Mapping of MST1 Kinase Sites of Phosphorylation
2002; Elsevier BV; Volume: 277; Issue: 45 Linguagem: Inglês
10.1074/jbc.m208538200
ISSN1083-351X
AutoresHelmut Glantschnig, Gideon A. Rodan, Alfred A. Reszka,
Tópico(s)Cellular Mechanics and Interactions
ResumoMST1 is a member of the Sterile-20 family of cytoskeletal, stress, and apoptotic kinases. MST1 is activated by phosphorylation at previously unidentified sites. This study examines the role of phosphorylation at several sites and effects on kinase activation. We define Thr183 in subdomain VIII as a primary site of phosphoactivation. Thr187 is also critical for kinase activity. Phosphorylation of MST1 in subdomain VIII was catalyzed by active MST1 via intermolecular autophosphorylation, enhanced by homodimerization. Active MST1 (wild-type or T183E), but not inactive Thr183/Thr187 mutants, was also highly autophosphorylated at the newly identified Thr177 and Thr387 residues. Cells expressing active MST1 were mostly detached, whereas with inactive MST1, adhesion was normal. Active MKK4, JNK, caspase-3, and caspase-9 were detected in the detached cells. These cells also contained all autophosphorylated and essentially all caspase-cleaved MST1. Similar phenotypes were elicited by a caspase-insensitive D326N mutant, suggesting that kinase activity, but not cleavage of MST1, is required. Interestingly, an S327E mutant mimicking Ser327 autophosphorylation was also caspase-insensitive, but only when expressed in caspase-3-deficient cells. Together, these data suggest a model whereby MST1 activation is induced by existing, active MST kinase, which phosphorylates Thr183 and possibly Thr187. Dimerization promotes greater phosphorylation. This leads to induction of the JNK signaling pathway, caspase activation, and apoptosis. Further activation of MST1 by caspase cleavage is best promoted by caspase-3, although this appears to be unnecessary for signaling and morphological responses. MST1 is a member of the Sterile-20 family of cytoskeletal, stress, and apoptotic kinases. MST1 is activated by phosphorylation at previously unidentified sites. This study examines the role of phosphorylation at several sites and effects on kinase activation. We define Thr183 in subdomain VIII as a primary site of phosphoactivation. Thr187 is also critical for kinase activity. Phosphorylation of MST1 in subdomain VIII was catalyzed by active MST1 via intermolecular autophosphorylation, enhanced by homodimerization. Active MST1 (wild-type or T183E), but not inactive Thr183/Thr187 mutants, was also highly autophosphorylated at the newly identified Thr177 and Thr387 residues. Cells expressing active MST1 were mostly detached, whereas with inactive MST1, adhesion was normal. Active MKK4, JNK, caspase-3, and caspase-9 were detected in the detached cells. These cells also contained all autophosphorylated and essentially all caspase-cleaved MST1. Similar phenotypes were elicited by a caspase-insensitive D326N mutant, suggesting that kinase activity, but not cleavage of MST1, is required. Interestingly, an S327E mutant mimicking Ser327 autophosphorylation was also caspase-insensitive, but only when expressed in caspase-3-deficient cells. Together, these data suggest a model whereby MST1 activation is induced by existing, active MST kinase, which phosphorylates Thr183 and possibly Thr187. Dimerization promotes greater phosphorylation. This leads to induction of the JNK signaling pathway, caspase activation, and apoptosis. Further activation of MST1 by caspase cleavage is best promoted by caspase-3, although this appears to be unnecessary for signaling and morphological responses. mitogen-activated protein kinase c-Jun N-terminal kinase mitogen-activated protein kinase/extracellular signal-regulated kinase kinase mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase tumor necrosis factor p21-activated kinase mitogen-activated protein kinase kinase wild-type β-glycerophosphate/HEPES-buffered solution SAPK/Erk kinase stress-activated protein kinase poly(ADP-ribose) polymerase combined caspase-3, -6, and -7 activities extracellular signal-regulated kinase cycloheximide In mammalian cells, Sterile-20 (Ste20)-related kinases participate in the regulation of the cytoskeleton