APC Inactivation Associates With Abnormal Mitosis Completion and Concomitant BUB1B/MAD2L1 Up-Regulation
2007; Elsevier BV; Volume: 132; Issue: 7 Linguagem: Inglês
10.1053/j.gastro.2007.03.027
ISSN1528-0012
AutoresMiguel Abal, Antònia Obrador‐Hevia, Klaus–Peter Janssen, L. Casadomé, Mireia Menéndez, Sabrina Carpentier, Emmanuel Barillot, Mechthild Wagner, Wilhelm Ansorge, Gabriela Möslein, Hafida Fsihi, Vladimir Bezrookove, Jaume Reventós, Daniel Louvard, Gabriel Capellá, Sylvie Robine,
Tópico(s)Genomics and Chromatin Dynamics
ResumoBackground & Aims: Chromosomal instability, a hallmark of most colorectal cancers, has been related to altered chromosome segregation and the consequent deficit in genetic integrity. A role for the tumor suppressor gene APC has been proposed in colorectal cancer that leads to compromised chromosome segregation even though the molecular mechanism is not yet understood. Here, we tackled the genetic basis for the contribution of APC to chromosomal instability in familial adenomatous polyposis and sporadic colorectal cancer. Methods: We have used video-microscopy of primary cultures and molecular genetic methods to address these issues in human samples and in genetically defined mouse models that either recapitulate the familial adenomatous polyposis syndrome (Apc1638N), or develop tumors in the absence of APC mutations (pvillin-KRASV12G). Results: Mutations in APC were associated with an increased incidence in cell cycle defects during the completion of cytokinesis. Transcriptome analysis performed on mouse models indicated a significant up-regulation of genes that regulate accurate mitosis. Notably, we identified up-regulated expression of BUB1B and MAD2L1, 2 genes that are involved in the mitotic checkpoint, but have so far not been implicated in chromosomal instability induced by APC loss of function. In vitro modulation of APC expression suggested a causal association for this upregulation, which was consistently found in sporadic and familial adenomatous polyposis lesions, as an early event in colorectal tumorigenesis. Conclusions: In addition to the known function of APC during correct spindle assembly and positioning, we propose a concomitant involvement of APC in the surveillance mechanism of accurate mitosis. Background & Aims: Chromosomal instability, a hallmark of most colorectal cancers, has been related to altered chromosome segregation and the consequent deficit in genetic integrity. A role for the tumor suppressor gene APC has been proposed in colorectal cancer that leads to compromised chromosome segregation even though the molecular mechanism is not yet understood. Here, we tackled the genetic basis for the contribution of APC to chromosomal instability in familial adenomatous polyposis and sporadic colorectal cancer. Methods: We have used video-microscopy of primary cultures and molecular genetic methods to address these issues in human samples and in genetically defined mouse models that either recapitulate the familial adenomatous polyposis syndrome (Apc1638N), or develop tumors in the absence of APC mutations (pvillin-KRASV12G). Results: Mutations in APC were associated with an increased incidence in cell cycle defects during the completion of cytokinesis. Transcriptome analysis performed on mouse models indicated a significant up-regulation of genes that regulate accurate mitosis. Notably, we identified up-regulated expression of BUB1B and MAD2L1, 2 genes that are involved in the mitotic checkpoint, but have so far not been implicated in chromosomal instability induced by APC loss of function. In vitro modulation of APC expression suggested a causal association for this upregulation, which was consistently found in sporadic and familial adenomatous polyposis lesions, as an early event in colorectal tumorigenesis. Conclusions: In addition to the known function of APC during correct spindle assembly and positioning, we propose a concomitant involvement of APC in the surveillance mechanism of accurate mitosis. A large percentage of cancers are characterized by chromosomal instability (CIN) and aneuploidy. This can be linked to a laxity in high-fidelity chromosome segregation and the consequent inability to maintain genetic integrity. CIN is the hallmark of most colorectal cancers. Both qualitative and quantitative variations in chromosome numbers are observed in early colonic adenomas. This is consistent with CIN playing a potential role in tumor progression.1Rajagopalan H. Nowak M.A. Vogelstein B. Lengauer C. The significance of unstable chromosomes in colorectal cancer.Nat Rev Cancer. 