Portal de Periódicos da CAPES

Transcription analysis of differentially expressed genes in insecticide-resistant Aedes aegypti mosquitoes after deltamethrin exposure

2010; Wiley; Volume: 35; Issue: 1 Linguagem: Inglês

10.1111/j.1948-7134.2010.00077.x

1948-7134

Panida Lertkiatmongkol, Sirikun Pethuan, Nuananong Jirakanjanakit, Pornpimol Rongnoparut,

Insect and Pesticide Research

Aedes aegypti mosquitoes are resistant to various insecticides, including pyrethroids, throughout Thailand. We previously reported that Ae. aegypti from Mae Wong district, Nakhon Sawan Province in north-central Thailand, were resistant to insecticides, including pyrethroids (deltamethrin and permethrin), organophosphates and carbamates, and that high levels of detoxification enzymes were present. In the present study we used the method of suppression by subtractive hybridization to determine differential expression of genes in Mae Wong Ae. aegypti that survived the exposure to increasing doses (∼1.5 – 2 × 10−5M) of deltamethrin beyond the diagnostic dose compared to unexposed mosquitoes. Screening of 350 cDNA clones from the suppression subtractive library by cDNA array hybridization revealed that 58 clones were over-expressed in the mosquito that survived high dose deltamethrin. The over-expressed cDNA insert sequences corresponded to 11 functional genes, five hypothetical protein genes, and five sequences of unknown function that could be located on the supercontig of the Ae. aegypti genome. The functional genes are those coding for cuticular proteins, muscle proteins, proteins related to controlling the release of synaptic vesicles, and other genes such as heat shock protein and small subunit ribosomal RNA. Over-expression of tomosyn and myosin light chain kinase genes was verified using a semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), confirming their increased expression in response to deltamethrin exposure in insecticide-resistant Ae. aegypti. Dengue fever and dengue hemorrhagic fever continue to be the most prevalent arboviral diseases, causing morbidity and mortality among two-fifths of the world's population including Southeast Asia. The principal vector of dengue fever in Southeast Asia is Aedes aegypti. In Thailand, there has been a 40% rise in cases reported from 2006 to 2007 and an additional 16% from 2007 to 2008. An important conventional approach to combat the infection is to control Ae. aegypti with synthetic insecticides such as pyrethroids, organophosphates, and carbamates. In Thailand, delta-metrin, either alone or in combination with other synthetic pyrethroids, has been the major adulticide used in the control of dengue vectors over the last decade. In addition, household insecticide products (aerosols, mosquito coils, mats, and liquid forms) containing pyrethroids have been widely used throughout the country (Paeporn et al. 1996). Deltamethrin pyrethroid insecticides affect voltage-sensitive sodium channels by slowing both the activation and inactivation properties of the channels, leading to a stable hyperexcitable state (Soderlund and Bloomquist 1989, Ginsburg and Narahashi 1993, Soderlund et al. 2002). After exposure in organisms, deltamethrin keeps sodium channels open and the amplitude of sodium current remains stable until the level of hyperexcitability overwhelms the capacity of the cell to maintain sodium pump activity and causes an influx of calcium ions (Vijverberg and Deweille 1985). We previously studied insecticide susceptibility among Ae. aegypti and Ae. albopictus mosquitoes in different regions of Thailand (Yaicharoen et al. 2005, Jirakanjanakit et al. 2007). The study showed widespread insecticide resistance in Ae. aegypti across different parts of Thailand. The mosquitoes in the Mae Wong district, Nakhon Sawan province (north-central part of Thailand) showed resistance to insecticides including pyrethroids (deltamethrin and permethrin), organophosphates, and carbamates. The possible mechanism that enables the mosquitoes to effectively sequester insecticides is the enhancement of the detoxification system at the molecular level (Oakeshott et al. 2003, Hemingway et al. 2004). Using biochemical analysis, we observed a significantly high amount of enzymatic activities of mixed function oxidases, nonspecific esterases, and glutathione-S-transferases (GSTs) in Mae Wong mosquitoes compared to the susceptible Bora (French Polynesia) strain (Pethuan et al. 2007). The results suggested that high activities of detoxifying enzymes could be responsible for pyrethroid resistance in the Mae Wong sample and could complicate the Ae. aegypti mosquito control programs in the area. In the present study, the Mae Wong Ae. aegypti were exposed to increasing doses of deltamethrin (∼1.5–2×10-5 M) at beyond the diagnostic dose to select for the resistant mosquitoes that could survive such doses and determine any altered gene expression compared with unexposed mosquitoes. The suppression subtractive cDNA hybridization (SSH) method was used to identify differentially expressed cDNAs in the surviving adult mosquitoes subjected to deltamethrin selection compared with the unexposed mosquitoes that have been maintained in the laboratory. The results showed that there was an increased expression of genes encoding cuticular proteins, muscle proteins, and genes related to the control of neurotransmitter release that may enable the mosquito to tolerate high dose deltamethrin neurotoxicity. This is the first report showing increased