Repulsive Guidance Molecule RGMa Alters Utilization of Bone Morphogenetic Protein (BMP) Type II Receptors by BMP2 and BMP4
2007; Elsevier BV; Volume: 282; Issue: 25 Linguagem: Inglês
10.1074/jbc.m701679200
ISSN1083-351X
AutoresYin Xia, Paul B. Yu, Yisrael Sidis, Hideyuki Beppu, Kenneth D. Bloch, Alan L. Schneyer, Herbert Y. Lin,
Tópico(s)Kruppel-like factors research
ResumoBone morphogenetic proteins (BMPs) are members of the transforming growth factor-β superfamily of multifunctional ligands that transduce their signals through type I and II serine/threonine kinase receptors and intracellular Smad proteins. Recently, we identified the glycosylphosphatidylinositol-anchored repulsive guidance molecules RGMa, DRAGON (RGMb), and hemojuvelin (RGMc) as coreceptors for BMP signaling (Babbit, J. L., Huang, F. W., Wrighting, D. W., Xia, Y., Sidis, Y., Samad, T. A., Campagna, J. A., Chung, R., Schneyer, A., Woolf, C. J., Andrews, N. C., and Lin, H. Y. (2006) Nat. Genet. 38, 531–539; Babbit, J. L., Zhang, Y., Samad, T. A., Xia, Y., Tang, J., Schneyer, A., Woolf, C. J., and Lin, H. Y. (2005) J. Biol. Chem. 280, 29820–29827; Samad, T. A., Rebbapragada, A., Bell, E., Zhang, Y., Sidis, Y., Jeong, S. J., Campagna, J. A., Perusini, S., Fabrizio, D. A., Schneyer, A. L., Lin, H. Y., Brivanlou, A. H., Attisano, L., and Woolf, C. J. (2005) J. Biol. Chem. 280, 14122–14129). However, the mechanism by which RGM family members enhance BMP signaling remains unknown. Here, we report that RGMa bound to radiolabeled BMP2 and BMP4 with Kd values of 2.4 ± 0.2 and 1.4 ± 0.1 nm, respectively. In KGN human ovarian granulosa cells and mouse pulmonary artery smooth muscle cells, BMP2 and BMP4 signaling required BMP receptor type II (BMPRII), but not activin receptor type IIA (ActRIIA) or ActRIIB, based on changes in BMP signaling by small interfering RNA inhibition of receptor expression. In contrast, cells transfected with RGMa utilized both BMPRII and ActRIIA for BMP2 or BMP4 signaling. Furthermore, in BmpRII-null pulmonary artery smooth muscle cells, BMP2 and BMP4 signaling was reduced by inhibition of endogenous RGMa expression, and RGMa-mediated BMP signaling required ActRIIA expression. These findings suggest that RGMa facilitates the use of ActRIIA by endogenous BMP2 and BMP4 ligands that otherwise prefer signaling via BMPRII and that increased utilization of ActRIIA leads to generation of an enhanced BMP signal. Bone morphogenetic proteins (BMPs) are members of the transforming growth factor-β superfamily of multifunctional ligands that transduce their signals through type I and II serine/threonine kinase receptors and intracellular Smad proteins. Recently, we identified the glycosylphosphatidylinositol-anchored repulsive guidance molecules RGMa, DRAGON (RGMb), and hemojuvelin (RGMc) as coreceptors for BMP signaling (Babbit, J. L., Huang, F. W., Wrighting, D. W., Xia, Y., Sidis, Y., Samad, T. A., Campagna, J. A., Chung, R., Schneyer, A., Woolf, C. J., Andrews, N. C., and Lin, H. Y. (2006) Nat. Genet. 38, 531–539; Babbit, J. L., Zhang, Y., Samad, T. A., Xia, Y., Tang, J., Schneyer, A., Woolf, C. J., and Lin, H. Y. (2005) J. Biol. Chem. 280, 29820–29827; Samad, T. A., Rebbapragada, A., Bell, E., Zhang, Y., Sidis, Y., Jeong, S. J., Campagna, J. A., Perusini, S., Fabrizio, D. A., Schneyer, A. L., Lin, H. Y., Brivanlou, A. H., Attisano, L., and Woolf, C. J. (2005) J. Biol. Chem. 280, 14122–14129). However, the mechanism by which RGM family members enhance BMP signaling remains unknown. Here, we report that RGMa bound to radiolabeled BMP2 and BMP4 with Kd values of 2.4 ± 0.2 and 1.4 ± 0.1 nm, respectively. In KGN human ovarian granulosa cells and