Nop5p Is a Small Nucleolar Ribonucleoprotein Component Required for Pre-18 S rRNA Processing in Yeast
1998; Elsevier BV; Volume: 273; Issue: 26 Linguagem: Inglês
10.1074/jbc.273.26.16453
ISSN1083-351X
AutoresPei Wu, J. Scott Brockenbrough, Angela C. Metcalfe, Shaoping Chen, John P. Aris,
Tópico(s)RNA and protein synthesis mechanisms
ResumoWe have identified a novel nucleolar protein, Nop5p, that is essential for growth in Saccharomyces cerevisiae. Monoclonal antibodies B47 and 37C12 recognize Nop5p, which has a predicted size of 57 kDa and possesses a KKXrepeat motif at its carboxyl terminus. Truncations that removed the KKX motif were functional and localized to the nucleolus, but conferred slow growth at 37 °C. Nop5p shows significant sequence homology with yeast Sik1p/Nop56p, and putative homologues in archaebacteria, plants, and human. Depletion of Nop5p in aGAL-NOP5 strain lengthened the doubling time about 5-fold, and selectively reduced steady-state levels of 40 S ribosomal subunits and 18 S rRNA relative to levels of free 60 S subunits and 25 S rRNA. Northern blotting and primer extension analyses showed that Nop5p depletion impairs processing of 35 S pre-rRNA at the A0 and A2 cleavage sites. Nop5p is associated with the small nucleolar RNAs U3, snR13, U14, and U18. Depletion of Nop5p caused the nucleolar protein Nop1p (yeast fibrillarin) to be localized to the nucleus and cytosol. Also, 37C12 co-immunoprecipitated Nop1p. These results suggest that Nop5p functions with Nop1p in the execution of early pre-rRNA processing steps that lead to formation of 18 S rRNA. We have identified a novel nucleolar protein, Nop5p, that is essential for growth in Saccharomyces cerevisiae. Monoclonal antibodies B47 and 37C12 recognize Nop5p, which has a predicted size of 57 kDa and possesses a KKXrepeat motif at its carboxyl terminus. Truncations that removed the KKX motif were functional and localized to the nucleolus, but conferred slow growth at 37 °C. Nop5p shows significant sequence homology with yeast Sik1p/Nop56p, and putative homologues in archaebacteria, plants, and human. Depletion of Nop5p in aGAL-NOP5 strain lengthened the doubling time about 5-fold, and selectively reduced steady-state levels of 40 S ribosomal subunits and 18 S rRNA relative to levels of free 60 S subunits and 25 S rRNA. Northern blotting and primer extension analyses showed that Nop5p depletion impairs processing of 35 S pre-rRNA at the A0 and A2 cleavage sites. Nop5p is associated with the small nucleolar RNAs U3, snR13, U14, and U18. Depletion of Nop5p caused the nucleolar protein Nop1p (yeast fibrillarin) to be localized to the nucleus and cytosol. Also, 37C12 co-immunoprecipitated Nop1p. These results suggest that Nop5p functions with Nop1p in the execution of early pre-rRNA processing steps that lead to formation of 18 S rRNA. Most of the steps of ribosome biogenesis in eukaryotic cells take place in the nucleolus. In the yeast Saccharomyces cerevisiae, a single long 35 S pre-rRNA is transcribed by RNA polymerase I and processed to 18 S, 5.8 S, and 25 S rRNAs through a series of co- and post-transcriptional steps. Ribosomal proteins imported from the cytoplasm are assembled with pre-rRNAs to form the small 40 S subunit and the large 60 S subunit. The 5 S rRNA is transcribed by RNA polymerase III from a separate transcription unit and is incorporated into the large subunit along with the 5.8 S and 25 S rRNAs, while 18 S rRNA is incorporated into the small subunit. During transcription and processing of pre-rRNA, a number of nucleotides are modified, primarily by the addition of 2′-O-methyl groups or by the formation of