2003; 3: 695-701Crossref PubMed Scopus (409) Google Scholar Moreover, the CIN phenotype seems to be dominant, as it can be conferred on a chromosomally stable, diploid cell when it is fused with a CIN cell.2Lengauer C. Kinzler K.W. Vogelstein B. Genetic instability in colorectal cancers.Nature. 1997; 386: 623-627Crossref PubMed Scopus (1646) Google Scholar A role for the tumor suppressor gene adenomatous polyposis coli (APC) has been proposed in colorectal CIN. This role was suggested after observing mouse embryonic stem cells carrying APC mutated alleles, which lead to truncated APC proteins lacking carboxyl-terminal sequences. Extensive chromosome and spindle aberrations provided genetic evidence for a possible role played by APC in chromosome segregation through kinetochore-microtubule attachment.3Fodde R. Kuipers J. Rosenberg C. Smits R. Kielman M. Gaspar C. van Es J.H. Breukel C. Wiegant J. Giles R.H. Clevers H. Mutations in the APC tumour suppressor gene cause chromosomal instability.Nat Cell Biol. 2001; 3: 433-438Crossref PubMed Scopus (591) Google Scholar, 4Kaplan K.B. Burds A.A. Swedlow J.R. Bekir S.S. Sorger P.K. Nathke I.S. A role for the Adenomatous Polyposis Coli protein in chromosome segregation.Nat Cell Biol. 2001; 3: 429-432Crossref PubMed Scopus (471) Google Scholar In addition to its prominence in the Wnt signaling pathway as a regulator of β-catenin transcriptional activity,5Gaspar C. Fodde R. APC dosage effects in tumorigenesis and stem cell differentiation.Int J Dev Biol. 2004; 48: 377-386Crossref PubMed Scopus (102) Google Scholar APC has been described to bind to and stabilize microtubules, to localize to clusters at the ends of microtubules, and to be an important regulator of the cytoskeletal function. By modulating microtubule plus-end attachments during mitosis, mutant APC dominantly compromises astral and mid-zone microtubules in mitotic tumor cells with CIN.6Green R.A. Kaplan K.B. Chromosome instability in colorectal tumor cells is associated with defects in microtubule plus-end attachments caused by a dominant mutation in APC.J Cell Biol. 2003; 163: 949-961Crossref PubMed Scopus (183) Google Scholar More precisely, APC mutants interfere with the function of EB1, a plus-end microtubule-binding protein that interacts with APC and is required for normal microtubule dynamics.7Green R.A. Wollman R. Kaplan K.B. APC and EB1 function together in mitosis to regulate spindle dynamics and chromosome alignment.Mol Biol Cell. 2005; 16: 4609-4622Crossref PubMed Scopus (188) Google Scholar Despite these insights regarding the contribution of APC to genomic instability in colorectal cancer, CIN is still not completely understood at the molecular level. A recent report presented evidence for the genetic basis of chromosomal instability, categorizing 3 classes of genes mutated in colorectal cancers with chromosomal instability. This study, based on the instability phenotypes identified in the Saccharomyces cerevisiae and Drosophila melanogaster model systems, included genes involved in double-strand break repair, genes that control chromosome segregation, and genes essential for proper chromosome disjunction.8Wang Z. Cummins J.M. Shen D. Cahill D.P. Jallepalli P.V. Wang T.L. Parsons D.W. Traverso G. Awad M. Silliman N. Ptak J. Szabo S. Willson J.K. Markowitz S.D. Goldberg M.L. Karess R. Kinzler K.W. Vogelstein B. Velculescu V.E. Lengauer C. Three classes of genes mutated in colorectal cancers with chromosomal instability.Cancer Res. 2004; 64: 2998-3001Crossref PubMed Scopus (161) Google Scholar In the present investigation, we tackled the genetic basis for the contribution of APC to CIN in both genetically defined mouse models and in human colorectal samples. We were able to relate mitotic defaults associated with nonfunctional APC to an altered expression of the genes involved in the pathways that regulate accurate mitosis completion. In addition to the genes that participated in proper spindle function and chromosome segregation, we also identified altered genes that were related