mouse pulmonary artery smooth muscle cells, BMP2 and BMP4 signaling required BMP receptor type II (BMPRII), but not activin receptor type IIA (ActRIIA) or ActRIIB, based on changes in BMP signaling by small interfering RNA inhibition of receptor expression. In contrast, cells transfected with RGMa utilized both BMPRII and ActRIIA for BMP2 or BMP4 signaling. Furthermore, in BmpRII-null pulmonary artery smooth muscle cells, BMP2 and BMP4 signaling was reduced by inhibition of endogenous RGMa expression, and RGMa-mediated BMP signaling required ActRIIA expression. These findings suggest that RGMa facilitates the use of ActRIIA by endogenous BMP2 and BMP4 ligands that otherwise prefer signaling via BMPRII and that increased utilization of ActRIIA leads to generation of an enhanced BMP signal. Bone morphogenetic proteins (BMPs) 4The abbreviations used are: BMPs, bone morphogenetic proteins; TGF-β, transforming growth factor-β; BMPRII, bone morphogenetic protein receptor type II; ActRII, activin receptor type II; ALKs, activin receptor-like kinases; RGM, repulsive guidance molecule; siRNA, small interfering RNA; PASMCs, pulmonary artery smooth muscle cells; RT, reverse transcription. 4The abbreviations used are: BMPs, bone morphogenetic proteins; TGF-β, transforming growth factor-β; BMPRII, bone morphogenetic protein receptor type II; ActRII, activin receptor type II; ALKs, activin receptor-like kinases; RGM, repulsive guidance molecule; siRNA, small interfering RNA; PASMCs, pulmonary artery smooth muscle cells; RT, reverse transcription. are a large subfamily of the transforming growth factor-β (TGF-β) superfamily of multifunctional ligands that regulate cell proliferation and differentiation, chemotaxis, and apoptosis. Members of the TGF-β superfamily, including BMPs, transduce their signals through binding to type I and II serine/threonine kinase receptors. Upon ligand binding, constitutively active type II receptors phosphorylate type I receptors, which then phosphorylate receptor-activated Smad proteins. Activated receptor-activated Smad proteins complex with the common partner Smad4 and subsequently translocate to the nucleus to regulate gene transcription (reviewed in Refs. 1Derynck R. Zhang Y.E. Nature. 2003; 425: 577-584Crossref PubMed Scopus (4199) Google Scholar, 2Massagué J. Chen Y.G. Genes Dev. 2000; 14: 627-644PubMed Google Scholar, 3Shi Y. Massagué J. Cell. 2003; 113: 685-700Abstract Full Text Full Text PDF PubMed Scopus (4737) Google Scholar). There are only five type II receptors: BMP receptor type II (BMPRII); activin receptor type II (ActRIIA and ActRIIB); TGF-β receptor type II; anti-müllerian hormone receptor type II; and seven type I receptors designated as activin receptor-like kinases (ALKs), including ALK1–ALK7. For the BMP ligands, three type II receptors (BMPRII, ActRIIA, and ActRIIB) and three type I receptors (ALK3, ALK6, and ALK2) have been identified, and these receptors transduce BMP signals through receptor-activated Smad1, Smad5, and Smad8.Signaling by TGF-β superfamily members, including BMPs, is modulated by extracellular secreted soluble binding proteins such as noggin, chordin, gremlin, and follistatin (3Shi Y. Massagué J. Cell. 2003; 113: 685-700Abstract Full Text Full Text PDF PubMed Scopus (4737) Google Scholar, 4Aspenberg P. Jeppsson C. Economides A.N. J. Bone Miner. Res. 2001; 16: 497-500Crossref PubMed Scopus (57) Google Scholar, 5Balemans W. Van Hul W. Dev. Biol. 2002; 250: 231-250Crossref PubMed Google Scholar, 6Canalis E. Economides A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar). Noggin is the best characterized BMP antagonist. It binds to BMP2 and BMP4 with an