Role of a Carboxylesterase in Herbicide Bioactivation in Arabidopsis thaliana
2007; Elsevier BV; Volume: 282; Issue: 29 Linguagem: Inglês
10.1074/jbc.m701985200
ISSN1083-351X
AutoresMarkus Gershater, Ian Cummins, Robert Edwards,
Tópico(s)Cholinesterase and Neurodegenerative Diseases
ResumoArabidopsis thaliana contains multiple carboxyesterases (AtCXEs) with activities toward xenobiotics, including herbicide esters that are activated to their phytotoxic acids upon hydrolysis. On the basis of their susceptibility to inhibition by organophosphates, these AtCXEs are all serine hydrolases. Using a trifunctional probe bearing a fluorophosphonate together with biotin and rhodamine to facilitate detection and recovery, four dominant serine hydrolases were identified in the proteome of Arabidopsis. Using a combination of protein purification, capture with the trifunctional probe and proteomics, one of these hydrolases, AtCXE12, was shown to be the major carboxyesterase responsible for hydrolyzing the pro-herbicide methyl-2,4-dichlorophenoxyacetate (2,4-D-methyl) to the phytotoxic acid 2,4-dichlorophenoxyacetic acid. Recombinant expression of the other identified hydrolases showed that AtCXE12 was unique in hydrolyzing 2,4-D-methyl. To determine the importance of AtCXE12 in herbicide metabolism and efficacy, the respective tDNA knock-out (atcxe12) plants were characterized and shown to lack expression of AtCXE12 and have greatly reduced levels of 2,4-D-methyl-hydrolyzing activity. Young atcxe12 seedlings were less sensitive than wild type plants to 2,4-D-methyl, confirming a role for the enzyme in herbicide bioactivation in Arabidopsis. Arabidopsis thaliana contains multiple carboxyesterases (AtCXEs) with activities toward xenobiotics, including herbicide esters that are activated to their phytotoxic acids upon hydrolysis. On the basis of their susceptibility to inhibition by organophosphates, these AtCXEs are all serine hydrolases. Using a trifunctional probe bearing a fluorophosphonate together with biotin and rhodamine to facilitate detection and recovery, four dominant serine hydrolases were identified in the proteome of Arabidopsis. Using a combination of protein purification, capture with the trifunctional probe and proteomics, one of these hydrolases, AtCXE12, was shown to be the major carboxyesterase responsible for hydrolyzing the pro-herbicide methyl-2,4-dichlorophenoxyacetate (2,4-D-methyl) to the phytotoxic acid 2,4-dichlorophenoxyacetic acid. Recombinant expression of the other identified hydrolases showed that AtCXE12 was unique in hydrolyzing 2,4-D-methyl. To determine the importance of AtCXE12 in herbicide metabolism and efficacy, the respective tDNA knock-out (atcxe12) plants were characterized and shown to lack expression of AtCXE12 and have greatly reduced levels of 2,4-D-methyl-hydrolyzing activity. Young atcxe12 seedlings were less sensitive than wild type plants to 2,4-D-methyl, confirming a role for the enzyme in herbicide bioactivation in Arabidopsis. A diverse range of synthetic compounds enter plants as pollutants or crop protection agents and undergo four phases of metabolism; namely, the introduction of reactive functional groups (phase 1), bioconjugation with polar natural products (phase 2), conjugate transport into the vacuole (phase 3), and finally phase 4 mineralization or incorporation into macromolecules (1Sandermann H. Trends Plant Sci. 2004; 9: 1360-1385Abstract Full Text Full Text PDF Scopus (42) Google Scholar). We have termed this xenobiotic detoxifying system the xenome and are currently functionally characterizing its components in a range of plants (2Edwards R. Brazier M. Dixon D.P. Cummins I. Adv. Bot. Res. 2005; 42: 1-32Crossref Scopus (46) Google Scholar). An important group of phase 1 enzymes that have received very little attention in plants are the xenobiotic-hydrolyzing carboxylesterases (CXEs). 