Quaternary Structure of Coronavirus Spikes in Complex with Carcinoembryonic Antigen-related Cell Adhesion Molecule Cellular Receptors
2002; Elsevier BV; Volume: 277; Issue: 22 Linguagem: Inglês
10.1074/jbc.m201837200
ISSN1083-351X
AutoresDaniel N. Lewicki, Thomas Gallagher,
Tópico(s)Virus-based gene therapy research
ResumoOligomeric spike (S) glycoproteins extend from coronavirus membranes. These integral membrane proteins assemble within the endoplasmic reticulum of infected cells and are subsequently endoproteolyzed in the Golgi, generating noncovalently associated S1 and S2 fragments. Once on the surface of infected cells and virions, peripheral S1 fragments bind carcinoembryonic antigen-related cell adhesion molecule (CEACAM) receptors, and this triggers membrane fusion reactions mediated by integral membrane S2 fragments. We focused on the quaternary structure of S and its interaction with CEACAMs. We discovered that soluble S1 fragments were dimers and that CEACAM binding was entirely dependent on this quaternary structure. However, two differentially tagged CEACAMs could not co-precipitate with the S dimers, suggesting that binding sites were closely juxtaposed in the dimer (steric hindrance) or that a single CEACAM generated global conformational changes that precluded additional interactions (negative cooperativity). CEACAM binding did indeed alter S1 conformations, generating alternative disulfide linkages that were revealed on SDS gels. CEACAM binding also induced separation of S1 and S2. Differentially tagged S2 fragments that were free of S1 dimers were not co-precipitated, suggesting that S1 harbored the primary oligomerization determinants. We discuss the distinctions between the S·CEACAM interaction and other virus-receptor complexes involved in receptor-triggered entry. Oligomeric spike (S) glycoproteins extend from coronavirus membranes. These integral membrane proteins assemble within the endoplasmic reticulum of infected cells and are subsequently endoproteolyzed in the Golgi, generating noncovalently associated S1 and S2 fragments. Once on the surface of infected cells and virions, peripheral S1 fragments bind carcinoembryonic antigen-related cell adhesion molecule (CEACAM) receptors, and this triggers membrane fusion reactions mediated by integral membrane S2 fragments. We focused on the quaternary structure of S and its interaction with CEACAMs. We discovered that soluble S1 fragments were dimers and that CEACAM binding was entirely dependent on this quaternary structure. However, two differentially tagged CEACAMs could not co-precipitate with the S dimers, suggesting that binding sites were closely juxtaposed in the dimer (steric hindrance) or that a single CEACAM generated global conformational changes that precluded additional interactions (negative cooperativity). CEACAM binding did indeed alter S1 conformations, generating alternative disulfide linkages that were revealed on SDS gels. CEACAM binding also induced separation of S1 and S2. Differentially tagged S2 fragments that were free of S1 dimers were not co-precipitated, suggesting that S1 harbored the primary oligomerization determinants. We discuss the distinctions between the S·CEACAM interaction and other virus-receptor complexes involved in receptor-triggered entry. For enveloped viruses, efficient infection requires a regulated coalescence of virion and cellular membranes. Temporal and spatial regulation of this membrane fusion event must occur for viral genomes to enter into a milieu suitable for subsequent replicative processes. Protruding virion glycoproteins, each poised to induce membrane coalescence, have therefore evolved sensitivities to the environmental conditions found at entry sites. These conditions trigger coordinated and irreversible changes in virion glycoprotein conformations that can culminate in membrane fusion. Well known triggers for conformational change include cellular receptor binding (1Hernandez L.D. Hoffman L.R. Wolfsberg T.G. White J.M. Annu. Rev. Cell Dev. Biol. 1986; 12: 627-661Crossref Scopus (509) Google Scholar, 2Doranz B.J. Baik S.S.W. Doms R.W. J. Virol. 