pseudouridine residues. The processing and modification of pre-rRNAs require non-ribosomal nucleolar proteins, many of which are associated with small nucleolar RNAs (snoRNAs) 1The abbreviations used are: snoRNA, small nucleolar RNA; ETS, externally transcribed spacer; ITS, internally transcribed spacer; mAb, monoclonal antibody; snoRNP, small nucleolar ribonucleoprotein; PAGE, polyacrylamide gel electrophoresis; kb, kilobase(s); 5-FOA, 5-fluoroorotic acid; IP, immunoprecipitation; IF, immunofluorescence. in the form of small nucleolar ribonucleoprotein (snoRNP) complexes (reviewed in Refs. 1Tollervey D. Exp. Cell Res. 1996; 229: 226-232Crossref PubMed Scopus (62) Google Scholar and 2Maxwell E.S. Fournier M.J. Annu. Rev. Biochem. 1995; 64: 897-934Crossref PubMed Scopus (552) Google Scholar). The earliest processing events are those involved in the removal of the promoter proximal 5′-externally transcribed spacer (5′-ETS). Cleavage occurs at two sites within the 5′-ETS: at A0, in the middle region of the 5′-ETS; and at A1, which results in the formation of the 5′-end of the mature 18 S rRNA (reviewed in Ref. 3Venema J. Tollervey D. Yeast. 1995; 11: 1629-1650Crossref PubMed Scopus (189) Google Scholar). Formation of 18 S requires processing to form its 3′-end, which involves processing at site A2 in the first internally transcribed spacer (ITS1) followed by processing at site D, which yields the 3′-end (see Fig. 9). In yeast, many gene products are required for, or participate in, cleavage at sites A0, A1, and A2, attesting to the complex nature of this process. The yeast RNase III encoded by RNT1 is involved in endonucleolytic cleavage at the A0 site, and can function in vitro in the absence of other factors (4Abou Elela S. Igel H. Ares M. Cell. 1996; 85: 115-124Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). Genetic depletion of the snoRNAs U14, snR10, snR30, and depletion of the snoRNP proteins Nop1p, Rok1p, Rrp5p, Sof1p, and Gar1p impair cleavage at A0, A1 and A2 (5Hughes J.M. Ares Jr., M. EMBO J. 1991; 10: 4231-4239Crossref PubMed Scopus (315) Google Scholar, 6Jarmolowski A. Zagorski J. Li H.V. Fournier M.J. EMBO J. 1990; 9: 4503-4509Crossref PubMed Scopus (59) Google Scholar, 7Morrissey J.P. Tollervey D. Chromosoma. 1997; 105: 515-522Crossref PubMed Scopus (26) Google Scholar, 8Morrissey J.P. Tollervey D. Mol. Cell. Biol. 1993; 13: 2469-2477Crossref PubMed Scopus (191) Google Scholar, 9Schimmang T. Tollervey D. Kern H. Frank R. Hurt E.C. EMBO J. 1989; 8: 4015-4024Crossref PubMed Scopus (251) Google Scholar, 10Jansen R. Tollervey D. Hurt E.C. EMBO J. 1993; 12: 2549-2558Crossref PubMed Scopus (111) Google Scholar, 11Venema J. Bousquetantonelli C. Gelugne J.P. Caizergues-Ferrer M. Tollervey D. Mol. Cell. Biol. 1997; 17: 3398-3407Crossref PubMed Scopus (89) Google Scholar, 12Girard J.P. Lehtonen H. Caizergues-Ferrer M. Amalric F. Tollervey D. Lapeyre B. EMBO J. 1992; 11: 673-682Crossref PubMed Scopus (226) Google Scholar, 13Venema J. Tollervey D. EMBO J. 1996; 15: 5701-5714Crossref PubMed Scopus (132) Google Scholar, 14Tollervey D. Lehtonen H. Carmo F.M. Hurt E.C. EMBO J. 1991; 10: 573-583Crossref PubMed Scopus (285) Google Scholar). These depletion experiments give rise to a similar phenotype: accumulation of 35 S pre-rRNA and reduction of 18 S rRNA levels. However, different underlying mechanisms are responsible for the reduction in 18 S rRNA levels. For example, the C/D box snoRNAs U3 and U14 are required for processing and 2′-O-methylation, and are associated with Nop1p (15Tollervey D. Lehtonen H. Jansen R. Kern H. Hurt E.C. Cell. 1993; 72: 443-457Abstract Full Text PDF PubMed Scopus (415) Google Scholar). The H box/ACA snoRNA, snR30, is required for conversion of uridine to pseudouridine and is associated with Gar1p, which has been shown to be involved in pseudouridine formation (16Bousquet-Antonelli C. Henry Y. Gelugne J.