3The abbreviations used are: CXE, carboxylesterase; 2,4-D, 2,4-dichlorophenoxyacetic acid; pNA, p-nitrophenyl acetate; αNA, α-naphthyl acetate; 2,4-D-methyl, methyl-2,4-dichlorophenoxyacetate; TriFP, trifunctional fluorophosphonate; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; MS, mass spectrometry. 3The abbreviations used are: CXE, carboxylesterase; 2,4-D, 2,4-dichlorophenoxyacetic acid; pNA, p-nitrophenyl acetate; αNA, α-naphthyl acetate; 2,4-D-methyl, methyl-2,4-dichlorophenoxyacetate; TriFP, trifunctional fluorophosphonate; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; MS, mass spectrometry. These plant enzymes detoxify persistent pollutants (3Krell H.W. Sandermann H. Eur. J. Biochem. 1984; 143: 57-62Crossref PubMed Scopus (31) Google Scholar) and insecticides (4Preiss U. Wallnofer P.R. Engelhardt G. Pestic. Sci. 1988; 23: 13-24Crossref Scopus (13) Google Scholar), as well as hydrolyzing pro-herbicide esters to their bioactive free acids (5Cummins I. Edwards R. Plant J. 2004; 39: 894-904Crossref PubMed Scopus (49) Google Scholar, 6Haslam R. Raveton M. Cole D.J. Pallet K.E. Coleman J.O.D. Pestic. Biochem. Physiol. 2001; 71: 178-189Crossref Scopus (21) Google Scholar). In the latter case, many major classes of herbicides are applied as esters to facilitate penetration into the leaf. Ester hydrolysis within the leaf is then required to bioactivate the herbicide, and the rate of cleavage is an important determinant of selective action in crops and weeds (7Nandula V.K. Messersmith C.G. Pestic. Biochem. Physiol. 2000; 68: 148-155Crossref Scopus (24) Google Scholar, 8Ruiz-Santaella J.P. Heredia A. De Prado R. Planta. 2006; 223: 191-199Crossref PubMed Scopus (38) Google Scholar). Using a classification system based on the sensitivity of hydrolases to inhibition by organophosphate insecticides, herbicide-active CXEs in wheat and competing grass weeds are of the B-type (9Cummins I. Burnet M. Edwards R. Physiol. Plant. 2001; 113: 477-485Crossref Scopus (42) Google Scholar, 6Haslam R. Raveton M. Cole D.J. Pallet K.E. Coleman J.O.D. Pestic. Biochem. Physiol. 2001; 71: 178-189Crossref Scopus (21) Google Scholar). B-class CXEs use a catalytic serine, with this residue undergoing irreversible covalent modification by organophosphates on binding. The modified catalytic serine residue is part of a conserved Ser-His-Asp catalytic triad that is found in a large number of hydrolytic enzymes in both prokaryotes and eukaryotes, most classically in the α/β-hydrolase-fold proteins (10Oakeshott J.G. Claudianos C. Russell R.J. Robin G.C. BioEssays. 1999; 21: 1031-1042Crossref PubMed Scopus (92) Google Scholar, 11Heikinheimo P. Golman A. Jeffries C. Ollis D.L. Structure. 1999; 7 (-R146): R141Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar). Arabidopsis contains several superfamilies of α/β-hydrolase-fold proteins, the best characterized being the serine proteases (12Tripathi L.P. Sowdhamini R. BMC Genomics. 2006; 7 (, Art No 200)Crossref PubMed Scopus (108) Google Scholar). Interestingly, this well characterized active site chemistry has been recruited for multiple functions in plant metabolism, notably the hydrolysis of amide and carboxylic ester bonds, dehydrations, transacylations, and lyase functions (13Fraser C.M. Rider L.W. Chapple C. Plant Phys. 2005; 138: 1136-1148Crossref PubMed Scopus (89) Google Scholar).With respect to the hydrolases active toward xenobiotic carboxylic esters (see Fig. 1A), some progress has recently been made in identifying xenobiotic-hydrolyzing serine hydrolases in tobacco (14Baudouin E. Charpenteau M. Roby D. Marco Y. Ranjeva R. Ranty B. Eur. J. Biochem. 