear to have any effect on cumulus expansion (18Gui L.M. Joyce I.M. RNA interference evidence that growth differentiation factor-9 mediates oocyte regulation of cumulus expansion in mice.Biol Reprod. 2005; 72: 195-199Crossref PubMed Scopus (90) Google Scholar). Nevertheless, the importance of BMP15 as a fertility regulator is evident in Inverdale and Hanna female sheep, where the disruption in BMP15 gene expression affects ovulation rates in a dosage-sensitive manner (19Galloway S.M. McNatty K.P. Cambridge L.M. Laitinen M.P. Juengel J.L. Jokiranta T.S. et al.Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner.Nat Genet. 2000; 25: 279-283Crossref PubMed Scopus (832) Google Scholar). In both strains, the heterozygous (FecXI/FecX+) sheep have increased ovulation rates and multiple births, whereas the homozygous (FecXI/FecXI) mutant females have primary ovarian failure due to an arrest in follicle growth at the primary preantral stage (19Galloway S.M. McNatty K.P. Cambridge L.M. Laitinen M.P. Juengel J.L. Jokiranta T.S. et al.Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner.Nat Genet. 2000; 25: 279-283Crossref PubMed Scopus (832) Google Scholar). Similarly, naturally occurring mutations in the GDF9 gene in Belclare and Cambridge ewes exhibit differential ovulation rates in a dose-dependent manner (20Hanrahan J.P. Gregan S.M. Mulsant P. Mullen M. Davis G.H. Powell R. et al.Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries).Biol Reprod. 2004; 70: 900-909Crossref PubMed Scopus (601) Google Scholar). The current study is a mutational analysis of the BMP15 and GDF9 genes in a cohort of women who have a clinical diagnosis of POF, with the specific aim of determining whether these are contributing factors in the pathogenesis of POF. For the purpose of this study, POF was defined as cessation of menses for a duration of ≥6 months before the age of 40 years, and an FSH concentration of >40 IU/L. Thirty-eight women with POF, who were karyotypically normal, were recruited for study in the Department of Obstetrics and Gynaecology, University of Auckland, Auckland, New Zealand. Procedures for genomic DNA extraction, polymerase chain reaction (PCR), single-strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP), and DNA sequencing were conducted as described previously (21Shelling A.N. Burton K.A. Chand A.L. van Ee C.C. France J.T. Farquhar C.M. et al.Inhibin: a candidate gene for premature ovarian failure.Hum Reprod. 2000; 15: 2644-2649Crossref PubMed Scopus (147) Google Scholar). The PCR primer sequences for GDF9 and BMP15 exons 1 and 2 were kindly provided by Dr. Ritvos, Ph.D. (University of Helsinki, Helsinki, Finland). Primer sequences for BMP15 exons 1 and 2 were derived from GenBank Sequence Reference AJ132405. For the screening of the 5′ untranslated region, GenBank Sequence AL359914 was used for reference. Primer sequences for Exon 1:F1 TTGTGTTGGGGCCTGTTGTT, R1 GGTACAACTCCAGCATGTACC;F2 GCTGCTAGAAGAATCCCCTG, R2 AACCCACCAATTCCCTTTT;Exon 2: F1 AATATTCATGTTAAGAGGTAAGA, R1 AGGAAGGGAAGTGGTTGGTT;F2 TCAATCTCTCCTGCCATGTGG, R2 TGTCCAAGGATGAAGAGCC;F3 TGGTCTTGAGCTCTGGCATG, R3 CTGATTTGGAAAGGGTGGAG;F4 CTCCGGAGAACCGAAAATAA, R4 CTCCCATTTGCCTCAATCA;RFLP Primers: F TATGAGGCAACTTTGGTCCAGGAGA, R TAAGAATACTGAGGAGGACCATCTTGAAAA; Mature peptide sequence primers:F TTGCCTTCTTGTTACTCTATTTCA, R GATTACTTGCAGCTTTAACACTGA; 5′ untranslated region:F1 AAGCTCCCCAGATGATTCCTATC, R1 CCATCCTACTTCCATGCCTCTAAT;F2 ATGGAAGTAGGATGGGAACAGG, R2 CCTCATAACTTGGCCTCTTTG;F3 ATGCTGCCTTGTCCCACCTTC, R3 GTGTTCCATGAAAAGCACGAGTTC. Primer sequences for GDF9 were derived from GenBank Sequence Reference AC004500 and are as follows:Exon 1: F1 TAGTCCACCCACACACCTGA, R1 CCAGAAGCCTGAGAACCAAG;F2 TTCCTCCTTTGGTTTTGCTG, R2 AAAGCTCTGGAGTCTGGCTG;F3 TTCTATCTGTTGGGCGAGGT, R3 CATCTTCCCTCCACCCAGT;Exon 2: F1 CTGCCTGTTGTGTTGACTGA, R1 TCTGAATCCATTTGTGTTTCTTTC;F2 CTCTCGGCAGAGCTCCATAC, R2 GGGGACACCAGAGTCATGTT;F3 