Portal de Periódicos da CAPES

A Mutational Analysis of the Baculovirus Inhibitor of Apoptosis Op-IAP

1998; Elsevier BV; Volume: 273; Issue: 51 Linguagem: Inglês

10.1074/jbc.273.51.33915

1083-351X

Domagoj Vucic, William J. Kaiser, Lois K. Miller,

Insect Resistance and Genetics

A family of antiapoptotic regulators known as inhibitors of apoptosis (IAPs) was initially identified and functionally described in baculoviruses, and IAP homologues are now known in insects, birds, and mammals. Baculovirus andDrosophila IAPs inhibit apoptosis induced byDrosophila proapoptotic proteins Reaper, HID, and GRIM and physically interact with them through their baculovirus IAP repeat (BIR) region. Here we examined the functional importance of BIR and RING finger motifs of Orgyia pseudotsugata nuclear polyhedrosis virus Op-IAP and D-IAP1 in binding to and inhibiting HID. In the absence of both the BIR1 and RING motifs, the BIR2 regions of Op-IAP and D-IAP1 were able to associate with HID and block HID-induced apoptosis. Mutation of conserved amino acid residues within the BIR and RING finger motifs revealed that the conserved residues within BIR2 were essential for Op-IAP to inhibit apoptosis. However, most of the conserved residues of the BIR2 were not required for HID binding. A region at the carboxy-proximal end of BIR2 was essential for the association of Op-IAP with HID. Thus binding to HID is necessary but not sufficient to block HID-induced apoptosis: the conserved residues within BIR2 must have an additional role in blocking apoptosis. These findings demonstrate that the region encompassing a single BIR of Op-IAP and D-IAP1 can be sufficient for physical interaction with and inhibition of apoptosis induced by HID. A family of antiapoptotic regulators known as inhibitors of apoptosis (IAPs) was initially identified and functionally described in baculoviruses, and IAP homologues are now known in insects, birds, and mammals. Baculovirus andDrosophila IAPs inhibit apoptosis induced byDrosophila proapoptotic proteins Reaper, HID, and GRIM and physically interact with them through their baculovirus IAP repeat (BIR) region. Here we examined the functional importance of BIR and RING finger motifs of Orgyia pseudotsugata nuclear polyhedrosis virus Op-IAP and D-IAP1 in binding to and inhibiting HID. In the absence of both the BIR1 and RING motifs, the BIR2 regions of Op-IAP and D-IAP1 were able to associate with HID and block HID-induced apoptosis. Mutation of conserved amino acid residues within the BIR and RING finger motifs revealed that the conserved residues within BIR2 were essential for Op-IAP to inhibit apoptosis. However, most of the conserved residues of the BIR2 were not required for HID binding. A region at the carboxy-proximal end of BIR2 was essential for the association of Op-IAP with HID. Thus binding to HID is necessary but not sufficient to block HID-induced apoptosis: the conserved residues within BIR2 must have an additional role in blocking apoptosis. These findings demonstrate that the region encompassing a single BIR of Op-IAP and D-IAP1 can be sufficient for physical interaction with and inhibition of apoptosis induced by HID. inhibitor of apoptosis baculovirus IAP repeat Reaper head involution defective Orgyia pseudotsugata nuclear polyhedrosis virus IAP Cydia pomonella granulosis virus IAP Drosophila IAP chloramphenicol acetyltransferase hemagglutinin chicken IAP. Apoptosis, or programmed cell death, is a genetically regulated mechanism that plays an important role in development and homeostasis in vertebrates and invertebrates (1Steller H. Science. 1995; 267: 1445-1449Crossref PubMed Scopus (2430) Google Scholar). Programmed cell death is also employed by host cells as a defense strategy against viral invasion (2Shen Y. Shenk T.E. Curr. Opin. Genet. Dev. 1995; 5: 105-111Crossref PubMed Scopus (309) Google Scholar). Baculoviruses use two classes of inhibitors to prevent cells from undergoing apoptosis and aborting virus infection (3Clem J.R. Miller L.K. The Baculoviruses. Plenum Publishing Corp., New York1997: 237-266Crossref Google Scholar). The baculovirusAutographa californica nuclear polyhedrosis virus encodes p35, which blocks apoptosis induced during infection of insect Sf-21 cells and by variety of other stimuli in insects, mammals, and nematodes (4Clem R.J. Fechheimer M. Miller L.K. Science. 