1997; 248: 700-706Crossref PubMed Scopus (52) Google Scholar), black-grass (Alopecurus myosuroides L.) (5Cummins I. Edwards R. Plant J. 2004; 39: 894-904Crossref PubMed Scopus (49) Google Scholar), and rice (15Waöspi U. Misteli B. Hasslacher M. Jandrositz A. Kohlwein S.D. Schwab H. Dudler R. Eur. J. Biochem. 1998; 254: 32-37Crossref PubMed Scopus (35) Google Scholar). These studies have demonstrated that the xenobiotic-hydrolyzing enzymes described are from distinct protein families. Thus, whereas the CXEs from rice and tobacco are both classic α/β-hydrolases (14Baudouin E. Charpenteau M. Roby D. Marco Y. Ranjeva R. Ranty B. Eur. J. Biochem. 1997; 248: 700-706Crossref PubMed Scopus (52) Google Scholar, 16Brick D.J. Brumlik M.J. Buckley J.T. Cao J.X. Davies P.C. Misra S. Tranbarger T.J. Upton C. FEBS Lett. 1995; 377: 475-480Crossref PubMed Scopus (91) Google Scholar), the black-grass esterase was homologous to the unrelated microbial GDS hydrolase superfamily (16Brick D.J. Brumlik M.J. Buckley J.T. Cao J.X. Davies P.C. Misra S. Tranbarger T.J. Upton C. FEBS Lett. 1995; 377: 475-480Crossref PubMed Scopus (91) Google Scholar). This example of convergent functional evolution is in contrast to all the other enzymes of xenobiotic metabolism in plants. Thus, the phase 1 cytochrome P450 mixed-function oxidases (17Schuler M.A. Crit. Revs. Plant Sci. 1996; 15: 235-284Crossref Scopus (277) Google Scholar), the phase 2 glutathione transferases (18Dixon D.P. Lapthorn A. Edwards R. Genome Biol. 2002; 3 (.10): 3004.1-3004Crossref Google Scholar) and glucosyltransferases (19Bowles D. Isayenkova J. Lim E.K. Poppenberger B. Curr. Opin. Plant Biol. 2005; 8: 254-263Crossref PubMed Scopus (357) Google Scholar) and the phase 3 ATP-binding cassette transporters (20Rea P.A. Li Z.-S. Lu Y.-P. Drozdowicz Y.M. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998; 49: 727-760Crossref PubMed Scopus (264) Google Scholar), are each derived from divergent superfamilies.The presence of multiple esterase gene families in the plant xenome is further complicated by the lack of correlation between activities of individual enzymes toward "model" xenobiotic esters and "real" pollutants and pesticides. Thus, the major esterase in wheat with activity toward the general colorimetric substrates p-nitrophenyl acetate (pNA, Fig. 1A) and α-naphthyl acetate (αNA) had negligible activities toward herbicides used in this crop (9Cummins I. Burnet M. Edwards R. Physiol. Plant. 2001; 113: 477-485Crossref Scopus (42) Google Scholar). Conversely, a 40-kDa esterase from the weed black-grass, which hydrolyzed aryloxyphenoxypropionate esters such as clodinafop-propargyl (Fig. 1A) to the respective herbicidal acids had little activity toward substrates used in colorimetric assays (5Cummins I. Edwards R. Plant J. 2004; 39: 894-904Crossref PubMed Scopus (49) Google Scholar).Based on these fragmentary data derived from multiple species, there was a need to develop new tools to functionally characterize the large numbers of CXEs in plants. Based on approaches applied to functional proteomics in animal cells (21Adam G.C. Sorenson E.J. Cravatt B.F. Mol. Cell. Proteomics. 