that controls cell morphology and motility, and in the regulation of apoptosis (1Dan I. Watanabe N.M. Kusumi A. Trends Cell Biol. 2001; 11: 220-230Abstract Full Text Full Text PDF PubMed Scopus (514) Google Scholar). These kinases share a conserved catalytic (kinase) domain at the amino terminus and a C-terminal regulatory region of great structural diversity, which interacts with signaling molecules that regulate the cytoskeleton. Currently, four closely related MST kinases have been described (5Creasy C.L. Chernoff J. J. Biol. Chem. 1995; 270: 21695-21700Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 6Creasy C.L. Chernoff J. Gene (Amst.). 1995; 167: 303-306Crossref PubMed Scopus (119) Google Scholar, 7Qian Z. Lin C. Espinosa R. LeBeau M. Rosner M.R. J. Biol. Chem. 2001; 276: 22439-22445Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 8Schinkmann K. Blenis J. J. Biol. Chem. 1997; 272: 28695-28703Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 9Taylor L.K. Wang H.C. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10099-10104Crossref PubMed Scopus (141) Google Scholar). Most Ste20 group kinases activate mitogen-activated protein kinase (MAPK)1cascades in the signaling pathways between the cellular membrane and the nuclear compartment (2Hagemann C. Blank J.L. Cell. Signal. 2001; 13: 863-875Crossref PubMed Scopus (245) Google Scholar). In yeast, the mating pheromone receptor Ste20p phosphorylates and activates a MAPK kinase kinase, Ste11p, raising the possibility that mammalian homologs of Ste20p (e.g. MST1 kinase) also function as MAPK kinase kinase kinases (3Wu C. Whiteway M. Thomas D.Y. Leberer E. J. Biol. Chem. 1995; 270: 15984-15992Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 4Graves J.D. Gotoh Y. Draves K.E. Ambrose D. Han D.K. Wright M. Chernoff J. Clark E.A. Krebs E.G. EMBO J. 1998; 17: 2224-2234Crossref PubMed Scopus (325) Google Scholar). MST1 was shown to act upstream of MAPK kinases that regulate p38 and JNK activities, probably acting via the MAPK kinase kinase MEKK1 (10Graves J.D. Draves K.E. Gotoh Y. Krebs E.G. Clark E.A. J. Biol. Chem. 2001; 276: 14909-14915Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). There is substantial evidence that MST1 promotes apoptosis, although its role in this process may vary in different cell types. Overexpression of MST1 can induce apoptosis and nuclear condensation in BJAB, 293T and COS-1 cells (4Graves J.D. Gotoh Y. Draves K.E. Ambrose D. Han D.K. Wright M. Chernoff J. Clark E.A. Krebs E.G. EMBO J. 1998; 17: 2224-2234Crossref PubMed Scopus (325) Google Scholar, 14Ura S. Masuyama N. Graves J.D. Gotoh Y. Genes Cells. 2001; 6: 519-530Crossref PubMed Scopus (102) Google Scholar, 15Ura S. Masuyama N. Graves J.D. Gotoh Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 10148-10153Crossref PubMed Scopus (140) Google Scholar), whereas MST1 promotes nuclear condensation without apparent chromosomal cleavage in HeLa cells (13Lee K.K. Ohyama T. Yajima N. Tsubuki S. Yonehara S. J. Biol. Chem. 2001; 276: 19276-19285Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). A consistent feature of MST1 in all tested cell types is its proteolytic cleavage by caspase, in response to apoptotic stimuli, to a 34–36-kDa product (hereafter referred to as 36-kDa MST1). Cleavage increases MST1 kinase activity severalfold (4Graves J.D. Gotoh Y. Draves K.E. Ambrose D. Han D.K. Wright M. Chernoff J. Clark E.A. Krebs E.G. EMBO J. 1998; 17: 2224-2234Crossref PubMed Scopus (325) Google Scholar, 16Lee K.K. Murakawa M. Nishida E. Tsubuki S. Kawashima S. Sakamaki K. Yonehara S. Oncogene. 1998; 16: 3029-3037Crossref PubMed Scopus (120) Google Scholar, 17Reszka A.A. Halasy-Nagy J.M. Masarachia P.J. Rodan G.A. J. Biol. Chem. 1999; 274: 34967-34973Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar, 18Watabe M. Kakeya H. Osada H. Oncogene. 