1991; 254: 1388-1390Crossref PubMed Scopus (707) Google Scholar, 5Hay B.A. Wolff T. Rubin G.M. Development. 1994; 120: 2121-2129Crossref PubMed Google Scholar, 6Rabizadeh S. LaCount D.J. Friesen P.D. Bredesen D.E. J. Neurochem. 1993; 61: 2318-2321Crossref PubMed Scopus (175) Google Scholar, 7Sugimoto A. Friesen P.D. Rothman J.H. EMBO J. 1994; 13: 2023-2028Crossref PubMed Scopus (186) Google Scholar). p35 is a general inhibitor of caspases, a family of cysteine proteases implicated as phylogenetically conserved executioners of cell death (8Bump N.J. Hackett M. Hugunin M. Seshagiri S. Brady K. Chen P. Ferenz C. Franklin S. Ghayur T. Li P. Licari P. Mankovich J. Shi L. Greenberg A.H. Miller L.K. Wong W.W. Science. 1995; 269: 1885-1888Crossref PubMed Scopus (601) Google Scholar, 9Xue D. Horvitz H.R. Nature. 1995; 377: 248-251Crossref PubMed Scopus (438) Google Scholar, 10Salvesen G.S. Dixit V.M. Cell. 1997; 91: 443-446Abstract Full Text Full Text PDF PubMed Scopus (1936) Google Scholar). p35 is cleaved by active caspases, and the fragments remain in a stable complex with the enzyme (8Bump N.J. Hackett M. Hugunin M. Seshagiri S. Brady K. Chen P. Ferenz C. Franklin S. Ghayur T. Li P. Licari P. Mankovich J. Shi L. Greenberg A.H. Miller L.K. Wong W.W. Science. 1995; 269: 1885-1888Crossref PubMed Scopus (601) Google Scholar). The second class of baculovirus apoptotic inhibitors, IAPs1 (inhibitors of apoptosis), were first isolated from two other baculoviruses, CpGV and OpNPV, by their ability to block apoptosis induced duringp35-mutant A. californica nuclear polyhedrosis virus infection (11Crook N.E. Clem R.J. Miller L.K. J. Virol. 1993; 67: 2168-2174Crossref PubMed Google Scholar, 12Birnbaum M.J. Clem R.J. Miller L.K. J. Virol. 1994; 68: 2521-2528Crossref PubMed Google Scholar). The antiapoptotic IAPs of these viruses, Cp-IAP and Op-IAP, also block apoptosis induced by other stimuli in both insects and vertebrates (13Clem R.J. Miller L.K. Mol. Cell. Biol. 1994; 14: 5212-5222Crossref PubMed Scopus (495) Google Scholar, 14Vucic D. Seshagiri S. Miller L.K. Mol. Cell. Biol. 1997; 17: 667-676Crossref PubMed Scopus (63) Google Scholar, 15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 16Harvey A.J. Bidwai A.P. Miller L.K. Mol. Cell. Biol. 1997; 17: 2835-2843Crossref PubMed Scopus (83) Google Scholar, 17Hay B.A. Wassarman D.A. Rubin G.M. Cell. 1995; 83: 1253-1262Abstract Full Text PDF PubMed Scopus (646) Google Scholar, 18Duckett C.S. Nava V.E. Gedrich R.W. Clem R.J. Van Dongen J.L. Gilfillan M.C. Shiels H. Hardwick J.M. Thompson C.B. EMBO J. 1996; 15: 2685-2694Crossref PubMed Scopus (523) Google Scholar, 19Hawkins C.J. Uren A.G. Hacker G. Medcalf R.L. Vaux D.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13786-13790Crossref PubMed Scopus (96) Google Scholar, 20Uren A.G. Pakusch M. Hawkins C.J. Puls K.L. Vaux D.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4974-4978Crossref PubMed Scopus (447) Google Scholar). IAPs are structurally distinct from p35 and act by a different mechanism. Although p35 blocks active Sf-caspase-1, an execution-style caspase that is activated by A. californica nuclear polyhedrosis virus infection, Op-IAP blocks the processing of the pro-form of Sf-caspase-1 to its active form (21Seshagiri S. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13606-13611Crossref PubMed Scopus (145) Google Scholar). Members of the IAP family are characterized by the presence of at least one and usually two or three tandem baculovirus IAP repeat (BIR) motifs located at the amino-terminal and central portions of the protein, and most of them have a carboxyl-terminal RING finger motif. Homologues of the IAP family have also been found in animal genomes, and many appear to have antiapoptotic activity. Neuronal apoptosis inhibitory protein, one of the human IAPs, is linked to the progression of spinal muscular atrophy, which involves neuronal cell death (22Roy N. Mahadevan M.S. McLean M. Shutler G. Yaraghi Z. Farahani R. Baird S. Besner-Johnston A. Lefebvre C. Kang X. Salih M. Aubry H. Tamai K. Guan X. Ioannou P. Crawford T.O. de Jong P.J. Surh L. Ikeda J. Korneluk R.G. MacKenzie A. Cell. 1995; 80: 167-178Abstract Full Text PDF PubMed Scopus (873) Google Scholar), whereas expression of human Survivin, the smallest IAP, correlates