2002; 1: 828-835Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar), we now report on the use of chemical probes to identify CXEs involved in xenobiotic detoxification in Arabidopsis. The trifunctional probe used had a fluorophosphonate group that covalently modified reactive serine residues in the active sites of expressed AtCXEs, a biotin tag to facilitate recovery of labeled proteins and a fluorophore (rhodamine) for detection and quantification (see Fig. 2A). Using a combination of classic enzyme purification and this "chemotyping" probe, we have isolated the CXE in Arabidopsis plants responsible for the selective hydrolysis and hence bioactivation of the pro-herbicide methyl 2,4-dichlorophenoxyacetate (2,4-D-methyl) to the phytotoxic 2,4-D acid (Fig. 1A).FIGURE 2Use of TriFP to identify serine hydrolases in Arabidopsis. A, structure of TriFP. When acted on by a catalytic serine, the fluorine atom is displaced leaving the probe bearing the biotin and rhodamine tags covalently bound to the hydrolase. B, resolution of polypeptides from total protein extracts of Arabidopsis plants and cell cultures covalently labeled with the TriFP. The biotinylated proteins were recovered using streptavidin affinity chromatography, and after SDS-PAGE the TriFP fluorescently labeled polypeptides directly visualized. Dominant polypeptides were then excised and identified by MALDI-TOF MS-based proteomics as 1, prolyl-oligopeptidase (At1g76140); 2, a GDS hydrolase of unknown function (At1g76140); 3, a CXE of unknown function from the AtCXE family (Marshal et al. 26Marshall S.D.G. Putterill J.J. P Lummer K.M. Newcomb R.D. J. Mol. Evol. 2003; 57: 487-500Crossref PubMed Scopus (80) Google Scholar) termed AtCXE12 (At3g48690); and 4, a lysophospholipase-like CXE (At5g20060).View Large Image Figure ViewerDownload Hi-res image Download (PPT)EXPERIMENTAL PROCEDURESArabidopsis Plants and Cultures—Arabidopsis (Columbia) suspension cell cultures and root cultures were maintained and harvested as previously detailed (22Loutre C. Dixon D.P. Brazier M. Slater M. Cole D.J. Edwards R. Plant J. 2003; 34: 485-493Crossref PubMed Scopus (76) Google Scholar). Seed from the SAIL tDNA insertion mutant SAIL_445_G03 was obtained from the Nottingham Arabidopsis Stock Centre (Nottingham, UK). Arabidopsis knock-out and wild-type (Columbia) plants were maintained as described previously (23Brazier-Hicks M. Edwards R. Plant J. 2005; 42: 556-566Crossref PubMed Scopus (58) Google Scholar). For the toxicity studies with young plants (28 days), treatments of 2,4-D-methyl or 2,4-D were spray-applied in 0.1% (v/v) Tween 20 at 0, 2, 5, or 10 mg liter-1 each at a rate of 360 ml m-2, equivalent to field applications of 36, 18, and 7.2 g of active ingredient Ha-1, respectively. Plants were then assessed for injury at timed intervals, with all treatments carried out in triplicate.Analysis of tDNA Knockouts—Homozygous plants were selected using the primers: left product (LP), ACCAAGATCCACTAAAATTCATC; right product (RP), GATGTTTGCTCCTGCACTGTC; and SAIL left border (LB), TTCATAACCAATCTCGATACAC. The site of tDNA insertion was then confirmed by sequencing the PCR products obtained using the LB and RP, and LB and LP primer pairs, respectively.Synthesis and Use of a Trifunctional Chemotyping Probe—The generation of the trifunctional fluorophosphonate (TriFP) probe utilized the modular synthetic strategy described for the synthesis of the corresponding sulfonate ester probes (21Adam G.C. Sorenson E.J. Cravatt B.F. Mol. Cell. Proteomics. 2002; 1: 828-835Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). First, the N-hydroxysuccinimide ester of 10-(fluoroethoxyphosphinyl)decanoic acid was prepared from 10-(ethoxyhydroxyphosphinyl)decanoic acid (24Liu Y.S. Patricelli M.P. Cravatt B.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 14694-14699Crossref PubMed Scopus (815) Google Scholar). Separately, α-(9-fluorenylmethoxycarbonyl (Fmoc))-lysine conjugated with biotin through its carboxyl function and with tetramethylrhodamine through its ɛ-amine function was prepared (21Adam G.C. Sorenson E.J. Cravatt B.F. Mol. Cell. Proteomics. 