1999; 73: 10346-10358Crossref PubMed Google Scholar, 3Sattentau Q.J. Moore J.P. J. Exp. Med. 1991; 174: 407-415Crossref PubMed Scopus (519) Google Scholar, 4Wu L. Gerard N.P. Wyatt R. Choe H. Parolin C. Ruffing N. Borsetti A. Cardoso A.A. Desjardin E. Newman W. Gerard C. Sodroski J. Nature. 1996; 384: 179-183Crossref PubMed Scopus (1081) Google Scholar) and/or the low pH exposures that occur following engulfment of virus particles into endosomes (5Mothes W. Boerger A.L. Narayan S. Cunningham J.M. Young J.A. Cell. 2000; 103: 679-689Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar, 6Bullough P.A. Hughson F.M. Skehel J.J. Wiley D.C. Nature. 1994; 371: 37-43Crossref PubMed Scopus (1379) Google Scholar, 7Stegmann T. White J.M. Helenius A. EMBO J. 1990; 13: 4231-4241Crossref Scopus (200) Google Scholar). Our studies have focused on murine hepatitis coronavirus (MHV) 1The abbreviations used are: MHVmurine hepatitis virusCEACAMcarcinoembryonic antigen-related cell adhesion moleculeDMEMDulbecco's modified Eagle's mediumFCSfetal calf serumTKthymidine kinaseDPRdeletion prone regionPBSphosphate-buffed salinemAbmonoclonal antibodyβ-MEβ-mercaptoethanolEGFPenhanced green fluorescent proteinHRPOhorseradish peroxidaseDSPdithiobis(succinimidylproprionate)NEMN-ethylmaleimidegpglycoprotein as a model for understanding receptor-triggered entry processes. This virus is a well studied prototype member of the Coronaviridae, plus-strand RNA viruses that cause a wide range of diseases in humans and animals (8Perlman S. Lane T.E. Buchmeier M.J. Cunningham M. Fujinami R.S. Effects of Microbes on the Immune System. Lippincott-Raven, New York2000: 331-348Google Scholar). Because the distinct species specificity and tissue tropism of coronavirus strains largely correlate with changes in the spike (S) protein (9Sanchez C.M. Izeta A. Sanchez-Morgado J.M. Alonso S. Sola I. Balasch M. Plana-Duran J. Enjuanes L. J. Virol. 1999; 73: 7607-7618Crossref PubMed Google Scholar, 10Phillips J.J. Chua M.M. Lavi E. Weiss S.R. J. Virol. 1999; 73: 7752-7760Crossref PubMed Google Scholar, 11Kuo L. Godeke G.J. Raamsman M.J. Masters P.S. Rottier P.J. J. Virol. 2000; 74: 1393-1406Crossref PubMed Scopus (294) Google Scholar), details about S interactions with receptors can enhance our understanding of pathogenesis. murine hepatitis virus carcinoembryonic antigen-related cell adhesion molecule Dulbecco's modified Eagle's medium fetal calf serum thymidine kinase deletion prone region phosphate-buffed saline monoclonal antibody β-mercaptoethanol enhanced green fluorescent protein horseradish peroxidase dithiobis(succinimidylproprionate) N-ethylmaleimide glycoprotein S proteins are classical type I membrane proteins, with ∼1300 residue ectodomains, 18-residue transmembrane spans, and a 38-residue cytoplasmic tail (12Schmidt I. Skinner M. Siddell S.G. J. Gen. Virol. 1987; 68: 47-56Crossref PubMed Scopus (70) Google Scholar). Oligomerization occurs rapidly after synthesis (13Vennema H. Rottier P.J.M. Heijnen L. Godeke G.J. Horzinek M.C. Spaan W.J.M. Cananaugh D. Brown T.D.K. Coronavirus and Their Diseases. Plenum Publishing Corp., New York1990: 9-19Google Scholar) and is followed by transport through the exocytic pathway. Within the trans-Golgi network, a furin-like protease cleaves the full-length spike into two similar-sized fragments, a peripheral S1, and a membrane-anchored S2 (14Sturman L.S. Ricard C.S. Holmes K.V. J. Virol. 