to the mitotic checkpoint, among them, BUB1B and MAD2L1. FAP patient specimens for video-microscopy analysis were obtained from the Department of Surgery at the Heinrich Heine University in Germany. In addition, a panel of 60 fresh-frozen FAP adenomas from 6 different FAP patients (10 adenomas each) and their corresponding normal mucosa were obtained from the IDIBELL-Institut Catala d’Oncologia in Barcelona, Spain. All patients harbored 100 or more adenomas and carried a pathogenic germ-line mutation in the APC gene. Finally, a panel of 10 fresh-frozen paired normal-mucosa/adenoma/carcinoma series from colorectal cancer patients was also analyzed. The protocol was previously approved by the institutional review boards, and informed consent was obtained from all of the patients involved in the study. All experiments on mice were performed in accordance with institutional and national guidelines and regulations. The Apc1638N mouse lineage of the inbred C57Bl/6J background9Fodde R. Edelmann W. Yang K. van Leeuwen C. Carlson C. Renault B. Breukel C. Alt E. Lipkin M. Khan P.M. et al.A targeted chain-termination mutation in the mouse Apc gene results in multiple intestinal tumors.Proc Natl Acad Sci U S A. 1994; 91: 8969-8973Crossref PubMed Scopus (466) Google Scholar was bred with the transgenic model pVillin-KRASV12G of the genetic background B6D2 (C57Bl/6J × DBA/2).10Janssen K.P. el-Marjou F. Pinto D. Sastre X. Rouillard D. Fouquet C. Soussi T. Louvard D. Robine S. Targeted expression of oncogenic K-ras in intestinal epithelium causes spontaneous tumorigenesis in mice.Gastroenterology. 2002; 123: 492-504Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar To control for genetic background effects, littermates were always employed as controls. Mice were maintained under a 12-hour light–dark cycle and fed with a standard diet and water ad libitum. Polyps were isolated after the colectomy of a FAP patient and histology-matched adenomas from Apc1638N, pVillin-KRASV12G, and compound Apc+/1638N/pVillin-KRASV12G mice were used. Human and animal samples were collected in DMEM medium supplemented with 20% fetal bovine serum and penicillin and streptomycin. Polyps were cut into pieces and processed for enzymatic digestion in culture medium with 0.5 fetal calf serum supplemented with insulin 0.25 μg/mL and collagenase 0.2 mg/mL, for 1 hour at 37°C in rotation. Tissue masses were washed twice, resuspended in complete medium with 20% fetal calf serum supplemented with insulin 0.25 μg/mL, seeded onto collagen-treated coverslips, and incubated for 48 hours at 37°C and in 5% CO2. Analysis of cell cycle progression was accomplished by collecting phase-contrast images every 10 minutes on a Leica (Leica Microsystems Wetzlar GmbH, Wetzlar, Germany) DMIRBE microscope controlled by Metamorph software (West Chester, PA). The microscope was equipped with an open chamber equilibrated in 5% CO2 and maintained at 37°C, and images were taken with a 40×/0.70 PL Fluotar (Leica Microsystems Wetzlar GmbH) objective and a MicroMax (Princeton Instruments, Trenton, NJ) CCD camera. Primary culture cells were fixed with 3% paraformaldehyde at room temperature for 20 minutes, treated with 50 mmol/L NH4Cl in PBS for a further 20 minutes, and permeabilized with 0.1% Triton X-100 for 5 minutes. Cells were incubated with primary antibodies for β-catenin (1:200 Clone 14, BD Transduction Laboratories, Franklin Lakes, NJ), Villin (1:500 monoclonal antibody ID2C311Dudouet B. Robine S. Huet C. Sahuquillo-Merino C. Blair L. Coudrier E. Louvard D. Changes in villin synthesis and subcellular distribution during intestinal differentiation of HT29-18 clones.J Cell Biol. 1987; 105: 359-369Crossref PubMed Scopus (99) Google Scholar), cytokeratin (1:200 Clone LP34; Dako Corp, Carpenteria, CA), and γ-tubulin (1:200 ab11319, Abcam, Cambridge, UK), and with Cy3- or Alexa488-conjugated secondary antibodies (Jackson Immunoresearch, West Grove, PA), diluted in PBS containing 3% bovine serum albumin for 60 minutes at room temperature. The whole-cell volume was scanned using a piezo device mounted at the base of a Leica DMRXA microscope; 63×/1.32 or 100×/1.4–0.7 PL-APO objectives and a MicroMax CCD camera (Princeton Instruments) were used for acquisition; images were analyzed with Metamorph software (Universal Imaging, West