-P. Caizergues-Ferrer M. Kiss T. EMBO J. 1997; 16: 4770-4776Crossref PubMed Scopus (122) Google Scholar, 17Ganot P. Bortolin M.L. Kiss T. Cell. 1997; 89: 799-809Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar, 18Kiss-Laszlo Z. Henry Y. Bachellerie J.-P. Caizergues-Ferrer M. Kiss T. Cell. 1996; 85: 1077-1088Abstract Full Text Full Text PDF PubMed Scopus (677) Google Scholar, 19Ni J.W. Tien A.L. Fournier M.J. Cell. 1997; 89: 565-573Abstract Full Text Full Text PDF PubMed Scopus (435) Google Scholar, 20Nicoloso M. Qu L.H. Michot B. Bachellerie J.P. J. Mol. Biol. 1996; 260: 178-195Crossref PubMed Scopus (214) Google Scholar). Nop1p is an essential and conserved nucleolar protein that is part of the U3 snRNP complex, which is required for early processing steps (9Schimmang T. Tollervey D. Kern H. Frank R. Hurt E.C. EMBO J. 1989; 8: 4015-4024Crossref PubMed Scopus (251) Google Scholar,14Tollervey D. Lehtonen H. Carmo F.M. Hurt E.C. EMBO J. 1991; 10: 573-583Crossref PubMed Scopus (285) Google Scholar, 15Tollervey D. Lehtonen H. Jansen R. Kern H. Hurt E.C. Cell. 1993; 72: 443-457Abstract Full Text PDF PubMed Scopus (415) Google Scholar, 21Saavedra C. Tung K.S. Amberg D.C. Hopper A.K. Cole C.N. Genes Dev. 1996; 10: 1608-1620Crossref PubMed Scopus (138) Google Scholar). The U3 snoRNP complex and the Nop1p homologue fibrillarin have been investigated in a number of different organisms (reviewed in Refs. 22Sollner-Webb B. Tycowski K.T. Steitz J.A. Zimmermann R.A. Dahlberg A.E. Ribosomal RNA: Structure, Evolution, Processing, and Function in Protein Synthesis. CRC Press, Boca Raton, FL1996: 469-490Google Scholar and 23Eichler D.C. Craig N. Prog. Nucleic Acid Res. Mol. Biol. 1995; 49: 197-239Crossref Scopus (181) Google Scholar). Nop1p is associated with multiple snoRNAs, indicating that it associates with more than one snoRNP complex and is not unique to the U3 snoRNP (9Schimmang T. Tollervey D. Kern H. Frank R. Hurt E.C. EMBO J. 1989; 8: 4015-4024Crossref PubMed Scopus (251) Google Scholar, 14Tollervey D. Lehtonen H. Carmo F.M. Hurt E.C. EMBO J. 1991; 10: 573-583Crossref PubMed Scopus (285) Google Scholar). This is consistent with the fact that Nop1p is multifunctional and participates in different aspects of ribosome biogenesis, including pre-rRNA modification, processing, and ribosome subunit assembly (15Tollervey D. Lehtonen H. Jansen R. Kern H. Hurt E.C. Cell. 1993; 72: 443-457Abstract Full Text PDF PubMed Scopus (415) Google Scholar). On the other hand, the essential nucleolar protein Mpp10p is required for processing at sites A0, A1, and A2, and is predominantly associated with U3, indicating that it is a specific U3 snoRNP component (24Dunbar D.A. Wormsley S. Agentis T.M. Baserga S.J. Mol. Cell. Biol. 1997; 17: 5803-5812Crossref PubMed Scopus (99) Google Scholar). The only other known protein in yeast that is specific for the U3 snoRNP is Sof1p, which plays an essential role in pre-18 S rRNA processing as well (10Jansen R. Tollervey D. Hurt E.C. EMBO J. 1993; 12: 2549-2558Crossref PubMed Scopus (111) Google Scholar). Thus, although the U3 snoRNP is one of the best understood snoRNPs, knowledge of its composition and function remains incomplete. To better understand the function of snoRNPs involved in early pre-rRNA processing steps and 18 S rRNA synthesis, it is necessary to identify and functionally characterize novel snoRNP components, especially