apparent Kd of ∼20 pm and also binds to BMP5–BMP7, GDF5, and GDF6, but with lesser affinity (4Aspenberg P. Jeppsson C. Economides A.N. J. Bone Miner. Res. 2001; 16: 497-500Crossref PubMed Scopus (57) Google Scholar, 5Balemans W. Van Hul W. Dev. Biol. 2002; 250: 231-250Crossref PubMed Google Scholar, 6Canalis E. Economides A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar). Recently, kielin/chordin-like protein has been described as a paracrine enhancer of BMP7 signaling (7Lin J. Patel S.R. Cheng X. Cho E.A. Levitan I. Ullenbruch M. Phan S.H. Park J.M. Dressler G.R. Nat. Med. 2005; 11: 387-393Crossref PubMed Scopus (152) Google Scholar). Another key regulatory mechanism for many TGF-β superfamily members is mediated through membrane-anchored proteins that assist with ligand binding to receptor or that alter receptor specificity. For example, betaglycan (TGF-β receptor type III) mediates TGF-β2 binding to TGF-β receptor type II (8Brown C.B. Boyer A.S. Runyan R.B. Barnett J.V. Science. 1999; 283: 2080-2082Crossref PubMed Scopus (329) Google Scholar) and also increases the affinity of inhibin for the activin and BMP type II receptors (9del Re E. Babitt J.L. Pirani A. Schneyer A.L. Lin H.Y. J. Biol. Chem. 2004; 279: 22765-22772Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, 10Lewis K.A. Gray P.C. Blount A.L. MacConell L.A. Wiater E. Bilezikjian L.M. Vale W. Nature. 2000; 404: 411-414Crossref PubMed Scopus (492) Google Scholar, 11Wiater E. Vale W. J. Biol. Chem. 2003; 278: 7934-7941Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Cripto, an epidermal growth factor-CFC (Cripto/FRL-1/Cryptic) motif-containing glycosylphosphatidylinositol-anchored membrane protein, mediates the binding of nodal and GDF1 to activin receptors (12Yeo C. Whitman M. Mol. Cell. 2001; 7: 949-957Abstract Full Text Full Text PDF PubMed Scopus (308) Google Scholar).We have shown recently that the repulsive guidance molecule (RGM) family members RGMa, DRAGON (RGMb), and hemojuvelin (RGMc) are coreceptors that enhance BMP signaling (13Babbit J.L. Huang F.W. Wrighting D.W. Xia Y. Sidis Y. Samad T.A. Campagna J.A. Chung R. Schneyer A. Woolf C.J. Andrews N.C. Lin H.Y. Nat. Genet. 2006; 38: 531-539Crossref PubMed Scopus (824) Google Scholar, 14Babbit J.L. Zhang Y. Samad T.A. Xia Y. Tang J. Schneyer A. Woolf C.J. Lin H.Y. J. Biol. Chem. 2005; 280: 29820-29827Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 15Samad T.A. Rebbapragada A. Bell E. Zhang Y. Sidis Y. Jeong S.J. Campagna J.A. Perusini S. Fabrizio D.A. Schneyer A.L. Lin H.Y. Brivanlou A.H. Attisano L. Woolf C.J. J. Biol. Chem. 2005; 280: 14122-14129Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). RGM family members share 50–60% protein sequence homology and have similar structural features, including a signal sequence, conserved proteolytic cleavage site, partial von Willebrand factor type D domain, and glycosylphosphatidylinositol anchor (16Monnier P.P. Sierra A. Macchi P. Deitinghoff L. Andersen J.S. Mann M. Flad M. Hornberger M.R. Stahl B. Bonhoeffer F. Mueller B.K. Nature. 2002; 419: 392-395Crossref PubMed Scopus (253) Google Scholar, 17Niederkofler V. Salie R. Sigrist M. Arber S. J. Neurosci. 2004; 24: 808-818Crossref PubMed Scopus (151) Google Scholar, 18Samad T.A. Srinivasan A. Karchewski L.A. Jeong S.J. Campagna J.A. Ji R.R. Fabrizio D.A. Zhang Y. Lin H.Y. Bell E. Woolf C.J. J. Neurosci. 2004; 24: 2027-2036Crossref PubMed Scopus (91) Google Scholar, 19Schmidtmer J. Engelkamp D. Gene Expr. Patterns. 