TGAAAGACCAGCTGGAGCA, R3 TCAGATTGAAGGAAGCTGGG;F4 CGCAGAGGTCAGGAAACTGT, R4 GGTCTTGGCACTGAGGAGTC;F5 TCGGTATGGCTCTCCAGTTC, R5 AATATATCAAGCTTTCTCTTGAAG Screening for mutations in the two genes of interest was undertaken with a combination of SSCP and DNA sequencing techniques. Although SSCP does not detect every mutation, the fragments used were of optimal size and were run under different conditions, thereby maximizing the likelihood of finding variants. Once variants were identified, they were tested in the patient and control populations using RFLP (details from authors upon request). Calculation of allele and genotype frequencies and χ2 analysis were performed using the SHEsis software (22Shi Y.Y. He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci.Cell Res. 2005; 15: 97-98Crossref PubMed Scopus (1845) Google Scholar). No sequence variation was observed in exons 1 and 2 of the GDF9 gene in either POF subjects or the control cohort (data not shown). Mutational analysis of the DNA sequences encoding the BMP15 protein and 800 bp of the 5′ untranslated region identified three single nucleotide polymorphisms (SNPs) (Table 1). The 387G>A variant (exon 1) did not result in a change in amino acid sequence, and was identified in the POF and control populations. Although a there was a higher incidence of the SNP in the controls compared with the POF population, the difference was not statistically significant. Note: GenBank Sequence AJ132405 was used as the reference for SNP location. BMP = bone morphogenetic protein; POF = premature ovarian failure; SNP = single nucleotide polymorphism. Chand. SNPs in BMP15 and GDF9 genes and POF. Fertil Steril 2006. Two nucleotide substitutions were identified in the 5′ untranslated region, 49 nucleotides from the translation start site (31T>G), and 9 nucleotides from the translation start site (71C>G) (NCBI GenBank Sequence Reference: AJ132405). The comparison of genotype and allelic frequencies in the two populations did not indicate a statistical significance. Search of the NCBI Nucleotide Sequence Database revealed the presence of both sequence variants (AF082349:715G and AJ132405:71C). Both 31T>G and 71C>G nucleotide variants were found to occur as heterozygotes and homozygotes; however, genotype frequencies were not significantly different both patient and control groups. Although the findings of the current study are similar to that of the observations of an earlier report demonstrating a lack of sequence variation in the GDF9 and BMP15 genes in 15 POF subjects studied from a Japanese population (23Takebayashi K. Takakura K. Wang H. Kimura F. Kasahara K. Noda Y. Mutation analysis of the growth differentiation factor-9 and -9B genes in patients with premature ovarian failure and polycystic ovary syndrome.Fertil Steril. 2000; 74: 976-979Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), the current study was conducted with a larger and predominantly Caucasian population (n = 38). Recently, a heterozygous nonconservative missense mutation (BMP15 Y235C) in the region encoding the BMP15 propeptide region was reported (24Di Pasquale E. Beck-Peccoz P. Persani L. Hypergonadotropic ovarian failure associated with an inherited mutation of human bone morphogenetic protein-15 (BMP15) gene.Am J Hum Genet. 2004; 75: 106-111Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar). The carrier had prepubertal onset of hypergonadotropic ovarian failure characterized by primary amenorrhea and ovarian hypoplasia. In contrast, the mutational analysis of this region in our study did not demonstrate any sequence variation in this region. The phenotype of primary amenorrhoea and dysgenesis of the ovaries, which was exhibited by the carrier of the Y235C mutation, is far more severe than the extent of ovarian failure exhibited in the New Zealand patient group. It was concluded that DNA variations in the GDF9 and BMP15 genes are rare in the New Zealand population. Premature ovarian failure is a highly heterogeneous condition caused by autoimmune (25Luborsky J. Llanes B. Roussev R. Coulam C. Ovarian antibodies, FSH and inhibin B: independent markers associated with unexplained infertility.Hum Reprod. 