with oncogenic transformation (23Ambrosini G. Adida C. Altieri D.C. Nat. Med. 1997; 3: 917-921Crossref PubMed Scopus (3011) Google Scholar), and ch-IAP is associated with v-rel transformation (24You M. Ku P.T. Hrdlickova R. Bose Jr., H.R. Mol. Cell. Biol. 1997; 17: 7328-7341Crossref PubMed Google Scholar). X-IAP, c-IAP1, and c-IAP2 display apoptosis-suppressive activities in response to several stimuli in mammalian cells (18Duckett C.S. Nava V.E. Gedrich R.W. Clem R.J. Van Dongen J.L. Gilfillan M.C. Shiels H. Hardwick J.M. Thompson C.B. EMBO J. 1996; 15: 2685-2694Crossref PubMed Scopus (523) Google Scholar, 20Uren A.G. Pakusch M. Hawkins C.J. Puls K.L. Vaux D.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4974-4978Crossref PubMed Scopus (447) Google Scholar, 25Liston P. Roy N. Tamai K. Lefebvre C. Baird S. Cherton-Horvat G. Farahani R. McLean M. Ikeda J.E. MacKenzie A. Korneluk R.G. Nature. 1996; 379: 349-353Crossref PubMed Scopus (870) Google Scholar) and have been shown to bind to and inhibit mammalian caspases-3, -7, and -9 in vitro (26Roy N. Deveraux Q.L. Takahashi R. Salvesen G.S. Reed J.C. EMBO J. 1997; 16: 6914-6925Crossref PubMed Scopus (1137) Google Scholar, 27Deveraux Q.L. Takahashi R. Salvesen G.S. Reed J.C. Nature. 1997; 388: 300-304Crossref PubMed Scopus (1719) Google Scholar, 28Deveraux Q.L. Roy N. Stennicke H.R. Van Arsdale T. Zhou Q. Srinivasula S.M. Alnemri E.S. Salvesen G.S. Reed J.C. EMBO J. 1998; 17: 2215-2223Crossref PubMed Scopus (1242) Google Scholar). These mammalian IAPs also associate with or influence other cellular factors or pathways: c-IAP1 and c-IAP2 are components of tumor necrosis factor signaling complex (29Shu H. Takeuchi M. Goeddel D.V. Immunology. 1996; 93: 13973-13978Google Scholar, 30Rothe M. Pan M.G. Henzel W.J. Ayres T.M. Goeddel D.V. Cell. 1995; 83: 1243-1252Abstract Full Text PDF PubMed Scopus (1056) Google Scholar), whereas X-IAP activates c-Jun N-terminal kinase 1 (JNK1) (31Sanna M.G. Duckett C.S. Richter B.W.M. Thompson C.B. Ulevitch R.J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6015-6020Crossref PubMed Scopus (117) Google Scholar). Two Drosophila IAPs, D-IAP1 and DIAP-2, inhibit apoptosis in the developing eye upon expression of Reaper (RPR) or HID (head involution-defective) genes (17Hay B.A. Wassarman D.A. Rubin G.M. Cell. 1995; 83: 1253-1262Abstract Full Text PDF PubMed Scopus (646) Google Scholar), two genetically identified inducers of apoptosis in Drosophilaembryos (32White K. Grether M.E. Abrams J.M. Young L. Farrell K. Steller H. Science. 1994; 264: 677-683Crossref PubMed Scopus (898) Google Scholar, 33Grether M.E. Abrams J.M. Agapite J. White K. Steller H. Genes Dev. 1995; 9: 1694-1708Crossref PubMed Scopus (593) Google Scholar). Baculovirus and Drosophila IAPs not only inhibit apoptosis induced by RPR-, HID-, and GRIM, a third genetically identified apoptotic inducer of Drosophila (34Chen P. Nordstrom W. Gish B. Abrams J.M. Genes Dev. 1996; 10: 1773-1782Crossref PubMed Scopus (363) Google Scholar), but they also physically interact with RPR, HID, and GRIM and alter their subcellular localization to punctate perinuclear locations, which coincide with IAP localization in Sf-21 cells (14Vucic D. Seshagiri S. Miller L.K. Mol. Cell. Biol. 1997; 17: 667-676Crossref PubMed Scopus (63) Google Scholar, 15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 35Vucic D. Kaiser W.J. Harvey A.J. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10183-10188Crossref PubMed Scopus (189) Google Scholar). RPR, HID, and GRIM share only a limited amount of sequence similarity: a stretch of 14 amino acids at the amino terminus of each protein. The amino-terminal 37 residues of HID are necessary and sufficient for the induction of apoptosis and for its binding to IAPs (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar). The region of Op-IAP containing two tandem BIR motifs, known as BIR1 and BIR2, is necessary and sufficient for binding to RPR, HID, and GRIM (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 35Vucic D. Kaiser W.J. Harvey A.J. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10183-10188Crossref PubMed Scopus (189) Google Scholar). In the case of D-IAP1, the BIR-containing region is not only sufficient for binding but also sufficient for blocking apoptosis (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 17Hay B.A. Wassarman D.A. Rubin G.M. Cell. 1995; 83: 1253-1262Abstract Full Text PDF PubMed Scopus (646) Google Scholar); the RING finger motif of this IAP appears to act as a negative regulator of its activity (17Hay B.A. Wassarman D.A. Rubin G.M. Cell. 1995; 83: 1253-1262Abstract Full Text PDF PubMed Scopus (646) Google Scholar). In contrast, both the BIR regions and the RING finger regions of the baculovirus IAPs were found to be important for their anti-apoptotic activity in the context of baculovirus infections (13Clem R.J. Miller L.K. Mol. Cell. Biol. 1994; 14: 5212-5222Crossref PubMed Scopus (495) Google Scholar) and to block apoptosis induced by actinomycin D or Doom (36Harvey A.J. Soliman H. Kaiser W.J. Miller L.K. Cell Death Differ. 1997; 4: 733-744Crossref PubMed Scopus (44) Google Scholar), another apoptotic inducer of Drosophila (16Harvey A.J. Bidwai A.P. Miller L.K. Mol. Cell. Biol. 1997; 17: 2835-2843Crossref PubMed Scopus (83) Google Scholar). Expression of only the BIR region of Op-IAP and Cp-IAP induces apoptosis in Sf-21 cells, although induction occurs relatively slowly (36Harvey A.J. Soliman H. Kaiser W.J. Miller L.K. Cell Death Differ. 1997; 4: 733-744Crossref PubMed Scopus (44) Google Scholar). In this study, we investigated the contribution of the BIR and RING finger motifs of Op-IAP to its ability to block HID-induced apoptosis. We also examined the importance of individual amino acid residues within these motifs that are conserved among IAP family members. We demonstrate that, under optimal conditions, the BIR2 of Op-IAP alone is able to block HID-induced apoptosis and associate with HID. We show that conserved residues within BIR2 are essential for anti-apoptotic activity but not inducer binding. Instead, a stretch of 17 amino acids on the carboxy-proximal end of BIR2 was found to be an essential region for both anti-apoptotic activity and physical interaction with HID. We also show that the region encompassing the second BIR of D-IAP1 is sufficient for inhibiting HID-induced apoptosis and binding HID. Spodoptera frugiperda (Lepidoptera: noctuidae) IPLB-Sf-21 (Sf-21) cells were maintained in TC-100 medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (Intergen, Purchase, NY) and 0.26% tryptose broth as described previously (37O'Reilly D.R. Miller L.K. Luckow V.A. Baculovirus Expression Vectors: A Laboratory Manual. W. H. Freeman and Co., New York1992Google Scholar). All the plasmids are derived from pHSP70PLVI+CAT, a plasmid expressing the chloramphenicol acetyltransferase (cat) gene underDrosophila hsp70 promoter (13Clem R.J. Miller L.K. Mol. Cell. Biol. 1994; 14: 5212-5222Crossref PubMed Scopus (495) Google Scholar). Plasmids expressing nontagged p35 or cat, Flag-tagged hid, and HA.11 HA-epitope (epi)-tagged Op-iap, Op-BIR, Op-RING, D-iap1, D-iap1-BIR, and D-iap1-RING were previously described (13Clem R.J. Miller L.K. Mol. Cell. Biol. 1994; 14: 5212-5222Crossref PubMed Scopus (495) Google Scholar, 15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 35Vucic D. Kaiser W.J. Harvey A.J. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10183-10188Crossref PubMed Scopus (189) Google Scholar). A plasmid expressing epi-tagged Op-IAP-BIR1 was constructed by introducing a frameshift mutation at the NotI site of Op-iap, which is located between the two BIRs. This frameshift mutant codes for 20 amino acids of nonsense before the stop codon. A plasmid expressing epi-Op-IAP-BIR2, pHSEpi-Op-IAP-BIR2VI+, was constructed by polymerase chain reaction amplification with Pfu polymerase using the primers OpIAPBIR2 (CGCGGATCCCCCGGGCCCCGCCGGCGCGGTCGGCC) and T3 with pHSOpBIRNruI (16Harvey A.J. Bidwai A.P. Miller L.K. Mol. Cell. Biol. 1997; 17: 2835-2843Crossref PubMed Scopus (83) Google Scholar) as a template. epi-OpBIR2-RING was constructed by replacing the NotI fragment of pHSEpi-Op-IAP-BIR2VI+ with the NotI fragment from pHSEpiOpIAPVI+. pHSP70PLVI+EpiD-IAP1 and pHSP70PLVI+EpiD-IAP1-BIR were digested with EcoRV and PstI, and the smallest fragments were subcloned into the PspAI andPstI sites of pHSEpiOpIAPVI+ to generate pHSP70PLVI+EpiD-IAP1-BIR2-RING and pHSP70PLVI+EpiD-IAP1-BIR2, expressing the D-IAP1 BIR2 region with or without the RING finger, respectively. The sequence encompassing the BIR1 of D-IAP1 was amplified by polymerase chain