2004; 4: 105-110Crossref PubMed Scopus (81) Google Scholar). RGMa and DRAGON are expressed in a complementary manner in the central nervous system, where DRAGON is involved in neuronal cell adhesion through homophilic interactions, whereas RGMa binds to the receptor neogenin and mediates retinotectal projections as well as neural tube closure (16Monnier P.P. Sierra A. Macchi P. Deitinghoff L. Andersen J.S. Mann M. Flad M. Hornberger M.R. Stahl B. Bonhoeffer F. Mueller B.K. Nature. 2002; 419: 392-395Crossref PubMed Scopus (253) Google Scholar, 17Niederkofler V. Salie R. Sigrist M. Arber S. J. Neurosci. 2004; 24: 808-818Crossref PubMed Scopus (151) Google Scholar, 20Rajagopalan S. Deitinghoff L. Davis D. Conrad S. Skutella T. Chedotal A. Mueller B.K. Strittmatter S.M. Nat. Cell Biol. 2004; 6: 756-762Crossref PubMed Scopus (221) Google Scholar). RGMa and DRAGON are also expressed in many other organs, including the kidney, testis, and ovary (14Babbit J.L. Zhang Y. Samad T.A. Xia Y. Tang J. Schneyer A. Woolf C.J. Lin H.Y. J. Biol. Chem. 2005; 280: 29820-29827Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 19Schmidtmer J. Engelkamp D. Gene Expr. Patterns. 2004; 4: 105-110Crossref PubMed Scopus (81) Google Scholar, 21Xia Y. Sidis Y. Mukherjee A. Samad T.A. Brenner G. Woolf C.J. Lin H.Y. Schneyer A. Endocrinology. 2005; 146: 3614-3621Crossref PubMed Scopus (28) Google Scholar). Our recent work has shown that DRAGON is localized in gonadal germ cells as well as in epithelial cells of the reproductive tract, including the epididymis and uterus, and that DRAGON is localized in lipid rafts as predicted from the presence of a glycosylphosphatidylinositol anchor site (21Xia Y. Sidis Y. Mukherjee A. Samad T.A. Brenner G. Woolf C.J. Lin H.Y. Schneyer A. Endocrinology. 2005; 146: 3614-3621Crossref PubMed Scopus (28) Google Scholar). Hemojuvelin is expressed at high levels in the skeletal muscle, heart, and liver (22Rodriguez Martinez A. Niemela O. Parkkila S. Haematologica. 2004; 89: 1441-1445PubMed Google Scholar). It is mutated in juvenile hemochromatosis, a disorder of iron overload (23Papanikolaou G. Samuels M.E. Ludwig E.H. MacDonald M.L. Franchini P.L. Dubé M. Andres L. MacFarlane J. Sakellaropoulos N. Politou M. Nemeth E. Thompson J. Risler J.K. Zaborowska C. Babakaiff R. Radomski C.C. Pape T.D. Davidas O. Christakis J. Brissot P. Lockitch G. Ganz T. Hayden M.R. Goldberg Y.P. Nat. Genet. 2004; 36: 77-82Crossref PubMed Scopus (824) Google Scholar). Interestingly, hemojuvelin mutants associated with hemochromatosis have impaired BMP signaling ability. BMP-induced expression of hepcidin, a key regulator of systemic iron homeostasis, is enhanced by hemojuvelin and blunted in hemojuvelin-null hepatocytes (13Babbit J.L. Huang F.W. Wrighting D.W. Xia Y. Sidis Y. Samad T.A. Campagna J.A. Chung R. Schneyer A. Woolf C.J. Andrews N.C. Lin H.Y. Nat. Genet. 2006; 38: 531-539Crossref PubMed Scopus (824) Google Scholar).The three RGM proteins bind directly to radiolabeled BMP2 and BMP4, but not to BMP7, activin, TGF-β1, TGF-β2, or TGF-β3. RGM proteins enhance BMP signaling even in the absence of exogenous BMP ligands. Although we have obtained data suggesting that RGM proteins appear to mediate BMP signaling through the classical BMP pathway (13Babbit J.L. Huang F.W. Wrighting D.W. Xia Y. Sidis Y. Samad T.A. Campagna J.A. Chung R. Schneyer A. Woolf C.J. Andrews N.C. Lin H.Y. Nat. Genet. 