2002; 1: 828-835Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). The Fmoc protecting group was removed by treating (14 mg and 5 μmol) of the bifunctional linker with 5 ml of 4 n HCl in dioxane for 60 min at room temperature. After drying under a stream of N2, the deprotected intermediate was dissolved in methanol (3 ml) containing NaHCO3 (5 mg) and reacted with freshly prepared 10-((fluoroethoxyphosphinyl)-N-hydroxysuccinyl)decanamide (1.9 mg and 5 μmol). After reacting under argon for 4 h at room temperature, solvent was evaporated under vacuum and the TriFP purified by preparative reversed phase high-performance liquid chromatography C18 column using an increasing linear gradient of water: MeCN (95:5, v/v) to MeCN. The final product (0.2 μmol) was analyzed by MALDI-TOF MS m/z = 1134.38 (C58H82FN8O10PS requires 1134.38 Da).TriFP (5 μm) was incubated with protein (1 ml) in 0.1 m Tris-HCl buffer (pH 7.2) for 60 min at 37 °C. Labeled proteins were then either analyzed directly by SDS-PAGE, or subjected to affinity chromatography by mixing with streptavidin-Sepharose (40 μl of 50% slurry) in the presence of SDS (0.2% w/v) on an end-over-end mixer (60 min). The streptavidin-Sepharose was pelleted by centrifugation and washed twice with 1 ml of SDS (0.2% w/v), followed by 2 × 1 ml distilled water. The beads were then heated to 90 °C in 20 μl of SDS-PAGE loading buffer to solubilize the biotinylated polypeptides.CXE Assay—Esterase assays with pNA were colorimetrically determined, whereas the hydrolysis of the pesticide esters was monitored by high-performance liquid chromatography (9Cummins I. Burnet M. Edwards R. Physiol. Plant. 2001; 113: 477-485Crossref Scopus (42) Google Scholar). All activities were determined in duplicate and corrected for non-enzymic hydrolysis by using boiled protein controls. CXE activity toward αNA was visualized following isoelectric focusing of protein preparations after an inhibitory pre-treatment ± 0.1 mm paraoxon (9Cummins I. Burnet M. Edwards R. Physiol. Plant. 2001; 113: 477-485Crossref Scopus (42) Google Scholar).CXE Purification and Proteomic Analysis—AtCXEs were purified from Arabidopsis suspension cultures using the protocol previously described, using sequential chromatography of active fractions on DEAE, butyl-Sepharose, and Mono Q fast-protein liquid chromatography (5Cummins I. Edwards R. Plant J. 2004; 39: 894-904Crossref PubMed Scopus (49) Google Scholar). CXE activity was monitored in fractions using pNA and 2,4-D-methyl as substrates. In the final stages, the TriFP was used to label active CXEs for concentration by streptavidin affinity chromatography prior to resolution of the polypeptides present by SDS-PAGE using 12.5% gels (5Cummins I. Edwards R. Plant J. 2004; 39: 894-904Crossref PubMed Scopus (49) Google Scholar). Proteins labeled with the TriFP fluorescence tag were visualized using a Fuji FLA-3000 Imager, and the respective bands were excised and digested with trypsin prior to analysis on a Voyager DE-STR MALDI-TOF mass spectrometer (Applied Biosystems, Warrington, UK) as described (22Loutre C. Dixon D.P. Brazier M. Slater M. Cole D.J. Edwards R. Plant J. 2003; 34: 485-493Crossref PubMed Scopus (76) Google Scholar). The resulting peptide mass ions were used to screen a non-redundant Arabidopsis protein data base using Mascot (Matrix Science).Cloning of AtCXEs—The AtCXEs identified by proteomics were cloned using selective forward (F) and reverse (R) primer combinations. For AtCXE5 (At1g49660), F = 5′-TCATATGGAATCTGAAATCGCCTCC-3′ and R = 5′-TCTCGAGACCAATAATAAACTCGAC-3′; for AtCXE12 (At3g48690); F = 5′-TCAACTAACCATGGATTCCGAGATCGCCG-3′ and R = 5′-CGCCTCGAGGTTCCCTCCCTTAATAAACCC-3′; for AtCXE20 (At5g62180), F = 5′-TCATATGTCCGAACCAAGTCCAATC-3′ and R = 5′-TCTCGAGCAGAACAGAGAATATGAA-3′. cDNA was prepared from total RNA from the aerial tissues of flowering Arabidopsis plants and used as the template for PCR, with the amplification products cloned first into pGEMT and then pET24 for the transformation of Escherichia coli strain ROSETTA DE3 (pLysS, Novagen) as described (25Kordic S. Cummins I. Edwards R. Arch. Biochem. Biophys. 