reaction with Pfu polymerase and the primers FLNDIAP1 (CACTCGAGACCCGGGATTTAAACCGCGAG) and CD1B1 (GCTCTAGATTAGGCGTATTCGGGATACTG). The resulting product was digested with PspAI and XbaI and subcloned intoPspAI and PshAI sites of pHSEpiOpBIRVI+ to generate pHSP70PLVI+EpiD-IAP1-BIR1. Site-directed mutagenesis was performed on pHSEpiOpIAPVI+ with the CLONTECHTransformer™ site-directed mutagenesis kit (CLONTECH, Palo Alto, CA) using selection primer KPNRPRNHE (CAGCAGAGTCGCTAGCGATGTAAA CGATGG) and the following mutagenic primers: OPIAPR21A (CAAAGCCGCGGCCCTAGGCACGTACAC), OPIAPG42A (CCGCATGGCCGCTAGCGCGTTCTACTAC), OPIAPC54A (CGAGGTGCGCGCCGCGTTTTGC), OPIAPW64A (GATTACGAATGCCGTACGGGGCGACGAC), OPIAPR114A (GGAAGCCGCGGCTTTGCGCACC), OPIAPC148A (GCGACAAGACCCGGGCCTTTTGCTGC), OPIAPH168A (GACGACGCGCCATGGCAGCAAGCCGCCCGCTG), OPIAPK182A (GCTGCTCGTCGCCGGCCGCGAC) to generate single and double mutations in the first and second BIRs of EpiOpIAP; OPIAPΔ106–109 (GGTCGGCGGCCTGCGCACACGGAAGCCG), OPIAPΔ132–142 (CAGCGGCCCGAAGAGCAGGGCGACAAGACGCG), OPIAPΔ143–155 (CGGATTCTTTTACACGTGCAAGGATTGGGAACCC), OPIAPΔ157–173 (GACGGCGGTCTGAAGCGCTGCGAGTACGTGC), OPIAPΔ174–190 (GCCCGCTGGTACGACGTCATGACTGAGGCGTGTG), and OPIAPBIR1RING (GCCACACGACCGCGCCCGCGACGCGGACAACG) to generate deletions within Op-iap; OPIAPC221A (GATGACCGGCTGGCCAAGATTTGCC), OPIAPH238 (GCCCTGCGGCGCCGTGGTGTGGCG), OPIAPR256A (CCCCGTTTGCGCCGGCCAGTTAG), OPIAPY266A (GGTGCGCATGGCCCAAGCGTAAC) to generate mutations in the RING of Op-iap. epi-Op-IAP-(Δ154–199) was constructed by the removal of the PshAI and NruI fragment in pHSEpiOpIAPVI+. All mutations and truncations were confirmed by DNA sequencing. Sf-21 cells plated at a density of 0.5 × 106/per 35-mm dish were transfected with recombinant plasmids. At 18 h posttransfection, cells were heat-shocked, and 8 h after heat shock, the medium was aspirated off each plate and replaced with 500-ul of phosphate-buffered saline (pH 6.2) containing 0.04% trypan blue. Viable intact cells were counted from four different fields of view at 400× magnification. The percent of nonviable cells was calculated as the difference between the number of viable cells in the cat-only transfected control (100%) and the number of viable cells in the test transfected cells. The data plotted represent three experiments ±S.D. All were performed as described recently (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 35Vucic D. Kaiser W.J. Harvey A.J. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10183-10188Crossref PubMed Scopus (189) Google Scholar). The PileUp program of the Genetics Computer Group software aligned the BIR and RING finger domains with a gap penalty of 3.0 and a gap extension penalty of 0.10. The shading of similar and identical residues was performed with the Boxshade program. GenBank/EMBL accession numbers for the sequences used were L22564 for Op-IAP, L05494 for Cp-IAP, L22858 for A. californica IAP, L49440 for D-IAP1, L49441 for D-IAP2, AF008592for Ch-IAP1, U32974 for human X-IAP, U45878 for C-IAP1, U45879 for C-IAP2, and U19251 for neuronal apoptosis inhibitory protein. To determine the minimal region of Op-IAP sufficient for inhibiting HID-induced apoptosis, we constructed a series of truncations within Op-IAP (Fig.1 A) and tested whether these truncations retained the ability to block HID-induced apoptosis. An HA.11 epitope-tagged version of Op-IAP, epi-Op-IAP, protected cells from apoptosis induced by HID as well as nontagged Op-IAP (data not shown) and was used as a template for generating truncations and other mutations of Op-IAP. Sf-21 cells were cotransfected with a plasmid expressing HID in a 1:1 ratio with plasmids expressing chloramphenicol acetyltransferase,epi-Op-IAP, or one of the epi-Op-IAP truncations. Gene expression was induced by heat shocking at 18 h posttransfection, and at 8 h after heat shock, viable cells were counted using the trypan blue exclusion method.epi-Op-IAP-BIR1, epi-Op-IAP-BIR1-RING, andepi-Op-IAP-RING did not protect cells from HID-induced apoptosis, but epi-Op-BIR2 and epi-Op-IAP-BIRs reduced HID-induced cell death by 17% (Fig. 1 B).epi-Op-BIR2-RING showed the strongest inhibitory activity of all tested Op-IAP truncations and reduced HID-induced apoptosis by more than 2-fold (Fig. 1 B). To better differentiate the anti-apoptotic abilities of the Op-IAP truncations, the