2006; 38: 531-539Crossref PubMed Scopus (824) Google Scholar, 14Babbit J.L. Zhang Y. Samad T.A. Xia Y. Tang J. Schneyer A. Woolf C.J. Lin H.Y. J. Biol. Chem. 2005; 280: 29820-29827Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 15Samad T.A. Rebbapragada A. Bell E. Zhang Y. Sidis Y. Jeong S.J. Campagna J.A. Perusini S. Fabrizio D.A. Schneyer A.L. Lin H.Y. Brivanlou A.H. Attisano L. Woolf C.J. J. Biol. Chem. 2005; 280: 14122-14129Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar), the molecular mechanisms by which RGM family members enhance BMP signaling remain largely unknown. In this study, we investigated the mechanism of action of RGMa using specific siRNA-mediated inhibition of endogenous BMP ligands and receptors. We found that RGMa has Kd values of 2.4 ± 0.2 nm for BMP2 and 1.4 ± 0.1 nm for BMP4 and that RGMa enhances BMP signaling by allowing BMP2 and BMP4 to increase their utilization of ActRIIA.EXPERIMENTAL PROCEDURESCell Culture and Transfection—KGN human ovarian granulosa cells were cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen), 2 mm l-glutamine, and antibiotics. Pulmonary artery smooth muscle cells (PASMCs) were isolated from mice that were homozygous for a conditional BmpRII allele, and the BmpRII gene was disrupted as described previously (24Yu P.B. Beppu H. Kawai N. Li E. Bloch K.D. J. Biol. Chem. 2005; 280: 24443-24450Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). PASMCs were cultured in RPMI 1640 medium containing 10% fetal bovine serum, l-glutamine, and antibiotics. All transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.Reverse Transcription (RT)-PCR—Total RNA was isolated from KGN cells and PASMCs using an RNeasy mini kit (Qiagen Inc.) including DNase by column digestion with an RNase-free DNase set (Qiagen Inc.) according to the manufacturer's instructions. First-strand cDNA synthesis was performed using an iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer's instructions. Transcripts of BMP2, BMP4–BMP7, BMPRII, BmpRII, and Rgma were amplified using the primers summarized in Table 1. Transcripts of ActRIIA and ActRIIB were amplified using the primers previously described (25Welt C.K. Lambert-Messerlian G.M. Zheng W. Crowley Jr., W.F. Schneyer A.L. J. Clin. Endocrinol. Metab. 1997; 82: 3720-3727Crossref PubMed Scopus (83) Google Scholar).TABLE 1Sequences, expected product sizes, and GenBank™ accession numbers for the primers used in RT-PCRGeneForward primer (5′ to 3′)Reverse primer (5′ to 3′)SizeAccession no.bphBMP2GTTCGGCCTGAAACAGAGACACCAACCTGGTGTCCAAAAG411NM_001200hBMP4AGCAGCCAAACTATGGGCTATGGTTGAGTTGAGGTGGTCA374NM_001202hBMP5TTCTTCAAGGCGAGTGAGGTAGGCTTTGGTACGTGGTCAG341BC027958hBMP6AACCAACCACGCGATTGTGAAGTCTCATCGTCCCACCTC280NM_001718hBMP7CAGAGCATCAACCCCAAGTTAGGATGACGTTGGAGCTGTC487NM_001719hBMPRII, mBmpRIITGACACAACACCACTCAGTCCACTACCCAGTCACTTGTGTGGAGAC495NM_001204, NM_007561hRGMa, mRgmaAACTCTGAGTTCTGGAGCGCCACAAAGTCCTGAGGTGTGGGTCCC361NM_020211, NM_177740 Open table in a new tab siRNA Targeting—siRNA duplexes in annealed and purified form were obtained from Ambion, Inc. (Austin, TX). Sense sequences of duplexes used for gene targeting are summarized in Table 2 for BMP2, BMP4, BMP6, BMPRII, ActRIIA, ActRIIB, Rgma, and Rgmb. Mouse BmpRII, ActRIIA, and ActRIIB siRNA sequences were described previously (24Yu P.B. Beppu H. Kawai N. Li E. Bloch K.D. J. Biol. Chem. 2005; 280: 24443-24450Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). siRNA duplexes were added at the concentrations indicated along with plasmids to subconfluent KGN cells or PASMCs in a mixture of Lipofectamine 2000 and Opti-MEM I (Invitrogen). Negative control siRNA (scrambled sequences) was used to balance siRNA where necessary. Assays to measure target mRNA levels, luciferase activity, or BMP-mediated Smad1/5/8 phosphorylation were performed ∼46 h after transfection.TABLE 2Sequences and GenBank™ accession numbers of siRNAs for human BMP ligands and type II receptors and mouse Rgma and RgmbGeneSequence (sense)Accession