2002; 399: 232-238Crossref PubMed Scopus (36) Google Scholar). Expression and purification of the recombinant AtCXEs was carried out essentially as previously described (25Kordic S. Cummins I. Edwards R. Arch. Biochem. Biophys. 2002; 399: 232-238Crossref PubMed Scopus (36) Google Scholar), except cultures were cooled and maintained at 10 °C when induced with isopropyl 1-thio-β-d-galactopyranoside.Accession Numbers—Sequence data from this article can be found in the GenBank™/EMBL data libraries under the following accession numbers: AtCXE5, At1g49660; AtCXE12, At3g48690; and AtCXE20, At5g62180.RESULTSCXE Activities in Arabidopsis—To evaluate the usefulness of Arabidopsis as a model plant to study the hydrolytic bioactivation of herbicides, extracts from the foliage, roots, and suspension cultures were assayed against 2,4-D-methyl and the aryloxyphenoxypropionate herbicide clodinafop-propargyl (Fig. 1A). The model CXE substrate pNA was also included (Fig. 1A) for reference. With the herbicide substrates, all of the tissues tested had a different range of hydrolytic activities (Fig. 1C). 2,4-D-Methyl was always the preferred substrate, particularly in suspension cultures, with lower activities being determined with clodinafop-propargyl, a herbicide used in the selective control of grass weeds in cereal crops (5Cummins I. Edwards R. Plant J. 2004; 39: 894-904Crossref PubMed Scopus (49) Google Scholar). These results demonstrated that Arabidopsis plants and cultures were able to catalyze the hydrolytic bioactivation of herbicide esters, particularly 2,4-D-methyl, a compound designed to be used in the control of dicotyledonous weeds. To study the diversity of CXEs present, crude extracts from Arabidopsis foliage, roots and suspension cultures were resolved by isoelectric focusing and visualized by incubating with α-naphthyl acetate, with and without a prior treatment with the organophosphate inhibitor paraoxon (Fig. 1B). In total, 10 CXEs could be visualized by this method, all of which were sensitive to inhibition by paraoxon, demonstrating that these were all serine hydrolases (Fig. 1B). Similarly, the hydrolytic activities toward the pro-herbicides were also sensitive to inhibition by the organophosphate. The differences in esterase expression between the tissues were relatively subtle. For example, a CXE with a basic pI was present at higher levels in root cultures and foliage than in suspension culture, whereas the converse was true for an enzyme with a pI of pH 5.1. Based on these results it was concluded that Arabidopsis cell cultures were an excellent source of CXEs with activity toward 2,4-D-methyl and that the respective enzymes were serine hydrolases.Identifying Serine Hydrolases in Arabidopsis—The zymogen analysis showing the presence of multiple CXEs sensitive to inhibition by organophosphates suggested that this labeling chemistry could be used to identify the respective proteins using a directed proteomics approach. The method adopted involved the preparation of a customized trifunctional probe bearing a fluorophosphonate labeling group, a biotin recovery tag, and a rhodamine fluorescent reporter function (Fig. 2A). The TriFP probe was synthesized and purified, and its identity was confirmed by MALDI-TOF MS prior to use. Total protein extracts