2000; 15: 1046-1051Crossref PubMed Scopus (28) Google Scholar) or genetic (26Mattison D.R. Evans M.I. Schwimmer W.B. White B.J. Jensen B. Schulman J.D. Familial premature ovarian failure.Am J Hum Genet. 1984; 36: 1341-1348PubMed Google Scholar) disorders, permanent damage to the ovaries (following chemotherapy, irradiation, or surgery), and exposure to environmental toxicants (27Matikainen T. Perez G.I. Jurisicova A. Pru J.K. Schlezinger J.J. Ryu H.Y. et al.Aromatic hydrocarbon receptor-driven Bax gene expression is required for premature ovarian failure caused by biohazardous environmental chemicals.Nat Genet. 2001; 28: 355-360Crossref PubMed Scopus (379) Google Scholar). However, for the majority of cases, the causes remain unknown. Disorders linked to the X chromosome, such as Fragile X and Turner’s syndrome, are associated with POF (28Conway G.S. Hettiarachchi S. Murray A. Jacobs P.A. Fragile X premutations in familial premature ovarian failure.Lancet. 1995; 346: 309-310Abstract PubMed Google Scholar). Furthermore, specific regions are deemed important for ovarian function and are located on long arm of the X chromosome (Xq): proximally Xq13.3-q21.3 (termed POF2) (29Sala C. Arrigo G. Torri G. Martinazzi F. Riva P. Larizza L. et al.Eleven X chromosome breakpoints associated with premature ovarian failure (POF) map to a 15-Mb YAC contig spanning Xq21.Genomics. 1997; 40: 123-131Crossref PubMed Scopus (111) Google Scholar) (30Powell C.M. Taggart R.T. Drumheller T.C. Wangsa D. Qian C. Nelson L.M. et al.Molecular and cytogenetic studies of an X autosome translocation in a patient with premature ovarian failure and review of the literature.Am J Med Genet. 1994; 52: 19-26Crossref PubMed Scopus (141) Google Scholar) or distally on Xq26-q28 (termed POF1) (31Tharapel A.T. Anderson K.P. Simpson J.L. Martens P.R. Wilroy Jr, R.S. Llerena Jr, J.C. et al.Deletion (X)(q26.1-q28) in a proband and her mother: molecular characterization and phenotypic-karyotypic deductions.Am J Hum Genet. 1993; 52: 463-471PubMed Google Scholar, 32Marozzi A. Manfredini E. Tibiletti M.G. Furlan D. Villa N. Vegetti W. et al.Molecular definition of Xq common-deleted region in patients affected by premature ovarian failure.Human Genetics. 2000; 107: 304-311Crossref PubMed Scopus (96) Google Scholar). Other X chromosomal genes that may cause POF include DIAPH2, which is thought to affect cell divisions required for ovarian follicle formation (33Bione S. Sala C. Manzini C. Arrigo G. Zuffardi O. Banfi S. et al.A human homologue of the Drosophila melanogaster diaphanous gene is disrupted in a patient with premature ovarian failure: evidence for conserved function in oogenesis and implications for human sterility.Am J Hum Genet. 1998; 62: 533-541Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar); the FSH primary response homolog 1 (FSHPRH1) gene at Xq22, which is potentially involved in the response of gonadal tissues to FSH (34Roberts R.G. Kendall E. Vetrie D. Bobrow M. Sequence and chromosomal location of a human homologue of LRPR1, an FSH primary response gene.Genomics. 1996; 37: 122-124Crossref PubMed Scopus (16) Google Scholar); and the ZFX gene encoding a zinc-finger protein, DFFRX, which possibly has a role oocyte proliferation and gonadal degeneration in Turner’s syndrome (35Jones M.H. Furlong R.A. Burkin H. Chalmers I.J. Brown G.M. Khwaja O. et al.The Drosophila developmental gene fat facets has a human homologue in Xp11.4 which escapes X-inactivation and has related sequences on Yq11.2.Hum Mol Genet. 