Chester, PA) and processed using Adobe Photoshop (San Jose, CA). Immunohistochemistry was performed on 5-μm OCT sections of human adenomas and carcinomas from FAP patients and from sporadic colorectal cancer patients. Samples treated with 3% formaldehyde and 3% hydrogen peroxide were evaluated for BUB1B and MAD2L1 expression with the anti-BUB1B rabbit polyclonal antibody (1:50; Abgent, San Diego, CA) and the anti-MAD2L1 rabbit polyclonal antibody (1:400; kindly provided by E.D. Salmon12Waters J.C. Chen R.H. Murray A.W. Salmon E.D. Localization of Mad2 to kinetochores depends on microtubule attachment, not tension.J Cell Biol. 1998; 141: 1181-1191Crossref PubMed Scopus (396) Google Scholar). After washing in 0.1% PBS Tween 20, the samples were incubated for 30 minutes with the antirabbit secondary antibody EnVision HRP system of Dako. Omission of the antibody served as a negative control. We obtained a 15,247 mouse cDNA clone set from the National Institute of Aging (http://lgsun.grc.nia.nih.gov/index.html), and we used it to generate custom cDNA microarrays. The establishment, testing, and analysis of these custom microarrays are described in detail elsewhere (manuscript in preparation). Briefly, polymerase chain reaction (PCR) fragments were spotted onto homemade amino-silanized glass or epoxy glass slides (Quantifoil, Jena, Germany). Spotting was performed on an OmniGrid Spotter (GeneMachines, San Carlos, CA). For direct labeling without amplification, we reverse transcribed the total RNA from normal/tumor samples into cDNA with oligo (dT)12–18 primers using Superscript II (Invitrogen, Carlsbad, CA). For most of the labeling, total RNA was amplified first. Therefore, RNA was converted into cDNA with a T7-oligo (dT)24 primer using Superscript II, followed by second-strand synthesis using DNA polymerase I and T4 DNA ligase, as well as RNase H. cDNA was purified by phenol/chloroform extraction and amplified using the Ambion MEGAScript Kit. Cleaning of the antisense RNA was accomplished using the Qiagen RNeasy Kit. Quantity was checked by spectrophotometrical measurement, and quality was analyzed by microelectrophoresis (Bioanalyzer 2100, Agilent Technologies, Waldbronn, Germany). Five micrograms of aRNA were directly labeled using random primers (Invitrogen). Purified Cy3- and Cy5-labeled probes were combined, mixed with 10 μg poly (dA) (Amersham, Buckinghamshire, United Kingdom) and 3 μg mouse Cot-1 DNA (Invitrogen) and evaporated in a vacuum concentrator (5301, Eppendorf, Hamburg, Germany). Microarrays were scanned using a GenePix 4000B Scanner (Axon Instruments, Union City, CA). All arrays were scanned with a resolution of 10 μm. For image analysis we used the ChipSkipper microarray analysis software (http://www.ansorge-group.embl.de/services/chipskip.htm). To identify genes that were differentially expressed, we used the detection procedure called significance analysis of microarrays,13Tusher V.G. Tibshirani R. Chu G. Significance analysis of microarrays applied to the ionizing radiation response.Proc Natl Acad Sci U S A. 2001; 98: 5116-5121Crossref PubMed Scopus (9774) Google Scholar as implemented in the R package siggenes.14Huber W. Gentleman R. Matchprobes: a bioconductor package for the sequence-matching of microarray probe elements.Bioinformatics. 2004; 20: 1651-1652Crossref PubMed Scopus (33) Google Scholar We used the following parameters for significance analysis of microarrays: the vector of values for the threshold Delta: i/5 for i = 1 … 10 and 100 permutations. We retained the list of significant differentially expressed genes for a false discovery rate equal to 0.001. SW480 cells were transiently transfected with 50 ng of phRL-TK as an internal control for transfection efficiency and 3 μg of the expression plasmid. Three different plasmids were transfected using the LipofectAMINE PLUS method (Invitrogen), according to the manufacturer’s instructions: pCMV–APC, containing full-length APC; pCMV–APC1309Δ, which encodes a C-terminal truncated APC mutant as negative control; and pCDNA 3.1 vector (Invitrogen), used as a transfection control. Experiments were performed on 4 independent days, and 11 replicas were obtained. Alternatively, 293 human embryonic kidney cells were transfected overnight with the following siRNAs (50–75 nM final