1999; 18: 5211-5220Crossref PubMed Scopus (48) Google Scholar, 19Kakeya H. Onose R. Osada H. Ann. N. Y. Acad. Sci. 1999; 886: 273-275Crossref PubMed Scopus (7) Google Scholar) and influences its subcellular localization (13Lee K.K. Ohyama T. Yajima N. Tsubuki S. Yonehara S. J. Biol. Chem. 2001; 276: 19276-19285Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar, 15Ura S. Masuyama N. Graves J.D. Gotoh Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 10148-10153Crossref PubMed Scopus (140) Google Scholar). Recently, a second caspase cleavage site was identified in the human MST1 sequence that is absent in mouse MST1 and in MST2 from several species (10Graves J.D. Draves K.E. Gotoh Y. Krebs E.G. Clark E.A. J. Biol. Chem. 2001; 276: 14909-14915Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Mutation of this site has no impact on accumulation of the 36-kDa species. Expression of a kinase-dead MST1 mutant (K59R) can partially or fully suppress apoptosis or chromatin condensation in HL-60 and 293T cells treated with chemical apoptotic stimuli (15Ura S. Masuyama N. Graves J.D. Gotoh Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 10148-10153Crossref PubMed Scopus (140) Google Scholar, 18Watabe M. Kakeya H. Osada H. Oncogene. 1999; 18: 5211-5220Crossref PubMed Scopus (48) Google Scholar). This protective effect is associated with suppression of both JNK activity and DNA fragmentation. However, the K59R mutant fails to suppress apoptosis in BJAB and HeLa cells treated with Fas ligand or TNF-α (4Graves J.D. Gotoh Y. Draves K.E. Ambrose D. Han D.K. Wright M. Chernoff J. Clark E.A. Krebs E.G. EMBO J. 1998; 17: 2224-2234Crossref PubMed Scopus (325) Google Scholar, 16Lee K.K. Murakawa M. Nishida E. Tsubuki S. Kawashima S. Sakamaki K. Yonehara S. Oncogene. 1998; 16: 3029-3037Crossref PubMed Scopus (120) Google Scholar). The basis for the cell type- and stimulus-specific differences in MST function has not yet been elucidated. Interestingly, like PAK proteins (11Rudel T. Bokoch G.M. Science. 1997; 276: 1571-1574Crossref PubMed Scopus (605) Google Scholar, 12Sells M.A. Knaus U.G. Bagrodia S. Ambrose D.M. Bokoch G.M. Chernoff J. Curr. Biol. 1997; 7: 202-210Abstract Full Text Full Text PDF PubMed Scopus (579) Google Scholar), MST1 (full-length or cleaved) can have a profound effect on cell shape (cell rounding and detachment) independent of caspase activation and prior to nuclear condensation (13Lee K.K. Ohyama T. Yajima N. Tsubuki S. Yonehara S. J. Biol. Chem. 2001; 276: 19276-19285Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). This action and the high basal activity of MST1 kinase suggest a possible function unrelated to apoptosis. Stress-inducing agents such as staurosporine and sodium arsenite (9Taylor L.K. Wang H.C. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10099-10104Crossref PubMed Scopus (141) Google Scholar) can increase MST1 kinase activity; however, no physiological activator of MST1 has been identified, and little is known about the endogenous activation of MST1. Recently, it was proposed that in addition to caspase cleavage, MST1 phosphorylation at yet unidentified sites contributes to kinase activation (10Graves J.D. Draves K.E. Gotoh Y. Krebs E.G. Clark E.A. J. Biol. Chem. 2001; 276: 14909-14915Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), as has been observed for PAK2 (20Gatti A. Huang Z. Tuazon P.T. Traugh J.A. J. Biol. Chem. 1999; 274: 8022-8028Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 21Walter B.N. Huang Z. Jakobi R. Tuazon P.T. Alnemri E.S. Litwack G. Traugh J.A. J. Biol. Chem. 1998; 273: 28733-28739Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). Creasy and Chernoff (5Creasy C.L. Chernoff J. J. Biol. Chem. 1995; 270: 21695-21700Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar) showed that dephosphorylation of MST1 with protein phosphatase-2A in vitro results in 3–4-fold stimulation of activity, suggesting that phosphorylation sites are involved in suppression of activity. The physiological occurrence of this type of phosphoregulation of MST1 has not been reported. To address some of the questions related to MST regulation, we performed a structure-function analysis of MST1 phosphorylation sites. We identified novel phosphorylation sites and, by mutational analysis, demonstrated a role for intermolecular autophosphorylation of the activation loop of MST1 in subdomain VIII. We identified Thr183 and Thr187 as essential for kinase activity and for effects on farther downstream targets such as MKK4 and JNK. Phosphorylation at Thr177 altered the electrophoretic mobility of MST1, suggesting an influence on