1985; 56: 904-911Crossref PubMed Google Scholar, 15Frana M.F. Behnke J.N. Sturman L.S. Holmes K.V. J. Virol. 1985; 56: 912-920Crossref PubMed Google Scholar). S1, which associates with S2 through noncovalent interactions, is responsible for binding to cellular receptors. S2 contains the core machinery necessary for membrane fusion (16Yoo D.W. Parker M.D. Babiuk L.A. Virology. 1991; 180: 395-399Crossref PubMed Scopus (40) Google Scholar). Receptors for the MHV S proteins include numerous members of thecarcinoembryogenic antigen-relatedcell adhesion molecule (CEACAM) family, immunoglobulin-like glycoproteins that serve as entry portals for a relatively wide variety of pathogens (17Dveksler G.S. Pensiero M.N. Dieffenbach C.W. Cardellichio C.B. Basile A.A. Elia P.E. Holmes K.V. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1716-1720Crossref PubMed Scopus (92) Google Scholar, 18Dveksler G.S. Pensiero M.N. Cardellichio C.B. Williams R.K. Jiang G.-S. Holmes K.V. Dieffenbach C.W. J. Virol. 1991; 65: 6881-6891Crossref PubMed Google Scholar, 19Holmes K.V. Dveksler G.S. Wimmer E. Cellular Receptors for Animal Viruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1994: 403-443Google Scholar, 20Billker O. Popp A. Brinkmann V. Wenig G. Schneider J. Caron E. Meyer T.F. EMBO J. 2002; 21: 560-571Crossref PubMed Scopus (73) Google Scholar, 21Leusch H.G. Drzeniek Z. Markos-Prustai Z. Wagener C. Infect. Immun. 1991; 59: 2051-2057Crossref PubMed Google Scholar). The prototype receptor for MHV, murine CEACAM isoform 1a, is a type I transmembrane glycoprotein with four Ig-like ectodomains designated as N (amino-terminal)-A1a-Ba-A2a (22Beauchemin N. Draber P. Dveksler G. Gold P. Gray-Owen S. Hammarstrom S. Holmes K.V. Karlsson A. Kuorki M. Lin S.-H. Lucka L. Najjar S.M. Neumaier M. Obrink B. Shively J.E. Skubitz K.M. Stanners C.P. Thomas P. Thompson J.A. Virji M.A. Exp. Cell Res. 1999; 252: 243-249Crossref PubMed Scopus (328) Google Scholar). The N-domain binds to S proteins (17Dveksler G.S. Pensiero M.N. Dieffenbach C.W. Cardellichio C.B. Basile A.A. Elia P.E. Holmes K.V. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1716-1720Crossref PubMed Scopus (92) Google Scholar). After binding to a soluble N-CEACAM fragment, spikes undergo a conformational change that can, in some cases, be revealed as S1 shedding from S2 (23Krueger D.K. Kelly S.M. Lewicki D.N. Ruffolo R. Gallagher T.M. J. Virol. 2001; 75: 2792-2802Crossref PubMed Scopus (72) Google Scholar). This structural change may be relevant to MHV entry, as S1 separation from S2 correlates with increased membrane fusion activity (23Krueger D.K. Kelly S.M. Lewicki D.N. Ruffolo R. Gallagher T.M. J. Virol. 2001; 75: 2792-2802Crossref PubMed Scopus (72) Google Scholar). A conservative view is that the CEACAM binding to S releases free energy that drives the conformational changes required to promote coalescence of the virus and cell membranes. Indeed, soluble forms of CEACAM can, through binding S proteins, increase the propensity of S to fuse membranes (24Taguchi F. Matsuyama S. J. Virol. 2002; 76: 950-958Crossref PubMed Scopus (44) Google Scholar). Understanding the connections between CEACAM binding and membrane fusion depends in part on a view of the actual CEACAM-binding site(s) on the S protein. Kubo et al. (25Kubo H. Yamada Y.K. Taguchi F. J. Virol. 1994; 68: 5403-5410Crossref PubMed Scopus (0) Google Scholar) mapped the CEACAM-binding sites to the amino-terminal 330 residues of S1, but high resolution protein structures are currently unknown. Questions also remain concerning quaternary structures, both S dimers and trimers have been proposed (13Vennema H. Rottier P.J.M. Heijnen L. Godeke G.J. Horzinek M.C. Spaan W.J.M. Cananaugh D. Brown T.D.K. Coronavirus and Their Diseases. Plenum Publishing Corp., New York1990: 9-19Google Scholar, 26Delmas B. Laude H. J. Virol. 