those that interact with Nop1p and/or U3. Monoclonal antibodies generated against nucleolar antigens have been useful in this regard, and have allowed us to identify novel nucleolar proteins in yeast. The studies reported herein center on a gene we termNOP5. Our studies show that Nop5p is essential for cell growth, is required for synthesis of the small 40 S subunit, and is involved in processing of pre-18 S rRNA. Genetic depletion of Nop5p impairs cleavage at sites A0 and A2. Nop5p has been conserved during evolution. We present evidence that Nop5p is associated with certain snoRNAs, including U3, and with Nop1p, suggesting that Nop5p functions together with Nop1p in snoRNP complexes required for 18 S rRNA synthesis. TheS. cerevisiae strains and plasmids used in this study are described in Table I. Growth of yeast, yeast transformation, sporulation, microdissection, tetrad analysis, and plasmid shuffling, were done according to standard procedures as described previously (25,26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). For genetic depletion of Nop5p, YPW48 was grown in liquid medium to mid-log phase (OD600 = 0.25–0.5), washed with sterile water, and transferred to fresh medium. Rich media (YPD or YPGal) or synthetic media (SD or SGal) plus supplements were prepared according to standard methods (25). Escherichia coli DH5α was used for plasmid preparation (27Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Vols. 1–3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar).Table IStrains and plasmids used in this studyStrain or PlasmidDescriptionStrains W303–1aMAT a,ade2–1, can1–100, his3–11, 15, leu2–3, 112, trp1–1, ura3–1 (from C. A. Styles and G. R. Fink) W303–1αMATα, ade2–1, can1–100, his3–11, 15, leu2–3, 112, trp1–1, ura3–1 (from C. A. Styles and G. R. Fink) YSB25Micromanipulated zygote from W303–1a× W303–1α YPW38YSB25 pPW73 (GAL-NOP5-HA tag, URA3, CEN6) YPW42YSB25 nop5::TRP1 YPW43YSB25 nop5::TRP1 YPW45YSB25 nop5::TRP1 pPW80 (NOP5, URA3, CEN6) (meiotic segregant from YPW42 carrying pPW80) YPW48YSB25 nop5::TRP1 pPW83 (GAL-NOP5, LEU2, CEN6) YPW51YSB25nop5::TRP1 pPW92 (nop5Δ1, LEU2, CEN6) YPW52YSB25 nop5::TRP1 pPW88 (nop5Δ2, LEU2, CEN6) YPW53YSB25nop5::TRP1 pPW91 (NOP5, LEU2, CEN6)Plasmids pPW69PCR product carrying NOP5(primers 4 and 5) cloned between BamHI and XhoI sites of pRS314 (TRP1, CEN6) (37Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). pPW73PCR product carrying HA-epitope tagged NOP5 (primers 1 and 2) cloned between BamHI and ClaI sites of pRD53 (GAL1/10 promoter, URA3) (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). pPW80PCR product carrying NOP5 (primers 4 and 5) cloned betweenBamHI and XhoI sites of pRS316 (URA3, CEN6) (37Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). pPW81PCR product carrying NOP5(primers 1 and 3) cloned between BamHI and XhoI sites of pRD53 (GAL1/10 promoter, URA3) (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). pPW83SacI-XhoI fragment carryingGAL-NOP5 cloned between same sites of pRS315 (LEU2, CEN6) (37Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). pPW84EcoRI-NsiI fragment of pJJ280 (32Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Crossref PubMed Scopus (334) Google Scholar) carrying TRP1 cloned intoEcoRI and PstI sites in NOP5 in pPW69. pPW85BamHI-XhoI fragment carryingnop5::TRP1 from pPW84 cloned between same sites in pBluescript SK+. pPW92A derivative of pPW69 that carriesnop5Δ1 (removes the COOH-terminal 38 amino acids) was constructed using inverse PCR (primers 6 and 7), and subcloned betweenBamHI and XhoI sites in pRS315 (LEU2, CEN6) (37Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). pPW88A