the conformation of the activation loop. We also found that MST1 phosphorylation status had no effect on MST1 cleavage by caspase-3 during apoptosis, but might influence susceptibility to cleavage by other caspases. Mouse fibroblast NIH-3T3 cells and African green monkey kidney COS-1 cells were obtained from American Type Culture Collection (Manassas, VA). Cells were cultivated at 37 °C in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 2 mml-glutamine, 100 units/ml penicillin G, and 100 μg/ml streptomycin in a humidified atmosphere with 5% CO2. MCF7 cells (MCF7/pBI pool) and caspase-3-expressing WTC3/MCF7 cells were kindly provided by Sophie Roy (Merck Frosst, Kirkland, Canada) and cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin G, 100 μg/ml streptomycin, 100 μg/ml Geneticin, and 150 μg/ml hygromycin B (Invitrogen). Apoptosis of MCF7 cells was induced by treatment with TNF (35 ng/ml) and cycloheximide (50 μm) for 6–7 h. Mouse osteoclast mRNA was reverse-transcribed with PowerScript reverse transcriptase (Clontech, Palo Alto, CA), and full-length MST1 was amplified with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA) and mouse MST1-specific primers: Primer 1 containing anSfiI site (5′-CTTATGGCCATGGAGGCCATGGAGACCGTGCAGCTGAGGAACCCACC) and Primer 2 (5′-GGGAGATCTTTGTCAGAAGTTCTGTTGCCTCCTCTTCTTGGCTTCAATGG) containing a BglII site. The 1.45-kb PCR product was directionally inserted into the SfiI/BglII sites of pCMV-Myc (Clontech) in-frame with the Myc epitope tag and designated Myc-MST1(WT). The MST1 N-terminal kinase domain (amino acids 1–326) corresponding to the caspase cleavage product of mouse MST1 was amplified using Primer 1 together with Primer 3 (5′-TCGCGGTACCTCAATCCATTTCATCCTCCTCTGAGTT) containing a KpnI site and a termination codon. This was then ligated into the SfiI/KpnI sites of pCMV-Myc. C-terminally V5 epitope-tagged MST1 was constructed by cloning in-frame into the pcDNA3.1/V5-His vector (Invitrogen). Site-directed mutagenesis was performed with a QuikChange site-directed mutagenesis kit (Stratagene) following the manufacturer's instructions. All mutations were confirmed by sequencing. NIH-3T3 or COS-1 cells were seeded at 30,000 cells/cm2, and MCF7 cells were seeded at 50,000 cells/cm2 in six-well multi-dishes and allowed to adhere for at least 8 h or overnight before transfection. Cells were transfected with 0.8 μg of DNA and 4 μg of FuGENE 6 reagent (Roche Molecular Biochemicals) according to the manufacturer's instructions. Cultures were then maintained for at least 18 h before protein lysates were made. After treatments, cells were placed on ice and washed twice with ice-cold β-glycerophosphate/HEPES-buffered solution (β-HBS; 50 mm HEPES (pH 7.6), 50 mm β-glycerophosphate, 1 mm EGTA, and 150 mm NaCl). For collection of floating cells, the culture medium was pooled with the washes and centrifuged at 5000 × g to pellet cells. Cell pellets were suspended in 1 ml of β-HBS, transferred to microcentrifuge tubes, and pelleted at 20,000 ×g. For collection of adherent cells, cells were scraped from the dish in ∼500 μl of residual β-HBS, transferred to microcentrifuge tubes, and pelleted at 20,000 × g. Cells were then lysed in β-HBS containing Triton X-100 (0.2%) supplemented with microcystin LR (1 μm), Na3VO4 (1 mm), dithiothreitol (1 mm), phenylmethylsulfonyl fluoride (1 mm), and a protease inhibitor mixture (Sigma) (22Reszka A.A. Halasy-Nagy J. Rodan G.A. Mol. Pharmacol. 2001; 59: 193-202Crossref PubMed Scopus (150) Google Scholar). Protein concentrations were determined using a Bradford reagent kit (Bio-Rad). Equal amounts of protein lysates were loaded and separated on 7.5, 12, or 4–15% gradient Tris-HCl gels (Bio-Rad). Proteins were transferred onto polyvinylidene difluoride membranes, which were blocked with 5% milk and 5% bovine serum albumin in 10 mmTris-HCl (pH 8.0), 150 mm NaCl, and 0.1% Tween 20). Primary antibodies were incubated overnight at 4 °C with gentle agitation. Monoclonal anti-Myc antibody (1:50,000; Clontech); monoclonal anti-V5 epitope antibody (1:10,000; Invitrogen); phospho-Ab1 (raised against phospho-Ser189/Ser207 MKK3/6 peptide), phospho-Ab2 (raised against phospho-Thr423 PAK1 peptide), and phospho-Ab3 (raised against