concentration) using Lipofectamine™ 2000 protocol (Invitrogen): 2 validated siRNA against human APC (siAPC1 ID 42812, and siAPC2, ID 122391, both from Ambion, Austin, TX) and a negative control siRNA (ID 4626, Ambion). Forty-eight hours after transfection, RNA was extracted and target mRNA levels were measured by quantitative real-time PCR. Experiments were performed on 3 independent days, and 3 replicas were obtained. Total RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. One microgram of RNA was reverse-transcribed into cDNA using pdN6 primers and the MMLV reverse transcriptase (Invitrogen). Subsequent real-time PCR reactions were performed in the LightCycler 2.0 System (Roche, Indianapolis, IN) using the SYBR Green detection methodology. Primer sets were designed to specifically amplify cDNA by using oligos complementary to different exons of the gene: MAD2L1 forward, 5′ GGTCCTGGAAAGATGGCAG 3′ and reverse, 5′ ATCACTGAACGGATTTCATCC 3′; BUB1B forward 5′ AGGATCTGCCCGCTTCCC 3′ and reverse, 5′ GTCGTCTGATAGGTTACTGG 3′, Stathmin forward, 5′ GAACGTTTGCGAGAGAAGGATAA 3′ and reverse, 5′ GTCAGCTTCAGTCTCGTCAGCA 3′. β-2-Microglobulin and c-myc were used as controls. Threshold cycle data were analyzed using the following formula: ratio =((Etarget)ΔCPtarget (control−sample)) / ((Eref)ΔCPr ef (control−sample))15Pfaffl M.W. A new mathematical model for relative quantification in real-time RT-PCR.Nucleic Acids Res. 2001; 29: e45Crossref PubMed Scopus (25584) Google Scholar to quantify the level of gene expression changes in adenomas and carcinomas relative to their corresponding normal mucosa. The gene expression levels were log2 ratios. The log2 ratios were applied to a t-test and a Wilcoxon test to evaluate their significance. To evaluate the differences between APC1309Δ and APC WT, with respect to pCDNA 3.1, we fitted a linear regression model adjusted by the effect of day. Significance was assessed by using the estimated parameters and standard error from the model. Box plots were used to visualize and interpret the observed effects with respect to the basal category represented by pCDNA 3.1. A significance level of 0.05 was set for the P values. Alternatively, expression levels after siRNA transfection for APC are expressed as log ratio with respect to the negative control siRNA. First, we sought to characterize whether eventual abnormalities during mitosis progression were associated with inactivated APC in human and mouse digestive tumors. For this, we prepared primary short-term cultures from polyps isolated after the colectomy of an FAP patient and analyzed them by video-microscopy. FAP is 1 of the hereditary factors accounting for about 1% of all colorectal cancers, and the genetic basis for FAP lies in the germ-line (inherited) mutation of APC. The epithelial origin of the primary cultured cells was confirmed by labeling with the intestinal epithelial-specific marker villin (Figure 1A, left panel). The mutated status of APC was elicited by the inability to induce β-catenin degradation, as detected by prominent nuclear accumulation of β-catenin (Figure 1A, right panel). Two days after seeding, the cell cycle progression was analyzed by phase-contrast video-microscopy for up to 24 hours. Evidence of cell cycle defaults in FAP-epithelial primary cultures was observed during the completion of cytokinesis (Figure 1B). Approximately 20% of the cells that progressed through mitosis during the video recording were able to enter mitosis and to separate sister chromatids, but they failed to finally complete cell segregation and ended up as polynucleated cells (Figure 1B). Correspondingly, a quantification of nuclei per cell in fixed cells yielded essentially the same number of binucleated cells. We have tried a variety of different culture conditions but we have not succeeded to obtain primary cultures of normal human colonocytes, so to further confirm whether mitosis defaults were associated with APC loss of function, we turned to a mouse model that carried a targeted loss-of-function mutation at the endogenous Apc gene. The mouse line Apc1638N has an autosomal dominant predisposition toward development of spontaneous colonic and intestinal tumors.9Fodde R. Edelmann W. Yang K. van Leeuwen C. Carlson C. Renault B. Breukel C. Alt E. Lipkin M. Khan P.M. et al.A targeted chain-termination