derivative of pPW69 that carriesnop5Δ2 (removes the COOH-terminal 61 amino acids) was constructed using inverse PCR (primers 6 and 8), and subcloned betweenBamHI and XhoI sites in pRS315 (LEU2, CEN6) (37Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). pPW91NOP5, LEU2, CEN6. ABamHI and XhoI fragment from pPW69 carryingNOP5 was cloned into the same sites in pRS315 (LEU2, CEN6) (37Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). Open table in a new tab NOP5 was cloned by polymerse chain reaction with Pfu polymerase (Stratagene) using strategies described in Table I. The sequences of oligonucleotides used for clonings are as follows: 1, CCCGGATCCAACCTCCTCATACAATG; 2, CCCATCGATCAGTTAGCGTAGTCTGGAACGTCGTAT; 3, CCCCTCGAGTACCTAAAACTATGTAAAC; 4, CCCGGATCCTTTTTTACAGTAACTGGAG; 5, CCGCCTCGAGCACTAATTTACAGATTATG; 6, CCCCCTAGGATGCATTTTACATTTTAAT; 7, CCCCCTAGGTTAAGCTTTTTTAGAATCCTTGG; 8, CCCCCTAGGTTATTCTTCCTCTTCATCATCAG. Cloning steps were carried out according to standard methods (25, 27Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Vols. 1–3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Cloned polymerase chain reaction products were sequenced in their entirety by the DNA Sequencing core facility at the University of Florida. Monoclonal antibody (mAb) 37C12 was generated against a nucleolus-enriched fraction (28Dove J.E. Brockenbrough J.S. Aris J.P. Berrios M. Nuclear Structure and Function. 53. Academic Press, New York1998: 33-46Google Scholar) as described previously (29Chen S. Brockenbrough J.S. Dove J.E. Aris J.P. J. Biol. Chem. 1997; 272: 10839-10846Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar), in conjunction with the Hybridoma Laboratory at the University of Florida. MAb B47 was generated in a screen for anti-nuclear antibodies that was described previously (30Aris J.P. Blobel G. J. Cell Biol. 1988; 107: 17-31Crossref PubMed Scopus (199) Google Scholar). Ascites fluid production was done using standard methods by the Hybridoma Laboratory. MAbs A66 and D77 recognize Nop1p (30Aris J.P. Blobel G. J. Cell Biol. 1988; 107: 17-31Crossref PubMed Scopus (199) Google Scholar), C21 recognizes Nsr1p, 2T. Buber and J. P. Aris, unpublished results. and 12CA5 recognizes the HA-1 epitope. Indirect immunofluorescence localization was done as described previously (31de Beus E. Brockenbrough J.S. Hong B. Aris J.P. J. Cell Biol. 1994; 127: 1799-1813Crossref PubMed Scopus (76) Google Scholar), using YSB25 grown at 30 °C in YPD for routine experiments. Ascites fluids were diluted 1/250. Affinity purified polyclonal antibody 3 (APpAb3) against Nop2p was diluted 1/40 (31de Beus E. Brockenbrough J.S. Hong B. Aris J.P. J. Cell Biol. 1994; 127: 1799-1813Crossref PubMed Scopus (76) Google Scholar). Secondary Cy3-conjugated antimouse antibody or Cy2-conjugated antirabbit antibody (Jackson ImmunoResearch Laboratories) were diluted 1/200. A yeast cDNA expression library in λgt11 prepared from mid-log yeast (CLONTECH) was screened using standard techniques (25, 27Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Vols. 1–3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar, 29Chen S. Brockenbrough J.S. Dove J.E. Aris J.P. J. Biol. Chem. 1997; 272: 10839-10846Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). MAb 37C12 ascites fluid was diluted 1/1000 and incubated with filters overnight at 4 °C. Positive plaques were purified, and the insert DNA analyzed by direct polymerase chain reaction amplification of λ-phage suspensions using primers flanking the EcoRI site. Eight positives fell into two classes containing overlapping inserts based on insert size and DNA sequence analysis. E. coli strain Y1089 was lysogenized with a λ-isolate from one class, and protein expression was induced and samples prepared for SDS-PAGE as described (28Dove J.E. Brockenbrough J.S. Aris J.P. Berrios M. Nuclear Structure and Function. 