phospho-(R/K)X(R/K)XX(S/T) motifs; catalog no. 9611) (all from Cell Signaling Technology, Beverly, MA); and anti-phospho-Thr261 SEK1/MKK4 antibody, anti-phospho-Thr183/Tyr185 SAPK/JNK antibody, anti-phospho-Thr180/Tyr182 p38 MAPK antibody, and anti-poly(ADP-ribose) polymerase (PARP) antibody (all at 1:1000;Cell Signaling Technology) were diluted in blocking solution. Detection was performed with alkaline phosphatase-coupled secondary antibodies (1:10,000; Santa Cruz Biotechnology, Santa Cruz, CA) and enhanced chemifluorescence substrate (Amersham Biosciences) using an Amersham Biosciences Storm system. Protein lysates (50 μg) were diluted in 1 ml of ice-cold β-HBS-IP (β-HBS containing Tween 20 (0.05%) and the protease inhibitor mixture noted above) and then combined with primary antibody (3 μg) and protein G-conjugated agarose beads (20-μl bead volume; Sigma). Lysate/antibody/bead mixtures were gently mixed overnight at 4 °C. The beads were then washed four times with ice-cold β-HBS-IP. Antibodies and antigen were released by suspending beads in Laemmli sample buffer (Bio-Rad) containing 5% 2-mercaptoethanol and boiled or mixed vigorously at 37 °C. Kinase assays were performed in-gel using the method described previously (17Reszka A.A. Halasy-Nagy J.M. Masarachia P.J. Rodan G.A. J. Biol. Chem. 1999; 274: 34967-34973Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar) with one modification: the kinase buffer contained 20 mm MgCl2 in place of 5 mm MnCl2. Lanes were loaded with equivalent amounts of protein lysate (5–10 μg/lane) or the entirety of each immunoprecipitation, and then gels were electrophoresed and processed for kinase assay. Dried gels were exposed to phosphorimaging screens and scanned and analyzed using the Amersham Biosciences Storm system. For auto- and transphosphorylation studies, Myc-tagged MST1, MST1(D326N), MST1(K59R/D326N), MST1-(1–326), and MST1(K59R)-(1–326) were separately transfected into COS-1 cells. Proteins were isolated 20 h after transfections, and the expression levels of diverse Myc-MST1 protein variants were assessed by Western blotting with anti-Myc antibody. Myc-tagged MST1 proteins were immunoprecipitated. To precipitate two different constructs on the same beads, lysates from independent transfections were mixed together prior to immunoprecipitation, which was then carried out as described above. Immunoprecipitates were washed twice with kinase buffer (20 mm HEPES (pH 7.6) and 10 mm MgCl2). Kinase assays were performed in 50 μl of kinase buffer with 5 μCi of [γ-32P]ATP (3000 Ci/mmol; PerkinElmer Life Sciences) or in 1 mm ATP for 25 min at 30 °C. The kinase reaction was stopped by adding Laemmli sample buffer, and each reaction was subjected to SDS-PAGE using 12% acrylamide gels. The fluorescent caspase-3 (DEVDase) activity assay kit was from Biovision Inc.; caspase-9 (LEHDase) and caspase-8 (IETDase) activity assay kits were from Oncogene Research Products (Boston, MA). Cells were washed with Hanks' buffered salt solution and lysed and scraped in the lysis buffer supplied by the manufacturer. Lysates were cleared by centrifugation, and supernatants were assayed according to the instructions provided with each kit. 40–90 μg of total protein were used per assay, and activities were determined after a 2-h incubation at 37 °C. Values are in relative fluorescence units/μg of protein. Cells were cotransfected with various Myc-MST1-encoding plasmids (0.8 μg) and the pcDNA3.1/lacZi expression vector (0.5 μg; Invitrogen) as described above. After 48 h, the plates were washed twice with phosphate-buffered saline, and adherent cells were fixed in 0.2% glutaraldehyde for 5 min. After fixation, cells were stained overnight at 37 °C with 1 mg/ml 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal), 5 mm potassium ferricyanide, 5 mm potassium ferrocyanide, and 2 mm MgCl2 in phosphate-buffered saline. MST1 was cloned from mouse osteoclast-like cells by reverse transcription-PCR using specific primers for the mouse sequence and is referred to throughout as MST1(WT). A nucleotide missense mutation (Lys instead of Glu at residue 198), by comparison with the published mouse and human sequences, was corrected by site-directed mutagenesis (K198E). Constructs described