1990; 64: 5367-5375Crossref PubMed Google Scholar). Thus, we embarked on studies assessing the oligomeric organization of S and S·CEACAM complexes. Here we report that S1, when shed from S2 or when produced independently from cDNAs, exists stably as a dimer. We discovered that S1 dimers, but not monomers, will bind to CEACAM receptors. In fact, we found that the region conferring dimerization resides at or near the CEACAM1a-binding site, an unexpected finding because oligomerization determinants in functionally analogous spike proteins of other viruses reside within the integral membrane fragments (27Wilson I.A. Skehel J.J. Wiley D.C. Nature. 1981; 289: 366-373Crossref PubMed Scopus (1982) Google Scholar, 28Wiley D.C. Skehel J.J. Annu. Rev. Biochem. 1987; 56: 365-394Crossref PubMed Scopus (1161) Google Scholar, 29Weissenhorn W. Wharton S.A. Calder L.J. Earl P.L. Moss B. Aliprandis E. Skehel J.J. Wiley D.C. EMBO J. 1996; 15: 1507-1514Crossref PubMed Scopus (133) Google Scholar, 30Weissenhorn W. Dessen A. Harrison S.C. Skehel J.J. Wiley D.C. Nature. 1997; 387: 426-430Crossref PubMed Scopus (1466) Google Scholar, 31Lu M. Blacklow S.C. Kim P.S. Nat. Struct. Biol. 1995; 2: 1075-1082Crossref PubMed Scopus (671) Google Scholar, 32Bernstein H.B. Tucker S.P. Kar S.R. McPherson S.A. McPherson D.T. Dubay J.W. Lebowitz J. Compans R.W. Hunter E. J. Virol. 1995; 69: 2745-2750Crossref PubMed Google Scholar, 33Weissenhorn W. Calder L.J. Wharton S.A. Skehel J.J. Wiley D.C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6032-6036Crossref PubMed Scopus (111) Google Scholar, 34Chan D.C. Fass D. Berger J.M. Kim P.S. Cell. 1997; 89: 263-273Abstract Full Text Full Text PDF PubMed Scopus (1841) Google Scholar, 35Dutch R.E. Leser G.P. Lamb R.A. Virology. 1999; 254: 147-159Crossref PubMed Scopus (39) Google Scholar). Remarkably, only one CEACAM bound each S1 dimer, and we identified a novel disulfide-linked S1 conformation in S1·CEACAM complexes. Our findings refine the current understanding of CEACAM receptors as mediators of conformational change, and they form the basis for a preliminary model of receptor-triggered entry with both parallels and deviations from established paradigms for enveloped virus entry (36Weissenhorn W. Dessen A. Calder L.J. Harrison S.C. Skehel J.J. Wiley D.C. Mol. Membr. Biol. 1999; 16: 3-9Crossref PubMed Scopus (321) Google Scholar, 37Skehel J.J. Wiley D.C. Cell. 1998; 95: 871-874Abstract Full Text Full Text PDF PubMed Scopus (368) Google Scholar, 38Eckert D.M. Kim P.S. Annu. Rev. Biochem. 2001; 70: 777-810Crossref PubMed Scopus (1146) Google Scholar, 39Joshi S.B. Dutch R.E. Lamb R.A. Virology. 1998; 248: 20-34Crossref PubMed Scopus (153) Google Scholar, 40Melikyan G.B. Markosyan R.M. Hemmati H. Delmedico M.K. Lambert D.M. Cohen F.S. J. Cell Biol. 2000; 151: 413-423Crossref PubMed Scopus (483) Google Scholar, 41Russell C.J. Jardetzky T.S. Lamb R.A. EMBO J. 2001; 20: 4024-4034Crossref PubMed Scopus (248) Google Scholar). HeLa-tTA and rabbit kidney clone 13 (RK13) cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS). 293 EBNA cells secreting N-CEACAMFc (formerly known as sMHVR-Ig) (42Gallagher T.M. J. Virol. 1997; 71: 3129-3137Crossref PubMed Google Scholar) were grown in DMEM, 10% FCS containing the antibiotics G418 (100 μg/ml) and hygromycin B (200 μg/ml). We used murine CEACAM1a cDNA (22Beauchemin N. Draber P. Dveksler G. Gold P. Gray-Owen S. Hammarstrom S. Holmes K.V. Karlsson A. Kuorki M. Lin S.-H. Lucka L. Najjar S.M. Neumaier M. Obrink B. Shively J.E. Skubitz K.M. Stanners C.P. Thomas P. Thompson J.A. Virji M.A. Exp. Cell Res. 1999; 252: 243-249Crossref PubMed Scopus (328) Google Scholar, 42Gallagher T.M. J. Virol. 