from Arabidopsis plants and cell cultures were incubated with the TriFP, and the resulting labeled proteins recovered using streptavidin affinity chromatography. The tagged proteins were then resolved by SDS-PAGE, and the dominant fluorescently labeled polypeptides excised and subjected to MALDI-TOF MS-based proteomics (Fig. 2B). Four polypeptides were identified as the major expressed serine hydrolases, namely prolyl-oligopeptidase (At1g76140), and three serine hydrolases of unknown function: a 46-kDa putative GDS-type hydrolase, a 36-kDa putative CXE previously termed AtCXE12 (At3g48690, Marshall, et al. 26Marshall S.D.G. Putterill J.J. P Lummer K.M. Newcomb R.D. J. Mol. Evol. 2003; 57: 487-500Crossref PubMed Scopus (80) Google Scholar), and a 27-kDa lysophospholipase-like CXE (At5g20060). The screen was useful for defining the relative abundance of expressed serine hydrolases in Arabidopsis and confirmed the diversity of proteins bearing this catalytic mechanism. The utility of the TriFP in identifying serine hydrolases in crude plant extracts suggested that it would also be a useful tool in helping purify and identify low abundance AtCXEs associated with specific hydrolytic activities. Thus, a chemotyping probe with fluorophosphonate functionality could be employed in the final stages of enzyme enrichment to unambiguously identify serine hydrolases present and affinity-concentrate them for MS-based proteomics.Purification of AtCXEs—The CXEs responsible for the hydrolysis of 2,4-D-methyl in Arabidopsis suspension cultures were purified from a crude protein extract using a combination of ammonium sulfate precipitation and separation based on anion exchange and hydrophobic interaction chromatographies (Table 1). First, proteins precipitated between 40 and 80% ammonium sulfate saturation were resolved using a DEAE-Sepharose column. CXE activity toward 2,4-D-methyl eluted in two pools, with the majority recovered in peak DEAE 2 (supplemental Fig. S1A). The DEAE 2 peak was applied onto a butyl Sepharose column, where it was resolved into peaks butyl 1 and 2 (supplemental Fig. S1B). These fractions were stored separately, with the major pool (butyl 2) applied onto a Mono Q fast-protein liquid chromatography column, where the activity eluted in a single sharp peak (supplemental Fig. S1C). Overall, the 2,4-D-methyl-hydrolyzing activity was purified 305-fold with 3.3% recovery using this protocol (Table 1). In contrast, when the final purified preparation was assayed with clodinafop-propargyl, the enrichment was only 30-fold in 0.3% yield, demonstrating that the CXE activity isolated was selectively enriched for the hydrolysis of 2,4-D-methyl rather than other classes of herbicide.TABLE 1Summary of the purification of the major CXE activity toward 2,4-D-methyl from Arabidopsis suspension culturesFractionTotal proteinSpecific activityPurificationTotal activityTotal recoverymgpicokatals/mg-foldnanokatals%Total20502901.059210040-80% (NH4)2SO46649403.3626106DEAE6660702140167.7Butyl 20.9148930169.544.37.5Mono Q10.2287900304.519.333.3 Open table in a new tab The polypeptides present at each stage of the purification were monitored by SDS-PAGE (Fig. 3A). When analyzed for total protein content it was difficult to identify a single polypeptide that was being enriched by sequential purification, with the final preparation containing multiple polypeptides. This was to be expected based on the low selectivity of the chromatography steps employed and is a common feature of purifying low abundance enzymes of secondary metabolism. However, by labeling proteins from each stage of the purification with the TriFP and then using the biotin recognition tag, the identification of