hereafter were expressed with an N-terminal Myc tag, unless otherwise noted. The general features of MST1 and amino acid residues targeted in this study are depicted schematically in Fig.1. NIH-3T3 cells were transfected with full-length MST1 or cleaved MST1-(1–326), visualized in Fig. 2 (A and B) by immunoblot and in-gel kinase analyses, respectively. The in-gel kinase activity of the MST1(WT) construct was substantial (Fig.2 B) and was not further increased by staurosporine treatment of transfected NIH-3T3 or COS-1 cells (data not shown). Overexpression of active MST1(WT) caused cell rounding and eventual detachment of NIH-3T3 cells. This was recorded as a reduction in the number of adherent cells 24 h after transfection (Fig.3, A and B) and by the increase in the activity of the wild-type kinase in the floating cell population (Fig. 3 C).Figure 3Cell detachment by non-caspase-cleavable MST1(D326N), but not by inactive MST1(T183A). A, shown is the cell detachment induced by MST1 overexpression. MST1 constructs were cotransfected with β-galactosidase-encoding pcDNA3.1/lacZi in NIH-3T3 cells. After 48 h, adherent cells were fixed and stained for β-galactosidase activity. Bar = 100 μm. B, the number of β-galactosidase (β-Gal)-positive cells in 10 observation fields (×10) was determined. Results are means ± S.D. from a representative experiment. The experiment was repeated three times with similar results. C, cell lysates of adherent (A) and floating (F) cell populations were analyzed for kinase activities by in-gel kinase assays (upper panel), and caspase activation was assessed by immunoblotting for PARP (lower panel). Myc-tagged full-length MST1 (MST1 FL) and the Myc-tagged MST1 caspase cleavage product (MST1 1–326) are indicated. PARP (p116) and the caspase cleavage product of PARP (p89) are also marked.View Large Image Figure ViewerDownload (PPT) To investigate the contribution of MST1 cleavage and kinase activity to the effects of the exogenous constructs on morphology, we expressed kinase-dead (MST1(K59R)), truncated (MST1-(1–326)), and caspase-insensitive (MST1(D326N)) mutant kinases (Fig. 2, Aand B) in NIH-3T3 cells. Consistent with a previous report (13Lee K.K. Ohyama T. Yajima N. Tsubuki S. Yonehara S. J. Biol. Chem. 2001; 276: 19276-19285Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar), kinase activity was required for MST1 induction of cell rounding and detachment (Fig. 3, A and B). Interestingly, the morphological phenotype and cell detachment generated by the full-length caspase-resistant (MST1(D326N)) and truncated (MST1-(1–326)) constructs were indistinguishable from those elicited by the MST1(WT) kinase. MST1 kinase activity thus seems to be both necessary and sufficient to produce morphological changes, in contrast to chromatin condensation, which requires MST1 caspase cleavage or expression of the truncated species (26Messmer U.K. Pereda-Fernandez C. Manderscheid M. Pfeilschifter J. Br. J. Pharmacol. 2001; 133: 467-476Crossref PubMed Scopus (69) Google Scholar). To further investigate the link between MST1 activity, caspase activity, and cell detachment, we separately collected and analyzed adherent and detached cells. In terms of total protein, there were ∼3-fold more floating cells when transfected with MST1(WT) or MST1(D326N) than when transfected with vector as measured 24 h post-transfection. Caspase activities were measured directly or by PARP cleavage. Detachment of cells correlated with induction of apoptosis, as assessed by generation of the 89-kDa PARP fragment (Fig.3 C, lower panel), which was cleaved in all floating cell populations transfected with vector, MST1(WT), or MST1(D326N). This correlated with fluorometric measurements of caspase-3 and caspase-9 activities, which were increased by >90-fold in floating versus adherent cells (activity/mg of protein). Total caspase-3 activity in floating cells expressing MST1(WT) and MST1(D326N) was increased by up to 6.3- and 4.2-fold, respectively, compared with the vector control. This reflected both an increase in the number of detached cells and an up to 2-fold average increase in caspase activity per floating cell. MST1 activity was determined by in-gel kinase assays at the same 24-h time point (Fig. 