1997; 71: 3129-3137Crossref PubMed Google Scholar) as template for PCR amplification of N-CEACAM6×His, using the primer 5′ GTCGAGTCAGTGGTGGTGGTGGTGGTGTACATGAAATCG 3′, which encodes a hexahistidine tag. We used cDNA of S (strain JHM) (43Parker S.E. Gallagher T.M. Buchmeier M.J. Virology. 1989; 173: 664-673Crossref PubMed Scopus (117) Google Scholar) as a template for PCR amplification of S gene and truncated S fragments. To create ST212S/Y214S/Y216S, mutagenic oligonucleotides 5′ GGTGGTTCTTTTTCTGCGTCCTATGCGGAT 3′ and its complement were used in PCRs. To generate enhanced green fluorescent protein (EGFP)-tagged spikes, we engineered pTM1-S (42Gallagher T.M. J. Virol. 1997; 71: 3129-3137Crossref PubMed Google Scholar) with a unique NotI restriction site using the following oligonucleotide: 5′ GGGCTCGAGTCAGCGGCCGCTCACAGGGATCCAGTGCATCCTCATGGGC 3′. EGFP DNA was PCR-amplified from pEGFP (Clontech), and 741-nucleotide Not-I/BamHI restriction fragment was cloned into the aforementioned pTM1-S(NotI). Mutations in the CEACAM and S genes were confirmed by DNA sequencing. Restriction fragment exchanges with the vaccinia virus insertion-expression vector pTM1-S and pTM3-S1 were all performed as described previously (42Gallagher T.M. J. Virol. 1997; 71: 3129-3137Crossref PubMed Google Scholar). All recombinant plasmids were cloned and amplified in E. coli DH5α (for pTM1 vector) or HB101 (for pTM3 vector). Plasmids pTM1-SΔDPR2 (23Krueger D.K. Kelly S.M. Lewicki D.N. Ruffolo R. Gallagher T.M. J. Virol. 2001; 75: 2792-2802Crossref PubMed Scopus (72) Google Scholar) and pTM1-SEGFP were used directly, without recombination into vaccinia vectors. The SEGFP protein includes the entire SΔDPR2 followed by an eight-residue linker (ALDPPVAT) and a C-terminal 238-residue EGFP. Plasmids were recombined into the thymidine kinase (TK) gene of vaccinia virus (strain WR) by standard methods (44Mackett M. Smith G.L. Moss B. J. Virol. 1984; 49: 857-864Crossref PubMed Google Scholar), and TK-negative virus isolates were amplified in RK13 cells. TK-negative virus stocks were screened for S or CEACAM cDNA expression by co-infection with vTF7.3 (45Fuerst T.R. Earl P.L. Moss B. Mol. Cell. Biol. 1987; 7: 2538-2544Crossref PubMed Scopus (334) Google Scholar) and immunoblot detection of the respective proteins in cell lysates, as described previously (23Krueger D.K. Kelly S.M. Lewicki D.N. Ruffolo R. Gallagher T.M. J. Virol. 2001; 75: 2792-2802Crossref PubMed Scopus (72) Google Scholar). We used the following vaccinia recombinants: vTM3-S1 (encodes 769-residue S1 of JHM strain); vTM3-S1330(encodes 330-residue amino-terminal S1 fragment); vTM3-S1ΔDPR1 (encodes S1 with internal deletion of residues 446–598); vTM3-S1ΔDPR2 (encodes S1 with internal deletion of residues 429–586); vTM1-SECTO(encodes 1320 residue S1/S2 lacking transmembrane span and cytoplasmic tail); vTM1-ST212S/Y214S/Y216S (encodes full-length S of JHM strain with the indicated substitutions); vTM3-CEACAMECTO (encodes N-A1-B-A2 Ig-like domains of CEACAM); vTM3-N-CEACAM6×His (encodes N-domain of CEACAM with 6 carboxyl-terminal histidines). To obtain N-CEACAMFc, 293 EBNA:N-CEACAMFc cells (42Gallagher T.M. J. Virol. 