53. Academic Press, New York1998: 33-46Google Scholar). To replace NOP5 with TRP1, plasmid pPW84 was constructed such that ∼90% of NOP5 between theNsiI and EcoRI sites was replaced with aPstI-EcoRI fragment from pJJ280 (32Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Crossref PubMed Scopus (334) Google Scholar). A 1.6-kbBamHI-XhoI nop5::TRP1disruption fragment was subcloned into pBluescript SK+ to form pPW85, and was used to transform YSB25. Trp+ transformants were selected and subjected to Southern analysis. YPW42 and YPW43 are two independent nop5::TRP1 disruption isolates. YPW42 and YPW43 were transformed with plasmid pPW80 (NOP5), and were subjected to tetrad analysis. Thirteen Trp+ and Ura+ spores were isolated and patched onto 5-fluoroorotic acid (5-FOA) containing medium and found to be inviable, indicating they require pPW80 to survive. Southern analysis confirmed the presence of the nop5::TRP1disruption and complementing plasmid (data not shown). One of these, YPW45, was used to create YPW48 by exchanging pPW83 for pPW80. Proteins were separated on 10.5% SDS-polyacrylamide gels, and RNAs were separated on 1.0–1.2% glyoxal agarose RNA gels as described previously (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). Total cellular protein or RNA were extracted according to standard procedures previously described (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). Immunoblots were probed with mAbs B47 or D77 diluted 1/10,000 and detected by ECL according to the manufacturer (Amersham). Equal loading of protein samples was determined by India ink staining of the immunoblot. RNAs were transferred to Hybond nylon membrane according to the manufacturer (Amersham), and probed with 32P-labeled oligonucleotides or probes against NOP5 or ACT1 mRNA, followed by autoradiography. Oligonucleotides complementary to regions of rRNAs are as follows: 9, GCACAGAAATCTCTCACCGT; 10, CATCCAATGAAAAGGCCAGC; 11, GAAGAAGCAACAAGCAG; 12, AGCCATTCGCAGTTTCACTG; 13, TACTAAGGCAATCCGGTTGG. Southern blotting was done as described (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). The Molecular Analyst (Bio-Rad) software package was used for quantitative comparison of relative band intensities on films. Ribosomal subunits, monosomes and polysomes from W303–1a and YPW48 grown in YPD at 30 °C were analyzed according to Hong et al. (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). Labeling with [methyl-3H]methionine or [3H]uracil was done with cells collected after 0, 4, 8, and 12 h of growth in dextrose-containing media as described previously (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). Primer extension was done using as template equivalent amounts of total RNA extracted from W303–1a or YPW48 grown in YPGal and transferred to YPD for 0, 2, 4, 12, or 24 h. The oligonucleotides used are: 12 (see above); 14, TCCAGTTACGAAAATTCTTG; 15, AGCGACTCTCTCCACCG. In this method, the primer that is extended is not radioactively labeled, but rather, [35S]dATP is incorporated into the extension products during a labeling step prior to the extension step (26Hong B. Brockenbrough J.S. Wu P. Aris J.P. Mol. Cell. Biol. 1997; 17: 378-388Crossref PubMed Scopus (131) Google Scholar). Yeast were labeled with 0.25 mCi of [35S]methionine per 5 OD600 units of cells as described (33Kolodziej P.A. Young R.A. Methods Enzymol. 