ratio of transfected HID-expressing plasmid to IAP- or chloramphenicol acetyltransferase-expressing plasmids was changed from 1:1 to 1:4. The protective ability of epi-Op-IAP-BIRs andepi-Op-IAP-BIR2 became more apparent under these optimized conditions, and epi-Op-IAP-BIR2-RING was almost as efficient in blocking HID-induced apoptosis as epi-Op-IAP (Fig.1 B). Thus, all subsequent viability assays presented in this study were conducted at a 1:4 ratio of inducer to inhibitor. We have reported previously that the region of Op-IAP containing both BIR1 and BIR2 binds HID (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar). To determine which BIR(s) of Op-IAP can physically interact with HID, we coexpressed HID-Flag withepi-Op-IAP truncations, and coimmunoprecipitated, with an anti-Flag monoclonal antibody, the IAP truncations that retained the ability to bind HID. We found that all Op-IAP constructs containing BIR2 coimmunoprecipitated with Hid-Flag (Fig. 1 C, top panel). epi-Op-IAP-RING, epi-Op-IAP-BIR1, and epi-Op-IAP-BIR1-RING did not coimmunoprecipitate with Hid-Flag (Fig. 1 C, top panel), although they were efficiently expressed (Fig. 1 C, middle panel). Expression for all HA-tagged and HID-Flag constructs were confirmed in the cell lysates (Fig. 1 C). Therefore, the BIR2 region of Op-IAP is necessary and sufficient for binding HID and inhibiting HID-induced apoptosis. Amino acid sequence alignments of the BIR motifs of baculovirus, vertebrate, and invertebrate IAPs reveal six rigorously conserved residues in BIR motifs (Fig.2 A). To assess the importance of conserved amino acid residues within BIR motifs to the ability of Op-IAP to block HID-induced apoptosis, we generated a series of single- and double-point mutants as well as deletion mutants (see Fig.2 A) by site-specific mutagenesis and tested their protective activity in viability assays. Expression of the mutants was confirmed in Western blot analysis (Fig. 2 C). The four mutations in BIR1 (R21A, G42A, C54A, W64A) reduced the protective potency ofepi-Op-IAP by approximately 2-fold (Fig. 2 D). However, mutations R114A, C148A, or H168A in BIR2 completely abrogated the ability of Op-IAP to block HID-induced apoptosis (Fig.2 D). Constructs that combined mutations in BIR1 and BIR2 (R21R114A, C54C148A) (Fig. 2, A and C) also failed to block HID-induced apoptosis (Fig. 2 D). Although the BIRs show significant homology to each other, the carboxy-proximal BIR of all IAPs differ from the more amino-proximal BIRs in that there is a conserved lysine seven amino acids downstream of the last cysteine of the consensus motif (Fig. 2 A). Mutation of that lysine to alanine, K182A, did not affect the anti-apoptotic ability of epi-Op-IAP (Fig. 2 D). One region of conserved homology between the baculovirus andDrosophila IAPs found outside the BIRs is a PXYA motif located only eight amino acids upstream of the BIR2 of Op-IAP (not shown in Fig. 2 A). A mutant with a deletion of these four amino acids in epi-Op-IAP, Δ(106–109), failed to block HID-induced apoptosis (Fig. 2 D). Because the BIR2 of Op-IAP was observed to interact with HID, we also constructed an additional series of contiguous deletions spanning the length of the BIR2 (Fig. 2 A). These deletion mutants did not block HID-induced apoptosis (Fig. 2 D). All deletions and point mutations within BIR2 other than K182A abrogated the ability ofepi-Op-IAP to block HID-induced apoptosis. Alignments of the RING finger motifs found in IAPs reveal 11 rigorously conserved amino acid residues. Four point mutations were generated within the RING finger of epi-Op-IAP (Fig. 2 B). We mutated the conserved amino acid residues important for the cross-brace structure believed to coordinate two zinc ions, Cys-221 and His-238, to alanine (Fig. 2 B). We also mutated R256 to alanine; this amino acid residue is conserved in RING fingers of all IAPs except X-IAP (Fig. 2 B). Finally, we chose to mutate Y266, a conserved (Tyr or Phe) amino acid found in IAPs with a RING finger, to alanine (Fig. 2 B). The ability of C221A, H238A, and R256A mutants to block HID-induced apoptosis was reduced 2-fold (Fig. 2 D) and was comparable with epi-Op-IAP-BIRs lacking the entire RING finger motif (Fig. 1 B). The Y266A mutation, which changed an amino acid residue with no apparent importance in metal ion coordination, had