1997; 71: 3129-3137Crossref PubMed Google Scholar) were incubated overnight in serum-free DMEM. Culture supernatant was collected, filtered through a 0.22-μm membrane, dialyzed against PBS-P (PBS (pH 7.4) containing 0.01% protease inhibitor mixture (Sigma)), and concentrated 100-fold by ultrafiltration. In some cases, N-CEACAMFc was further purified by affinity chromatography on Sepharose-protein G (Amersham Biosciences). Supernatants typically yielded ∼2 μg of N-CEACAMFc per ml. To obtain 35S-labeled recombinant S proteins and CEACAMECTO, monolayers of HeLa-tTA cells were inoculated at 2 plaque-forming units/cell for 1 h at 37 °C with vTF7.3 and the respective recombinant vaccinia viruses. At 6 h post-infection, the medium was replaced with labeling media (DMEM, 1% dialyzed FCS lacking cysteine and methionine). After 1 h, the labeling media was replaced with serum-free labeling media supplemented with 25 μCi/ml Tran35S-label (ICN). After a 5-h incubation, the harvested media were clarified by centrifugation, dialyzed, and concentrated ∼100-fold by ultrafiltration as described above. S proteins were collected from media or from cytoplasmic extracts. Extracts were obtained by lysing infected cell monolayers with PBS-P containing 0.5% Nonidet P-40, followed by removal of nuclei by centrifugation at 3000 × g for 15 min. S proteins were immunoprecipitated with N-CEACAMFc, with polyclonal anti-JHM serum (R33 serum, a gift from Dr. Stanley Perlman, University of Iowa), or with monoclonal anti-S antibody J.2.6 (J.2.6 hybridoma (46Fleming J.O. Stohlman S.A. Harmon R.C. Lai M.M.C. Frelinger J.A. Werner L.P. Virology. 1983; 131: 296-307Crossref PubMed Scopus (108) Google Scholar), a gift from Dr. John Fleming, University of Wisconsin, Madison) or with monoclonal anti-S antibody number 2 (a gift from Dr. Fumihiro Taguchi, National Institute of Neuroscience, Tokyo, Japan). Briefly, these Igs were bound for 4 h at 4 °C to Gamma Bind G-Sepharose beads (Amersham Biosciences). The beads were then rinsed three times with PBS-P by centrifugation and resuspension. After overnight incubation at 4 °C with media or cytoplasmic extracts, beads were rinsed by five cycles of centrifugation and resuspension with PBS-P containing 0.5% Nonidet P-40. The final bead pellets were mixed with SDS solubilizer (2% SDS, 5% β-mercaptoethanol (β-ME), 2.5% Ficoll, 0.005% bromphenol blue) for 5 min at 100 °C. Dissolved proteins were then visualized after SDS-PAGE by fluorography or immunoblotting, as described previously (23Krueger D.K. Kelly S.M. Lewicki D.N. Ruffolo R. Gallagher T.M. J. Virol. 2001; 75: 2792-2802Crossref PubMed Scopus (72) Google Scholar). Samples containing35S-labeled S1 or S1·CEACAM complexes were overlaid onto linear 5 ml of 5–20% w/w sucrose gradients in PBS-P containing 0.01% BSA. A parallel gradient was overlaid with an extract containing the sedimentation markers horseradish peroxidase (HRPO 4 S), human immunoglobulin G1 (IgG 7 S), and E. coliβ-galactosidase (16 S). After sedimentation at 55,000 rpm at 5 °C for 5.95 h in a Beckman Spinco SW55 rotor, fractions (20 per gradient) were collected. The S proteins in gradient fractions were then immunoprecipitated and visualized by fluorography after SDS-PAGE. Sedimentation standards were identified in the fractions by enzymatic assays (HRPO by turnover of 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid substrate; IgG by immunoblotting with goat anti-human IgG:alkaline phosphatase; β-galactosidase by turnover of chlorophenol red-β-d-galactopyranoside substrate). Dithiobis(succinimidylproprionate) (DSP) (25 mm in dimethyl sulfoxide) was added at various dilutions to35S-labeled S1 in PBS (pH 7.4). After 30 min at 22 °C, reactions were quenched with 50 mm Tris-HCl (pH 7.0). The35S-labeled S1 proteins were then immunoprecipitated with N-CEACAMFc, eluted with SDS solubilizer lacking β-ME, electrophoresed on a 4–20% polyacrylamide gradient gel under reducing and non-reducing conditions, and then visualized via fluorography. vTF7.3-infected HeLa-tTA cells were lipofected with pTM1-S and with pTM1-SEFGP, alone or together, using LipofectAMINE PLUS according to manufacturer's instructions (Invitrogen). At 4 h post-lipofection, media were removed and replaced for 1 h with labeling media and