1996; 5: 1695-1701Crossref PubMed Scopus (125) Google Scholar). Several autosomal genetic mutations reportedly have a significant correlation with POF. These include mutations in the inhibin α subunit (21Shelling A.N. Burton K.A. Chand A.L. van Ee C.C. France J.T. Farquhar C.M. et al.Inhibin: a candidate gene for premature ovarian failure.Hum Reprod. 2000; 15: 2644-2649Crossref PubMed Scopus (147) Google Scholar, 36Marozzi A. Porta C. Vegetti W. Crosignani P.G. Tibiletti M.G. Dalpra L. et al.Mutation analysis of the inhibin alpha gene in a cohort of Italian women affected by ovarian failure.Hum Reprod. 2002; 17: 1741-1745Crossref PubMed Scopus (93) Google Scholar, 37Dixit H. Deendayal M. Singh L. Mutational analysis of the mature peptide region of inhibin genes in Indian women with ovarian failure.Hum Reprod. 2004; 19: 1760-1764Crossref PubMed Scopus (68) Google Scholar), the FSH receptor (38Aittomaki K. Lucena J.L. Pakarinen P. Sistonen P. Tapanainen J. Gromoll J. et al.Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure.Cell. 1995; 82: 959-968Abstract Full Text PDF PubMed Scopus (818) Google Scholar, 39Beau I. Touraine P. Meduri G. Gougeon A. Desroches A. Matuchansky C. et al.A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor.J Clin Invest. 1998; 102: 1352-1359Crossref PubMed Scopus (228) Google Scholar, 40Touraine P. Beau I. Gougeon A. Meduri G. Desroches A. Pichard C. et al.New natural inactivating mutations of the follicle-stimulating hormone receptor: correlations between receptor function and phenotype.Mol Endocrinol. 1999; 13: 1844-1854Crossref PubMed Google Scholar), LH receptor (41Takahashi K. Ozaki T. Kanasaki H. Miyazaki K. Successful pregnancy in a woman with ovarian failure associated with mutation in the beta-subunit of luteinizing hormone.Horm Res. 2001; 55: 258-263Crossref PubMed Scopus (13) Google Scholar, 42Latronico A.C. Anasti J. Arnhold I.J. Mendonca B.B. Domenice S. Albano M.C. et al.A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty.J Clin Endocrinol Metab. 1995; 80: 2490-2494Crossref PubMed Google Scholar, 43Misrahi M. Meduri G. Pissard S. Bouvattier C. Beau I. Loosfelt H. et al.Comparison of immunocytochemical and molecular features with the phenotype in a case of incomplete male pseudohermaphroditism associated with a mutation of the luteinizing hormone receptor.J Clin Endocrinol Metab. 1997; 82: 2159-2165Crossref PubMed Scopus (85) Google Scholar, 44Toledo S.P. Brunner H.G. Kraaij R. Post M. Dahia P.L. Hayashida C.Y. et al.An inactivating mutation of the luteinizing hormone receptor causes amenorrhea in a 46,XX female.J Clin Endocrinol Metab. 1996; 81: 3850-3854Crossref PubMed Scopus (178) Google Scholar), and the Forkhead transcription factor FOXL2 (45Harris S.E. Chand A.L. Winship I.M. Gersak K. Aittomaki K. Shelling A.N. Identification of novel mutations in FOXL2 associated with premature ovarian failure.Mol Hum Reprod. 2002; 8: 729-733Crossref PubMed Scopus (154) Google Scholar). On the basis of current knowledge on genes with proven roles in female reproductive system, it has been suggested that up to 30% of all POF cases may be attributed to a genetic cause (46Vegetti W. Grazia Tibiletti M. Testa G. de Lauretis Y. Alagna F. Castoldi E. et al.Inheritance in idiopathic premature ovarian failure: analysis of 71 cases.Human Reproduction. 1998; 13: 1796-1800Crossref PubMed Scopus (118) Google Scholar). The current study did not demonstrate a contribution of BMP15 and GDF9 genes in the pathogenesis of POF in the New Zealand population. The identification of the BMP15 Y235C in a patient with hypergonadotropic ovarian failure in the Italian population, but not in the New Zealand or the Japanese population, suggests that it is a rare event. We suggest the POF may be due to defects in several genes, with each mutation affecting only a small number of patients. However, the ultimate understanding of the contribution of ovary-specific genes and pathways will eventually enable early detection or prediction of those at risk for developing POF.
Referência(s)