1991; 194: 508-519Crossref PubMed Scopus (436) Google Scholar), and used to prepare a crude nuclear-enriched pellet fraction. A nuclear-enriched fraction was used for these studies because previous experiments indicated that monoclonal antibodies against nuclear antigens (i.e. mAb A66 against Nop1p and mAb 3F2 against Nab2p) immunoprecipitated the predicted protein band with nuclear extracts, but not with whole cell extracts prepared under comparable conditions. 3V. Lamian and J. P. Aris, unpublished results. Labeled yeast cells were washed, pretreated, and digested as described (28Dove J.E. Brockenbrough J.S. Aris J.P. Berrios M. Nuclear Structure and Function. 53. Academic Press, New York1998: 33-46Google Scholar) for 30 min with 10 μg of Zymolyase 100T and 10 μl of Glusulase per 5 OD600 units. Spheroplasts were washed with 1.1m sorbitol and lysed with 20% Ficoll 400, 20 mm KPi, pH 6.5, essentially as described (28Dove J.E. Brockenbrough J.S. Aris J.P. Berrios M. Nuclear Structure and Function. 53. Academic Press, New York1998: 33-46Google Scholar). The lysate was subjected to low speed centrifugation in an SW50.1 rotor for 6 min at 10,000 rpm at 2 °C, after which the supernatant was loaded onto a precooled 1-ml cushion consisting of 30% Ficoll 400, 20 mm KPi, pH 6.5. Centrifugation in an SW50.1 rotor for 20 min at 22,000 rpm (58,165 × g) at 2 °C yielded a pellet enriched in nuclei. The load zone and cushion volumes were completely removed, and the pellet was quick frozen and stored at −80 °C. The frozen nuclear pellet was thawed in immunoprecipitation (IP) buffer (50 mm Tris-HCl, pH 8, 150 mm NaCl, 2 mm EDTA) containing 0.1% (w/v) Nonidet P-40, and bath sonicated 3 × 20 s, with intermittent chilling on ice. Preabsorbtion was done with rabbit anti-mouse antibody (Fc-specific, Jackson ImmunoResearch) bound to protein A-Sepharose beads (Pharmacia), followed by two pre-clearing centrifugations of 5 min each in a microcentrifuge. Monoclonal antibodies bound to rabbit anti-mouse antibody bound to protein A-Sepharose beads were incubated with yeast proteins for 3 h at 4 °C with gentle mixing. The immunoprecipitates were washed 5 × 2 min at ∼25 °C with IP buffer plus Nonidet P-40, followed by one wash in IP buffer alone. Immunoprecipitates were boiled for 5 min in sample buffer, and analyzed by SDS-PAGE. All buffers after the digestion step contained protease inhibitor mixtures (28Dove J.E. Brockenbrough J.S. Aris J.P. Berrios M. Nuclear Structure and Function. 53. Academic Press, New York1998: 33-46Google Scholar). For re-immunoprecipitation, two immunoprecipitations were pooled, solubilized with 2% SDS, 20 mm dithiothreitol, 25 mm Tris-HCl, pH 6.5, for 10 min at 85 °C, and treated with 40 mm N-ethylmaleimide for 1 h on ice. After dilution with 9 volumes of IP buffer plus 1% Nonidet P-40 and protease inhibitor mixture, the sample was microcentrifuged at top speed for 5 min. The supernatant was used for a second round of IP conducted essentially the same as the first round. For RNA immunoprecipitations, nuclei isolated from BJ2168 using 2 Ficoll step gradients (28Dove J.E. Brockenbrough J.S. Aris J.P. Berrios M. Nuclear Structure and Function. 