the most severe effect on the antiapoptotic activity of epi-Op-IAP (Fig.2 D). To determine whether the point mutations or deletions within Op-IAP affect the ability of Op-IAP to physically interact with HID, we coexpressed all deletions and point mutations with HID-Flag and determined if anti-Flag antibodies could coimmunoprecipitate the epi-Op-IAP mutants. All of the point mutations in BIR1 or the RING finger coprecipitated with HID-Flag (Fig.3 and data not shown). Despite their inability to block HID-induced apoptosis, all point mutations in the BIR2 also coprecipitated with HID-Flag (data not shown). We also tested mutants of epi-Op-IAP that possess mutations in both BIRs (R21R114A, C54C148A) (Fig. 2 A) and found that these double mutants of epi-Op-IAP associated with HID-Flag as well (Fig.3). We then tested whether or not epi-Op-IAP with deletions within the BIR2 could coprecipitate with HID. Deletions Δ132–142, Δ143–155, and Δ157–173 retained the ability to physically interact with HID-Flag, but deletion Δ154–198 and the smaller deletion of Δ174–190 did not coimmunoprecipitate with HID-Flag, suggesting that amino acids 174 to 190 represent a region of Op-IAP essential for the physical interaction with HID. To determine the region of D-IAP1 responsible for inhibiting HID-induced apoptosis, we created a series of truncations within epi-D-IAP1 (Fig.4 A) and tested whether these truncations of epi-D-IAP1 were still able to block HID-induced apoptosis. As expected, epi-D-IAP1 andepi-D-IAP1-BIRs inhibited HID apoptosis (Fig.4 B). The constructs expressing the first BIR of D-IAP1 and the spacer region between BIR1 and BIR2 (epi-D-IAP1-BIR1) and the construct expressing the RING finger of D-IAP1 and most of the spacer region between BIR2 and the RING finger (epi-D-IAP1-RING), did not block HID-induced cell death (Fig. 4 B). The constructs expressing BIR2 and the flanking spacer regions of epi-D-IAP1 (epi-D-IAP1-BIR2) or this region with the RING finger attached (epi-D-IAP1-BIR2-RING) were efficient in blocking HID-induced apoptosis (Fig. 4 B). We have reported previously that the region encompassing both BIRs of D-IAP1 can bind HID (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar). To further narrow the region of interaction, we coexpressed HID-Flag with HA.11 epitope-tagged versions of the D-IAP1 truncations and coimmunoprecipitated with anti-Flag antibodies the epi-D-IAP1 truncations that retained the ability to bind HID. All epi-D-IAP1 constructs containing BIR2 coimmunoprecipitated with Hid-Flag (Fig. 4 C). D-IAP1-BIR1 and D-IAP1-RING did not coimmunoprecipitate with HID-Flag, although they were efficiently expressed (Fig. 4 C). Expression for all HA-tagged and HID-Flag constructs were confirmed in the cell lysates (Fig. 4 C). Because most of the flanking regions contained within the BIR2 construct are also contained in either BIR1 or the RING finger constructs that do not bind HID, it appears that the BIR2 region of D-IAP1 is responsible for binding HID and inhibiting HID-induced apoptosis. We have investigated the functional importance of individual BIRs and the RING finger motif of baculovirus Op-IAP andDrosophila D-IAP1 in interacting with and inhibiting apoptosis induced by HID. Our findings demonstrate that the region encompassing the second BIR of both Op-IAP and D-IAP1 is sufficient for association with HID and for inhibition of HID-induced apoptosis. Despite its extensive amino acid sequence similarity to BIR2, the BIR1 of Op-IAP and D-IAP1 was dispensable for their interaction with HID and antiapoptotic activity. Similar studies have shown that the BIR2 is the minimal caspase-binding and -inhibiting region of X-IAP (38Takahashi R. Deveraux Q. Tamm I. Welsh K. Assa-Munt N. Salvesen G.S. Reed J.C. J. Biol. Chem. 1998; 273: 7787-7790Abstract Full Text Full Text PDF PubMed Scopus (526) Google Scholar). In addition, Survivin, a human IAP family member with a single BIR is capable of suppressing apoptosis in human tissues (23Ambrosini G. Adida C. Altieri D.C. Nat. Med. 1997; 3: 917-921Crossref PubMed Scopus (3011) Google Scholar). The purpose for multiple tandem BIRs is not clear, but individual BIRs within each IAP may have different binding specificities and functions. Like its cellular counterparts, our results show that the BIR region of baculovirus Op-IAP is capable of inhibiting apoptosis in the absence of the RING finger motif. Previous studies found that the RING finger was important in blocking baculovirus-induced apoptosis (13Clem R.J. Miller L.K. Mol. Cell. Biol. 1994; 14: 5212-5222Crossref PubMed Scopus (495) Google Scholar) and, when expressed individually, the BIR regions of baculovirus IAPs were unable to inhibit apoptosis induced by actinomycin D and Doom (36Harvey A.J. Soliman H. Kaiser W.J. Miller L.K. Cell Death Differ. 