no.BMP2GGUUUUCCGAGAACAGAUGttNM_001200BMP4GGGACCAGUGAAAACUCUGttNM_001202BMP6GCGACACCACAAAGAGUUCttNM_001718BMPRIIGGUCUUCACAGUAUGAACAttNM_001204ActRIIAGGACUGAUUGUGUAGAAAAttNM_001616ActRIIBGGUGUACUUCUGCUGCUGUttNM_001106Rgma sequence 1CUAGAACCUUCUUUCAACUttNM_177740Rgma sequence 2CAGAAGCAUUUCCAAGAUUttNM_177740Rgmb sequence 1CAAACAAGGUCACGAUUAUttNM_178615Rgmb sequence 2CCAUGUAUAUGACAGAUGUttNM_178615 Open table in a new tab Measurement of Gene Expression—Real-time quantification of mRNA transcripts was performed using an AB 7300 real-time system (Applied Biosystems). First-strand cDNA was amplified with the primers shown in Table 3 and detected using SYBR® Green PCR Master Mix (Applied Biosystems) according to the manufacturer's instructions. In parallel, RPL19 (ribosomal protein-like 19) or Rpl19 transcripts were amplified and detected in a similar manner to serve as an internal control (26Szabo A. Perou C.M. Karaca M. Perreard L. Quackenbush J.F. Bernard P.S. Genome Biol. 2004; 5: R59Crossref PubMed Scopus (158) Google Scholar). Standard curves were generated from accurately determined dilutions of plasmid cDNAs or purified PCR fragments as templates. Results are expressed as a ratio of the gene of interest to RPL19 or Rpl19.TABLE 3Sequences, expected product sizes, and GenBank™ accession numbers for the primers used in real-time PCRGeneForward primer (5′ to 3′)Reverse primer (5′ to 3′)SizeAccession no.bphBMP2CGCAGCTTCCACCATGAAGAACCTGAAGCTCTGCTGAGGTGATA116NM_001200hBMP4AGGAGCTTCCACCACGAAGAACTGGAAGCCCCTTTCCCAATCAG175NM_001202hBMP6GTGAACCTGGTGGAGTACGACAAAGGTCAGAGTCTCTGTGCTGATG214NM_001718hBMPRIITGACACAACACCACTCAGTCCAGCTGCTGCCTCCATCATGTTC176NM_001204hActRIIACGATACCCATGGACAGGTTGGTAGAGATGGATGCTGGCCAATTTCC211NM_001616hActRIIBGCCTCTCATACCTGCATGAGGATGCCATGTACCGTCTCGTGCCTA206NM_001106mActRIIACAGAGGTGTTGGAGGGTGCTACTTCAAGAGATGGATGCTGGCC176NM_007396mActRIIBCACAAGCCTTCTATTGCCCACAGCATGTACCGTCTGGTGCCAAC160NM_007397mRgmaAAGGGAGAGGCTAGTGGTAACAGGCTCCAGAACTCAGAGTTGCAC166NM_177740mRgmb, hRGMbGCTACACACTGGAGACTGCCAAGTTGGCATCACCAGTGGTGAG107NM_178615, NM_001012761hRPL19ACATGGGCATAGGTAAGCGGA AGTTCACCTTCAGGTACAGGCTGTG159NM_000981mRpl19AGGCATATGGGCATAGGGAAGAGTTGACCTTCAGGTACAGGCTGTG164BC089549 Open table in a new tab Luciferase Assay—KGN cells or PASMCs were transiently transfected with a BMP-responsive firefly luciferase reporter (BRE-Luc) (27Korchynskyi O. ten Dijke P. J. Biol. Chem. 2002; 277: 4883-4891Abstract Full Text Full Text PDF PubMed Scopus (699) Google Scholar) or an activin-responsive firefly luciferase reporter ((CAGA)12MPL-Luc) (28Dennler S. Itoh S. Vivien D. ten Dijke P. Huet S. Gauthier J.M. EMBO J. 1998; 17: 3091-3100Crossref PubMed Scopus (1573) Google Scholar) construct in combination with pTK-Renilla (Promega Corp., Madison, WI) at a ratio of 10:1 to control for transfection efficiency with or without cotransfection with siRNAs in the absence or presence of RGMa cDNA. Approximately 24 h after transfection, the medium was replaced with serum-free medium supplemented with 0.1% bovine serum albumin with or without BMP or activin ligands (R&D Systems, Minneapolis, MN). After treatment for 16 h, the cells were lysed, and luciferase activity was determined with the Dual-Reporter assay kits (Promega Corp.). Experiments were performed in triplicate wells. Relative light units were calculated as the ratios of firefly (reporter) and Renilla (transfection control) luciferase values.Measurement of Smad1/5/8 Phosphorylation—KGN cells plated to 80% confluence were transiently transfected with BMPRII, ActRIIA, ActRIIB, or control siRNA; with RGMa cDNA; or with empty vector. 