then 5 h with labeling media containing 25 μCi/ml Tran35S-label. Cell monolayers were lysed with PBS-P (pH 8.5) containing 0.5% Nonidet P-40, and nuclei were pelleted by centrifugation (3000 ×g for 10 min at 4 °C). To separate 35S-labeled S1 from S2, leaving S1 associated with Sepharose beads,35S-labeled S proteins in clarified cytoplasmic extracts were captured by incubation for 4 h at 4 °C with Sepharose G:N-CEACAMFc beads, and suspensions were incubated for an additional 4 h at 37 °C before pelleting beads (3000 × g for 10 min at 4 °C). Supernatants enriched in S2 were further depleted of residual S1 by two additional cycles of incubation with fresh Sepharose G:N-CEACAMFcbeads. The final supernatants were then incubated overnight at 4 °C with Sepharose G:anti-GFP antiserum to capture S2EGFPfragments. Beads were rinsed extensively with PBS-P containing 0.5% Nonidet P-40, suspended in SDS solubilizer, and heated to 100 °C for 5 min. Dissolved proteins were visualized by immunoblot with anti-S2 mAb 10G (a gift from Drs. Stuart Siddell and Fumihiro Taguchi) (47Routledge E. Stauber R. Pfleiderer M. Siddell S.G. J. Virol. 1991; 65: 254-262Crossref PubMed Google Scholar) after SDS-PAGE. Fluorograms of immunoblots were obtained using a Molecular Dynamics Typhoon 8600 PhosphorImager. It is still unclear whether coronavirus peplomers are dimers or trimers. Vennema et al. (13Vennema H. Rottier P.J.M. Heijnen L. Godeke G.J. Horzinek M.C. Spaan W.J.M. Cananaugh D. Brown T.D.K. Coronavirus and Their Diseases. Plenum Publishing Corp., New York1990: 9-19Google Scholar) reported that MHV spikes are dimers, and Delmas and Laude (26Delmas B. Laude H. J. Virol. 1990; 64: 5367-5375Crossref PubMed Google Scholar) provided evidence for cross-linking of transmissible gastroenteritis coronavirus spikes into trimers. Noting the importance of quaternary structure in viral glycoprotein function, we decided to return to the question of S protein oligomerization in the MHV system. We initially used velocity gradient ultracentrifugation and chemical cross-linking to determine the quaternary structure of peripheral S1 fragments. We found that S1 produced independently from cDNA sedimented to an ∼9 S position on sucrose gradients (Fig. 1A). Identical results were obtained for S1 fragments that had separated from S2 (data not shown). Formulas based on isokinetic sedimentation of globular proteins indicated that the ∼9 S material would have a molecular mass of ∼200 kDa, consistent with S1 homodimers (48Young B.D. Rickwood D. Centrifugation: A Practical Approach. 2nd Ed. IRL Press, Washington D. C.1984: 127-140Google Scholar). However, elongated molecules like the coronavirus spike peplomer (49Cavanagh D. Siddell S.G. The Coronaviridae. Plenum Publishing Corp., New York1995: 73-103Crossref Google Scholar) might exhibit unusual sedimentation behavior in sucrose gradients; therefore, we further addressed quaternary structure by cross-linking35S-labeled S1 with DSP, a thiol-cleavable chemical cross-linker. Cross-linked spikes were then immunoprecipitated and electrophoresed under non-reducing and reducing conditions (Fig. 1B). S1 dimers appeared with increasing concentrations of DSP, and β-ME reduced these dimers into monomers. Extraordinarily high DSP concentrations (25 mm) did not complex35S-labeled S1 into higher order oligomers (data not shown). In previous experiments, we found that polyclonal anti-spike antibodies captured newly synthesized35S-labeled S proteins, whereas N-CEACAMFc, an immunoadhesion consisting of the N-domain of murine CEACAM1a linked to a carboxyl-terminal IgG1 Fc, did not. The 35S-labeled spikes bound N-CEACAMFc only after ∼30 min of maturation (23Krueger D.K. Kelly S.M. Lewicki D.N. Ruffolo R. Gallagher T.M. J. Virol. 