mutation in the mouse Apc gene results in multiple intestinal tumors.Proc Natl Acad Sci U S A. 1994; 91: 8969-8973Crossref PubMed Scopus (466) Google Scholar These animals progressively develop intestinal tumors in a manner that is similar to that observed in patients with FAP. Likewise, abnormalities during the mitosis completion of primary epithelial cells derived from these lesions were observed. Epithelial cells typically presented abnormal multiple nuclei and supernumerary centrosomes (Figure 2A), a phenotype that could have been the result of an eventual incomplete cytokinesis and the fusion of presumptive daughter cells, as previously shown in the FAP films (see Figure 1B). Consistent with the mitotic defects observed in the FAP primary cultures, around 20% of the mitoses in the APC1638N cells recapitulated the errors in cell segregation completion and the refusion of presumptive daughter cells observed in the human cells (Figure 2B). Correspondingly, a quantification of nuclei per cell in fixed cells yielded essentially the same number of binucleated cells (Figure 2B). To exclude the possibility that the observed mitotic defaults in the digestive cancer cells could be due to the preparation of the primary cultures, we set up primary cultures from normal intestinal epithelial cells generated from wild-type littermates. The percentage of abnormal mitoses in normal epithelial primary culture cells was indeed only half as high as observed in the APC1638N cells, as judged from both video-microscopy and immunofluorescence (Figure 2B) analysis. Furthermore, primary tumor cultures were derived from transgenic pVillin-KRASV12G mice, which have been reported to be diploid and do not display genetic instability.10Janssen K.P. el-Marjou F. Pinto D. Sastre X. Rouillard D. Fouquet C. Soussi T. Louvard D. Robine S. Targeted expression of oncogenic K-ras in intestinal epithelium causes spontaneous tumorigenesis in mice.Gastroenterology. 2002; 123: 492-504Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar The pVillin-KRASV12G mice express oncogenic human KRAS in the intestinal epithelium and develop spontaneous digestive adenocarcinomas in the presence of functional Apc.10Janssen K.P. el-Marjou F. Pinto D. Sastre X. Rouillard D. Fouquet C. Soussi T. Louvard D. Robine S. Targeted expression of oncogenic K-ras in intestinal epithelium causes spontaneous tumorigenesis in mice.Gastroenterology. 2002; 123: 492-504Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar The tumors from KRAS-induced tumors did not show elevated numbers of aberrant mitoses or binucleated cells, when compared to the wild-type littermates (Figure 2B). Thus, in primary cultures derived from digestive murine tumors with nonmutated, functional Apc, we could not observe mitotic aberrations above the levels found in wild-type primary cells. We finally evaluated the contribution of nonfunctional Apc in a compound animal model, the Apc+/1638N/pVillin-KRASV12G mice, that carried both the loss-of-function mutation at the endogenous Apc gene and the transgene encoding for the activated form of the human KRAS oncogene, and develop adenomas and adenocarcinomas in the gastrointestinal tract.16Janssen K.P. Alberici P. Fsihi H. Gaspar C. Breukel C. Franken P. Rosty C. Abal M. El Marjou F. Smits R. Louvard D. Fodde R. Robine S. APC and oncogenic KRAS are synergistic in enhancing Wnt signaling in intestinal tumor formation and progression.Gastroenterology. 2006; 131: 1096-1109Abstract Full Text Full Text PDF PubMed Scopus (235) Google Scholar Video-microscopy, performed on primary cultures from the compound Apc+/1638N/pVillin-KRASV12G mice, showed similar mitotic defaults and similar percentages of incomplete mitoses to those found in the FAP patient and the APC1638N animals (20%; Figure 2B). Similar results were also found when we compared the percentages of polynucleated cells (27%; Figure 2B). No difference in the time of mitosis completion between wild-type and APC-deficient cultures was observed. All of these data indicated a specific involvement for the inactivation of APC, but not oncogenic KRAS, in the increased incidence of compromised mitosis completion. When using a test for given proportions based on the chi-squared distribution, we analyzed the incidence of abnormalities during mitosis for