24 h after transfection, cells were replaced with serum-free medium supplemented with 0.1% bovine serum albumin. After starvation for 16 h, cells without RGMa cDNA transfection were incubated with 10 ng/ml BMP2 for 1 h at 37 °C. Cells were lysed in 20 mm Tris-HCl, 150 mm NaCl, 2 mm EDTA, and 0.1% Nonidet P-40 containing protease inhibitor mixture (Pierce) and phosphatase inhibitor mixture (Pierce) for 30 min on ice. After centrifugation for 10 min at 4 °C, the supernatant was assayed for protein concentration by colorimetric assay (BCA kit, Pierce). 30 μg of protein was separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes. Membranes were probed with rabbit anti-phospho-Smad1/5/8 polyclonal antibody (1:1000 dilution; Cell Signaling Technology, Beverly, MA). Membranes were stripped in 0.2 m glycine (pH 2.5) and 0.5% Tween 20 for 10 min and reprobed with rabbit anti-Smad1 polyclonal antibody (1:1000 dilution; Upstate Biotechnology, Lake Placid, NY), followed by horseradish peroxidase-conjugated secondary antibody. Antibody binding was detected with chemiluminescence reagent (PerkinElmer Life Sciences) and exposed to X-Omat film (Eastman Kodak Co., Rochester, NY). Densitometry was performed using IPLab Spectrum software (Scanalytics, Vienna, VA).Ligand Iodination—Carrier-free human BMP2 and BMP4 were purchased from R&D Systems. Ligand (2 μg/reaction) was iodinated with 125I by the modified chloramine-T method as described previously (29Frolik C.A. Wakefield L.M. Smith D.M. Sporn M.B. J. Biol. Chem. 1984; 259: 10995-11000Abstract Full Text PDF PubMed Google Scholar).Binding Assays—The RGMa-Fc fusion protein was produced by fusing the soluble extracellular domain of RGMa to the Fc portion of human IgG and was purified from the medium of stably transfected cells via one-step protein A affinity chromatography using HiTrap rProtein A FF columns (Amersham Biosciences) as described previously (14Babbit J.L. Zhang Y. Samad T.A. Xia Y. Tang J. Schneyer A. Woolf C.J. Lin H.Y. J. Biol. Chem. 2005; 280: 29820-29827Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar). Purified RGMa-Fc (20 ng) mixed in 1× Tris-buffered saline/casein blocking buffer (BioFX Laboratories, Owings Mills, MD) was incubated overnight at 4 °C with 125I-BMP2 or 125I-BMP4 and increasing doses of unlabeled BMP2 or BMP4 (R&D Systems). The reaction mixture was then incubated for 1.5 h at 4 °C on protein A-coated plates (Pierce); the plates were washed with wash solution (KPL, Inc., Gaithersburg, MD); and individual wells were counted with a standard γ-counter. For mixing studies, buffer alone; purified RGMa-Fc alone (1 ng); ActRIIA-Fc alone (2 ng); a combination of ActRIIA-Fc and ALK3-Fc (R&D Systems); or a combination of RGMa-Fc, ActRIIA-Fc, and ALK3-Fc was incubated with 125I-BMP2, followed by incubation on protein A-coated plates and determination of radioactivity as described above.Data Analysis—Results from luciferase assay experiments are expressed as the means ± S.E. of at least three replicates. For homologous binding assays, dissociation constants were determined by Scatchard analysis using Prism (GraphPad Software, San Diego, CA). The Western blots shown in Fig. 6 are representative experiments, and the densitometry data represent the means ± S.E. of two replicates. Differences were assessed by Student's t test with p < 0.05 used to indicate significance.RESULTSBMP2 and BMP4 Are Both Endogenous Ligands for RGMa in KGN Cells—We demonstrated previously that RGMa-Fc binds BMP2 and BMP4, but not BMP7 and TGF-β1, and that RGMa-mediated BMP signaling can be inhibited by an antibody against both BMP2 and BMP4 (14Babbit J.L. Zhang Y. Samad T.A. Xia Y. Tang J. Schneyer A. Woolf C.J. Lin H.Y. J. Biol. Chem. 2005; 280: 29820-29827Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar). Therefore, it