2001; 75: 2792-2802Crossref PubMed Scopus (72) Google Scholar). One possible explanation for this finding was that S proteins oligomerized during the 30-min maturation process and that soluble receptors only recognized oligomers. This contention was consistent with numerous reports that glycoprotein oligomerization is required to maintain native tertiary structures (50Doms R.W. Lamb R.A. Rose J.K. Helenius A. Virology. 1993; 19: 545-562Crossref Scopus (416) Google Scholar,51Tatu U. Hammond C. Helenius A. EMBO J. 1995; 14: 1340-1348Crossref PubMed Scopus (88) Google Scholar). Therefore, we separated newly synthesized spikes by rate-zonal sedimentation through sucrose gradients prior to immunoprecipitation and detection on SDS-polyacrylamide gels. Polyclonal anti-spike serum captured a range of spike forms from ∼6 S to ∼14 S (Fig. 2, 0 hour anti-S). In contrast, N-CEACAMFc specifically immunoprecipitated ∼14 S macromolecules (Fig. 2, 0 hour N-CEACAMFc). When a 2-h chase period occurred prior to cell lysis and sedimentation, N-CEACAMFc and anti-S antiserum captured only the ∼14 S forms (Fig. 2, 2 hour panels). The two endoproteolytic cleavage products S1 (lower band) and S2 (upper band) indicated that most of the spikes had encountered a trans-Golgi-localized furin-like protease (14Sturman L.S. Ricard C.S. Holmes K.V. J. Virol. 1985; 56: 904-911Crossref PubMed Google Scholar). These findings indicate that newly synthesized S proteins form CEACAM-binding sites concomitant with their oligomerization. We next considered whether CEACAM-binding sites disappeared when S proteins dissociated into monomers. We could address this question because our S1 preparations moderately break down when incubated for 2 h at 37 °C. On sucrose gradient sedimentation, the 37 °C-treated S1 occupied two positions, ∼9 S and ∼6 S, with ∼6 S being consistent with 110-kilodalton monomers (48Young B.D. Rickwood D. Centrifugation: A Practical Approach. 2nd Ed. IRL Press, Washington D. C.1984: 127-140Google Scholar) (Fig. 3, top panel). N-CEACAMFc only precipitated the ∼9 S material (Fig. 3,bottom panel), suggesting that monomers do not contain a CEACAM-binding site. Interestingly, soluble ectodomain fragments of S2 co-sedimented with the ∼6 S S1 monomers in these gradients. Although many viral glycoproteins oligomerize through associations between integral membrane fragments (27Wilson I.A. Skehel J.J. Wiley D.C. Nature. 1981; 289: 366-373Crossref PubMed Scopus (1982) Google Scholar, 28Wiley D.C. Skehel J.J. Annu. Rev. Biochem. 1987; 56: 365-394Crossref PubMed Scopus (1161) Google Scholar, 29Weissenhorn W. Wharton S.A. Calder L.J. Earl P.L. Moss B. Aliprandis E. Skehel J.J. Wiley D.C. EMBO J. 1996; 15: 1507-1514Crossref PubMed Scopus (133) Google Scholar, 30Weissenhorn W. Dessen A. Harrison S.C. Skehel J.J. Wiley D.C. Nature. 1997; 387: 426-430Crossref PubMed Scopus (1466) Google Scholar, 31Lu M. Blacklow S.C. Kim P.S. Nat. Struct. Biol. 1995; 2: 1075-1082Crossref PubMed Scopus (671) Google Scholar, 32Bernstein H.B. Tucker S.P. Kar S.R. McPherson S.A. McPherson D.T. Dubay J.W. Lebowitz J. Compans R.W. Hunter E. J. Virol. 1995; 69: 2745-2750Crossref PubMed Google Scholar, 33Weissenhorn W. Calder L.J. Wharton S.A. Skehel J.J. Wiley D.C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6032-6036Crossref PubMed Scopus (111) Google Scholar, 34Chan D.C. Fass D. Berger J.M. Kim P.S. Cell. 1997; 89: 263-273Abstract Full Text Full Text PDF PubMed Scopus (1841) Google Scholar, 35Dutch R.E. Leser G.P. Lamb R.A. Virology. 1999; 254: 147-159Crossref PubMed Scopus (39) Google Scholar), the MHV S proteins formed dimers of peripheral S1 fragments. To delineate further the sites on S1 responsible for oligomer formation, we took advantage of th
Referência(s)