3 C). To more accurately assess kinase activity per cell, lanes were loaded with equivalent amounts of protein. The activities of full-length MST1(WT) and MST1(D326N) were increased by ∼20-fold in floating versus adherent cells. The activity of the 36-kDa MST1(WT) caspase cleavage product was mostly found in the floating cell population and at levels equal to the full-length kinase. In adherent cells, the 36-kDa caspase-cleaved MST1(WT) kinase showed about one-fourth of the activity of the full-length kinase. Because MST1(D326N) was caspase-resistant, no 36-kDa kinase activity was observed, and the full-length activity was approximately equal to that of the combined full-length and caspase-cleaved MST1(WT) kinases. Together, these data suggest that expression of active MST1 leads to concomitant cell detachment and caspase activation. Caspase cleavage of MST1 in and of itself is not required for either process. Alignment of MST1 subdomain VIII with other members of the Ste20 family and MKK3 and MKK6 kinases (Fig. 4 A) shows conservation in MST1 of phosphoregulated residues. Thr177aligns with the phosphoacceptor Ser189/Ser207residues in MKK3 and MKK6, respectively; and Thr183 aligns with the phosphorylated Thr423 residue in PAK1. Thr175 and Thr187 are also conserved among the Ste20 family members, although phosphorylation at these sites has not been described. We used two approaches to investigate putative phosphorylation at these residues and their relationship to MST1 kinase function. (a) Using site-directed mutagenesis, we replaced all four putative phosphorylatable residues with alanine (T175A, T177A, T183A, and T187A) or glutamate (T175E, T177E, T183E, and T187E) and assessed catalytic activities (Fig. 4 B). (b) We used phospho-specific antibodies to probe for putative phosphorylation at Thr177 (antibody Ab1) and Thr183 (antibody Ab2) (Fig. 4 C), similar to a previous approach assessing phosphorylation at Thr423 of PAK1 (23Zenke F.T. King C.C. Bohl B.P. Bokoch G.M. J. Biol. Chem. 1999; 274: 32565-32573Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). Mutation of Thr183 and Thr187 altered the catalytic activity of MST1 (Fig. 4 B, lower panel). The T183A mutation reduced the estimated activity to 1–3% of that of MST1(WT). This substitution was somewhat more effective than the analogous T423A mutation in PAK1, which maintains 12% of the wild-type kinase activity (23Zenke F.T. King C.C. Bohl B.P. Bokoch G.M. J. Biol. Chem. 1999; 274: 32565-32573Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). Even more substantial was the complete loss of catalytic activity observed with the T187A mutation. Consistent with a role for Thr183 phosphorylation in MST1 kinase activation, the T183E mutant was partially active, with glutamate substituting for a putative phosphorylated threonine. However, the T187E mutant remained completely inactive, which is more analogous to the effects of similar substitutions in MAPKs such as ERK2 (24Zhang J. Zhang F. Ebert D. Cobb M.H. Goldsmith E.J. Structure. 1995; 3: 299-307Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). As in the case of the K59R mutant, lack of kinase activity following expression of T183A (Fig. 3, A and B) and T187A or T187E (data not shown) resulted in little or no morphological rounding and detachment of NIH-3T3 cells. Meanwhile, expression of the mostly active T183E mutant caused morphological rounding and detachment that were comparable to those caused by the wild-type kinase (Fig. 3, A and B). Mutations of Thr175 and Thr177 did not alter catalytic activity (see T175A, T175E, T177A, and T177E in Fig. 4 B,lower panel), and morphological cell rounding was comparable to that obtained with the MST1(WT) kinase (data not shown). A phosphorylation-dependent MST1 band shift was recently reported for the cleaved MST1 kinase (13Lee K.K. Ohyama T. Yajima N. Tsubuki S. Yonehara S. J. Biol. Chem. 2001; 276: 19276-19285Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar), although the responsible residue(s) were not identified. Likely candidates are identified here because mutations of Thr177 and Thr183 altered the electrophoretic mobility of the kinase. The T177A mutant showed reduced mobility of both the full-lengt
Referência(s)