the active serine hydrolases in each fraction was immediately clarified, with a single 36.6-kDa polypeptide identified in the final preparation. Use was then made of the biotin affinity tag to purify the TriFP-labeled protein from the final enriched fraction using streptavidin affinity chromatography, purifying and concentrating the polypeptide for proteomic analysis in a single step (Fig. 3B). Tryptic digests of the purified protein were analyzed by MALDI-TOF MS and analysis of the peptide fragments identified AtCXE12 as the active hydrolase (Table 2 and supplemental Fig. S2).FIGURE 3Isolation of the 2,4-D-methyl-hydrolyzing AtCXE using the TriFP. A, purification of the major CXE-hydrolyzing 2,4-D-methyl from Arabidopsis suspension cultures as monitored by SDS-PAGE with protein staining (lanes 1-5) and by visualization of biotinylated peptides using Western blotting, probing with streptavidin-linked phosphodiesterase after labeling each fraction with the TriFP (lanes 6-10). Lane 1, Mr markers; lanes 2 and 7, crude 40-80% (NH4)2SO4 protein precipitate; lane 3 and 8, peak DEAE; lanes 4 and 9, peak Butyl 2; lanes 5 and 10, Mono Q peak; lane 6, streptavidin blot of the crude 40-80% (NH4)2SO4 protein precipitate without prelabeling with the TriFP demonstrating the presence of endogenously biotinylated proteins in the extract. B, the CXEs present in the final Mono Q fraction (lanes 5 and 10 in A) were treated with the TriFP, and the biotinylated proteins were then recovered by streptavidin affinity chromatography and analyzed by SDS-PAGE (lane 2) and Western-blotted with streptavidin (lane 3), prior to proteomic analysis of the major 36.6-kDa polypeptide. Lane 1, Mr markers. The major stained polypeptide running at the bottom of the gel is streptavidin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)TABLE 2CXEs identified through the purification of CXE activity toward 2,4-D-methyl from Arabidopsis suspension culturesFractionCXEAGI gene codePredicted massObserved massMALDI statisticsSequence coverageMascot scorep valuekDa%Mono Q1AtCXE12At3g4869035.836.633740.0018Mono Q2AtCXE12At3g4869035.836.630520.4Mono Q3AtCXE20At5g6218036.440.129630.026Mono Q4AtCXE5At1g4966035.438.145710.004 Open table in a new tab Identification, Cloning, and Expression of AtCXEs Involved in Xenobiotic Hydrolysis in Arabidopsis Cultures—Although AtCXE12 was the major 2,4-D-methyl-hydrolyzing CXE expressed in Arabidopsis, it was also apparent from the purification runs that there were additional CXEs with this activity present. Thus the 2,4-D-methyl-hydrolyzing activity could be resolved into distinctly eluting pools both at the stage of DEAE-anion exchange chromatography (supplemental Fig. S1A) and on butyl-Sepharose (supplemental Fig. S1B). Attempts to isolate CXEs from the minor DEAE 1 pool proved unsuccessful due to the instability of the respective enzymes. However, when the butyl 1 fraction was applied to a Mono Q column, a broad peak of CXE activity was recovered (supplemental Fig. S3). Using the TriFP, the peak was subsequently shown to contain three distinct serine hydrolases that were analyzed by MALDI-based proteomics. All the proteins were identified as members of the AtCXE family (26Marshall S.D.G. Putterill J.J. P Lummer K.M. Newcomb R.D. J. Mol. Evol. 2003; 57: 487-500Crossref PubMed Scopus (80) Google Scholar), namely AtCXE5 (At1g49660) with lesser amounts of AtCXE20 (At5g62180) and AtCXE12 (At3g48690) also being determined (Table 2). The identification of this "secondary" minor source of AtCXE12 was made with a lower degree of confidence than was the case with the other two CXEs, but the polypeptide did have the same molecular mass as the AtCXE12 protein d
Referência(s)