is possible that BMP2, BMP4, or both are endogenous ligands for RGMa. To further investigate ligands for the RGMa coreceptor, we screened KGN cells, which do not express RGMa (RT-PCR data not shown), by RT-PCR for expression of BMP2 and BMP4 and the closely related members BMP5–BMP7 (Fig. 1A). Among these ligands, only BMP2, BMP4, and BMP6 were detected in KGN cells. We then tested whether RGMa-induced BMP signaling is affected by siRNA-mediated specific inhibition of BMP2, BMP4, or BMP6. As shown in Fig. 1B, BMP2, BMP4, and BMP6 expression was specifically inhibited by the respective gene-specific siRNA duplexes (60 nm), with minimal effect on the expression of the other ligands. The siRNAs reduced BMP2, BMP4, and BMP6 mRNA expression levels by 80, 60, and 75%, respectively. KGN cells were transfected with BRE-Luc in combination with control, BMP2, BMP4, or BMP6 siRNA (60 nm) (Fig. 2A). As expected, transfection of KGN cells with RGMa increased BRE-Luc activity in a dose-dependent manner in the absence of exogenous ligands. Inhibition of BMP2 or BMP4 expression dramatically reduced RGMa-mediated BMP signaling. In contrast, inhibition of BMP6 expression did not change BRE-Luc activity induced by RGMa compared with control siRNA (Fig. 2A). RGMa-mediated BMP signaling was completely inhibited to below the basal levels by double inhibition of both BMP2 and BMP4 expression (Fig. 2B). These results demonstrate that BMP2 and BMP4 are both endogenous ligands for RGMa. Moreover, because inhibition of BMP2 and BMP4 expression abrogated the ability of RGMa to induce BRE-Luc activity, BMP2 and BMP4 are likely the sole endogenous ligands for the RGMa coreceptor in KGN cells.FIGURE 1Expression of BMP ligands BMP2 and BMP4–BMP7 in KGN cells and specificity and efficacy of siRNAs targeting BMP2, BMP4, and BMP6 expression. A, total RNA from KGN cells was extracted for RT-PCR to determine the expression of BMP2 and BMP4–BMP7. Purified plasmid cDNAs for these ligands were used in PCR analyses as positive controls. B, siRNAs (60 nm) derived from sequences of BMP2, BMP4, and BMP6 were employed to decrease their expression in KGN cells. mRNA levels were measured 46 h after cells were transfected with specific siRNA by quantitative real-time PCR, were normalized to RPL19 mRNA levels, and are expressed as a fraction of values from cells treated with negative control siRNA. The values shown are the means ± S.E. of triplicate measurements. BMP2 (si-BMP2)-, BMP4 (si-BMP4)-, and BMP6 (si-BMP6)-specific siRNAs reduced the expression of those genes by 80, 60, and 75% respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 2siRNA-mediated specific inhibition of BMP2 and BMP4 expression attenuates the stimulation of BRE promoter activity induced by RGMa. A, impact of siRNA targeting of BMP2, BMP4, and BMP6 on RGMa-mediated BMP signaling. KGN cells were transfected with BRE-Luc and pRL-TK either alone or with increasing amounts of RGMa cDNA and in combination with control, BMP2 (si-BMP2), BMP4 (si-BMP4), or BMP6 (si-BMP6) siRNA (60 nm) for 46 h prior to measurement of luciferase activity. Luciferase values were normalized for transfection efficiency relative to Renilla activity. The values shown are the means ± S.E. of triplicate measurements. B, impact of combined BMP2 and BMP4 siRNAs on RGMa-mediated BMP signaling. KGN cells were transfected with BRE-Luc and pRL-TK either alone or with increasing amounts of RGMa cDNA and in combination with control, BMP2, or BMP4 siRNA or with BMP2 and BMP4 siRNAs (40 nm each). Control siRNA was used to equalize the total amount of siRNA.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Next, w
Referência(s)