those samples harboring mutant APC (FAP patient, Apc1638N, Apc+/1638N/pVillin-KRASV12G) and compared them to those with functional APC (wild-type, pVillin-KRASV12G), significant statistical differences were found (P value <.0006, video-microscopy; P value <.00001, immunofluorescence). To further explore the molecular basis of the observed abnormalities during mitosis in primary cells with mutated APC, we conducted a series of gene expression profiling experiments. Lesions from single transgenic pVillin-KRASV12G animals, which are diploid, did not present signs of genetic instability,10Janssen K.P. el-Marjou F. Pinto D. Sastre X. Rouillard D. Fouquet C. Soussi T. Louvard D. Robine S. Targeted expression of oncogenic K-ras in intestinal epithelium causes spontaneous tumorigenesis in mice.Gastroenterology. 2002; 123: 492-504Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar and were found to have no obvious defects in mitosis. They were compared to age-, sex-, and histology-matched tumors dissected from the compound mutant Apc+/1638N/pVillin-KRASV12G littermates. The analysis was carried out on custom-generated arrays containing a 15k mouse gene set (described in detail: Janssen & Wagner et al, in preparation). Briefly, to extract the biologic information and remove experimental biases, microarrays were normalized; the differential expression of genes was assessed as described in the Materials and Methods section; and finally, we carried out our analysis using gene ontology17Ashburner M. Ball C.A. Blake J.A. Botstein D. Butler H. Cherry J.M. Davis A.P. Dolinski K. Dwight S.S. Eppig J.T. Harris M.A. Hill D.P. Issel-Tarver L. Kasarskis A. Lewis S. Matese J.C. Richardson J.E. Ringwald M. Rubin G.M. Sherlock G. Gene ontology: tool for the unification of biology The Gene Ontology Consortium.Nat Genet. 2000; 25: 25-29Crossref PubMed Scopus (27254) Google Scholar in the functional annotation of the differentially expressed genes found by significance analysis of microarrays. We thus applied the method Gostat18Beissbarth T. Speed T.P. GOstat: find statistically overrepresented gene ontologies within a group of genes.Bioinformatics. 2004; 20: 1464-1465Crossref PubMed Scopus (981) Google Scholar to obtain the gene ontology annotations that were significantly overrepresented among the differentially expressed genes. We analyzed 8 tumors from pVillin-KRASV12G animals and 6 tumors from compound Apc+/1638N/pVillin-KRASV12G mice against the normal mucosa from wild-type littermates. This transcriptome analysis of tumor samples dissected from transgenic mouse models revealed altered expression in a group of genes related to mitosis (Table 1).Table 1A List of Mitosis-Related Genes Found Altered in Association With APC-Dependent CINGene codeGene descriptionIncreaseSTMN1stathmin 1/oncoprotein 184.7702CCNB2cyclin B23.6262RANBP1RAN binding protein 13.4847BUB1Bbudding uninhibited by benzimidazoles 1 homolog beta3.4311CCNB1cyclin B13.2234NUSAP1nucleolar- and spindle-associated protein 12.9636WEE1WEE1 homolog2.704SMC4L1SMC4 structural maintenance of chromosomes 4-like 12.6086RANRAN, member RAS oncogene family2.5616CNAP1chromosome condensation-related SMC-associated protein 12.554MAD2L1MAD2 mitotic arrest deficient-like 12.487CETN3centrin, EF-hand protein, 32.1549ANAPC4anaphase-promoting complex subunit 42.0603Transcriptome analysis revealed that the genes related to mitosis were significantly up-regulated in the tumor samples from the compound Apc+/1638N/pVillin-KRASV12G mice, compared to the genetically stable tumors of the pVillin-KRASV12G mice. Open table in a new tab Transcriptome analysis revealed that the genes related to mitosis were significantly up-regulated in the tumor samples from the compound Apc+/1638N/pVillin-KRASV12G mice, compared to the genetically stable tumors of the pVillin-KRASV12G mice. The catalog of mitotic genes altered in a nonfunctional APC scenario included some related to spindle assembly, such as RAN, RANBP1, NUSAP1, and STMN1, genes associated with spindle formation and maintenance, such as CETN3, SMC4L1, and CNAP1, and genes of the regulatory machinery, such as B-type cyclins, WEE1, and ANAPC4. The alteration of the genes involved in spindle formation and positioning is consistent with the observations that a truncation in APC dominant
Referência(s)