1997; 4: 733-744Crossref PubMed Scopus (44) Google Scholar). We found that the BIR region of Op-IAP was efficient in blocking HID-induced apoptosis under optimal conditions. Because the BIR region of Op-IAP induces apoptosis by 24 h after induction of expression (36Harvey A.J. Soliman H. Kaiser W.J. Miller L.K. Cell Death Differ. 1997; 4: 733-744Crossref PubMed Scopus (44) Google Scholar), we examined its protective ability at earlier times, when HID-induced apoptosis was at its peak (8 h). We also optimized the conditions of viability assays by adjusting the amounts of inducer (HID) to inhibitor (IAPs) to the levels where the protective activity of various Op-IAP truncations were more pronounced. Similar studies indicate that the BIR2 of Op-IAP can also block RPR- and Grim-induced apoptosis when tested under the same conditions (data not shown). However, attempts to rescue p35-mutant Autographa californica nuclear polyhedrosis virus with the BIR region of Op-IAP were unsuccessful, and Op-IAP-BIRs was also unable to block apoptosis induced by actinomycin D (data not shown). Similarly, D-IAP1-BIRs were unable to or were inefficient at blocking actinomycin D-induced cell death in Sf-21 cells (36Harvey A.J. Soliman H. Kaiser W.J. Miller L.K. Cell Death Differ. 1997; 4: 733-744Crossref PubMed Scopus (44) Google Scholar). It is possible that these pro-apoptotic signals are too potent for Op-IAP-BIRs or interact with Op-IAP in a different manner than HID, RPR, or Grim. Our mutational analysis examined the importance of conserved amino acid residues within BIR and RING finger motifs for the anti-apoptotic activity of Op-IAP. Mutations of conserved amino acid residues in BIR2 of Op-IAP completely abrogated the ability of Op-IAP to suppress cell death initiated by HID, suggesting that the integrity of the conserved structure of BIR2 is essential for Op-IAP to serve as an inhibitor of apoptosis. Even though BIR1 and the RING finger did not protect Sf-21 cells from HID-induced apoptosis or bind HID in the absence of BIR2, mutations of conserved residues in BIR1 and the RING finger diminished the anti-apoptotic activity of Op-IAP. BIR1 and the RING finger of Op-IAP may enhance the activity of BIR2 by strengthening the association with HID or other factors. Point mutations in the RING finger and BIR1 did not disrupt the ability of Op-IAP to interact with HID. Surprisingly, all point mutations generated in BIR2 retained the ability to associate with HID even though most of these BIR2 mutants completely failed to block HID-induced apoptosis. Therefore, binding to the inducer alone is probably not sufficient for Op-IAP to prevent HID from delivering its apoptotic signal to downstream effectors of the cell death machinery. A series of contiguous deletions in BIR2 revealed that the majority of BIR2 is not required for HID binding but that a region at the carboxy-proximal end of BIR2, amino acids 174–190 of Op-IAP are essential for the association of Op-IAP with HID. These residues may constitute the HID-interaction region or deletion of these 17 amino acids might alter the structure of Op-IAP in such a way as to prevent its association with HID. How the phylogenetically conserved residues of the remainder of the BIR2 contribute to the anti-apoptotic activity of IAPs remains to be determined. We have previously shown that IAPs redirect HID, RPR, and Grim to distinct perinuclear locations (15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 35Vucic D. Kaiser W.J. Harvey A.J. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10183-10188Crossref PubMed Scopus (189) Google Scholar), and it may be that conserved BIR residues participate in this or other steps in silencing inducer signaling. We thank Somasekar Seshagiri for helpful discussions and Brian Doss for help with constructing pHSEpiOp-IAPVI+C221A.