53. Academic Press, New York1998: 33-46Google Scholar) were diluted in 20 mmKPi, pH 6.5, 1 mm MgCl2 (PM buffer), centrifuged, and the pellet resuspended in RNA IP buffer: 50 mm Tris-HCl, pH 8, 150 mm NaCl, 100 mm KCl, 5 mm MgCl2, 0.1% Nonidet P-40, protease inhibitor mixtures, 8 mm vanadyl ribonucleoside complex (Life Technologies, Inc.). To dissolve vanadyl ribonucleoside complex, the buffer was heated to ∼50 °C and tip sonicated for 10 min. The nuclear pellet was dissolved in RNA IP buffer, and tip sonicated 3 × 20 s, with intermittent chilling on ice. The lysate was precleared with rabbit antimouse protein A-Sepharose that had been washed with RNA IP buffer, and immunoprecipitates were prepared as described above using RNA IP buffer. The immunoprecipitate was treated for 10 min at 37 °C with 25 μg of proteinase K in 5 mm Tris-HCl, pH 8, 2 mm EDTA, 0.2% SDS containing 10 μg of glycogen, followed by extraction with phenol, phenol:CHCl3, and CHCl3, and precipitation and washing with ethanol. RNAs were 3′-end labeled with RNA ligase (New England Biolabs) using a standard method (34England T.E. Uhlenbeck O.C. Nature. 1978; 275: 560-561Crossref PubMed Scopus (424) Google Scholar), purified, and electrophoresed on a 6% denaturing polyacrylamide gel. The "total" labeling sample mixture consisted of a portion of the supernatant fraction from the control IP treated, extracted, precipitated, and labeled as described above. Monoclonal antibodies raised against nucleolar antigens were evaluated by immunofluorescence (IF) staining. Monoclonal antibody 37C12 produced a bright and specific intranuclear IF pattern that substantially overlapped the distribution of the nucleolar protein Nop2p (Fig. 1, A-D). The mAb B47 also gave an IF staining pattern that coincided with the distribution of Nop2p (Fig. 1, E-H). The IF pattern in both cases was offset from the distribution of chromatin in many cells, depending on the orientation of the nucleus, which resulted in the appearance of a crescent shape that is characteristic of the nucleolus in yeast (Fig. 1, arrows). Thus, 37C12 and B47 recognized nucleolar antigens in yeast. To identify the antigen(s) recognized by 37C12, immunoprecipitations were done with 35S-labeled nuclear extracts. 37C12 immunoprecipitated two proteins of approximately 67 and 38 kDa, which were not observed in the absence of primary antibody (Fig. 2). 37C12 immunoprecipitates washed with IP buffer containing 0.5 m NaCl, 2 m urea, or 0.2% SDS, 1% Nonidet P-40 also contained the 67-kDa protein, but with lower relative amounts of the 38-kDa band (data not shown). This suggested that 37C12 recognized a 67-kDa protein in the nuclear fraction. Considering that Nop1p is known to migrate on SDS gels at 38 kDa (30Aris J.P. Blobel G. J. Cell Biol. 1988; 107: 17-31Crossref PubMed Scopus (199) Google Scholar), we tested the possibility that this protein was Nop1p. The immunoprecipitate obtained with 37C12 was solubilized with SDS, diluted with non-ionic detergent, and re-immunoprecipitated with mAb A66, which is specific for Nop1p (30Aris J.P. Blobel G. J. Cell Biol. 1988; 107: 17-31Crossref PubMed Scopus (199) Google Scholar). A66 quantitatively immunoprecipitated the 38-kDa protein, proving that it is Nop1p (Fig. 2). Monoclonal 37C12 did not immunoblot yeast nuclear protein extracts, despite the use of protocols to renature proteins prior to transfer or after transfer. 4S. Chen and J. P. Aris, unpublished results. On the other hand, B47 was not very effective in protein immunoprecipitation experiments, but produced a specific signal on immunoblots (see Figs. 5 B and 14 B).Figure 14Nop5p depletion affects the localization of the nucleolar protein Nop1p. A, YPW48 was shifted to glucose-containing medium and grown for 0, 4, 8, or 12 h, after which cells were collected and analyzed by indirect immunofluorescence with the mAbs B47, 37C12, A66 (anti-Nop1p), or C21 (anti-Nsr1p). A secondary antibody Cy3 conjugate was used. Bar, 10 μm.B, YPW48 was grown as described, cells were harvested at the same time points, and crude nuclear and cytoplasmic fractions were prepared and analyzed by Western blotting.
Referência(s)