expression of tomosyn and MLCK genes in the insecticide resistant Ae. aegypti after deltamethrin exposure. Aedes (Stegomyia) aegypti mosquitoes were collected from Mae Wong district, Nakhon Sawan province, Thailand, in 2004. This mosquito strain has been found to be resistant to various insecticides including deltamethrin (Jirakanjanakit et al. 2007). To observe the highest concentration of deltamethrin that the mosquitoes could tolerate, the adult mosquitoes were exposed to different concentrations of deltamethrin-treated paper in the laboratory to select for the survivors as described by Jirakanjanakit et al. (2007). The highest concentration that allowed survival of 5–10% was 0.75% deltamethrin (∼1.5 × 10−5 M, 12.5-fold of diagnostic dose at 0.06%). The survivors were exposed to 0.75% deltamethrin for three generations, thereafter with 1% deltamethrin (∼2 × 10−5 M) for three further generations, providing approximately 25% of the survivors. The survivors were immediately subjected to total RNA isolation. The unexposed mosquitoes were maintained at the same generation for comparison. These remained at similar levels of insecticide susceptibility as reported by Jirakanjanakit et al. (2007). Mosquitoes were maintained under laboratory conditions at 28° C and 70–80% RH as described previously (Jirakanjanakit et al. 2007). Total RNA was isolated from six adult mosquitoes per preparation of deltamethrin-exposed and unexposed mosquitoes using NucleoSpin® RNA II (Macherey-Nagel, PA, U.S.A.). Total RNA quantity and quality was assessed by UV-Visible2501 Shimadzu. Double-stranded cDNAs were synthesized from 1.2 μg of total RNA of each sample by PCR-Select™ cDNA Subtraction Kit (BD Biosciences, CA, U.S.A.) following the manufacturer's instructions. Synthesized cDNAs were digested with RsaI to yield small blunt-ended fragments. For subtraction, deltamethrin-exposed mosquitoes were used as a tester and unexposed mosquitoes were used as a driver. Consequently, cDNAs of deltamethrin-exposed mosquitoes were ligated with adaptors 1 and 2 separately and subtracted with cDNAs of unexposed mosquitoes at a 1:10 ratio. The remaining deltamethrin-exposed mosquito cDNAs from the first subtraction were continued with a second subtraction by hybridizing single-stranded cDNAs with adaptors 1 and 2. Only double-stranded hybrids with adaptors 1 and 2 were polymerase chain reaction (PCR)-amplified with primers corresponding to adaptors 1 and 2 using iTaq polymerase (iNtRon Biotechnology, Gyeonggi-do, Korea). The PCR products of differentially expressed cDNAs of deltamethrin-exposed mosquitoes were ligated into pGem®-T Easy (Promega, WI, U.S.A.). The library of expressed cDNAs was constructed in E. coli XL1-Blue growing in Luria-Bertani agar medium with ampicillin and bromo-chloro-indolyl-galactopyranoside (X-gal). Reverse subtraction was performed by using unexposed mosquito cDNAs as a tester and deltamethrin-exposed mosquito cDNAs as a driver. Detection of subtracted cDNA expression fragments was done by using DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Mannheim, Germany). Differentially expressed fragments from subtraction were amplified with M13 primers, and PCR products were spotted onto Nytran SuperCharge (Whatman® Schleicher & Schuell Bioscience, NH, U.S.A.). PCR products were spotted onto Nytran in an equal amount to establish four parallel cDNA arrays. Four types of probes were generated by tagging cDNAs of unsubtracted deltamethrin-exposed mosquitoes, unsubtracted unexposed mosquitoes, forward subtraction, and reverse subtraction with digoxigenin (DIG), as described by the manufacturer. The membrane was hybridized with each type of probe. A signal was detected by enzyme immunoassay with alkaline phosphatase. The intensity of the signal was quantified using Quantity One® software (Bio-Rad, CA, U.S.A.). Potential cDNA clones obtained from the forward subtraction library that were equal to or more than two-fold up-regulation in deltamethrin-exposed mosquitoes compared to unexposed mosquitoes were subjected to further analysis. The reverse subtraction upon hybridization could not obtain a potential signal and was not processed further. Plasmids of these clones were extracted with NucleoSpin® (Macherey-Nagel, PA, U.S.A.), adjusted to 100 ng/ml, and subjected to DNA sequencing employing a Macrogen sequencing service. Sequences were analyzed by utilizing a tblastx algorithm available on VectorBase to locate the sequences on supercontig in Ae. aegyti genome and obtained possible amino acid sequences with the correct reading frame. Nucleotide sequences of the clones were identified with a blastn algorithm on the National Center for Biotechnology Information (NCBI) and VectorBase, while translated amino acid sequences were analyzed with a blastp algorithm available on the NCBI and Expert Protein Analysis System (ExPAsy). Clones were annotated based on the lowest E-value. Up-regulation of groups of clones that share 97–100% identity was evaluated with a paired t-test at a 95% confidence interval. Based on SSH data, tomosyn and myosin light chain kinase (MLCK) were further subjected to semi-quantitative reverse-transcription polymerase chain reaction (RT-PCR). The total RNA of deltamethrin-exposed and unexposed mosquitoes was prepared biologically independent from SSH. cDNAs were synthesized by using SuperScript® III RNase-H reverse transcriptase (InvitrogenTM, CA, U.S.A.). The conserved region of actin GenBank accession numbers AY432896, AY432905, and AY432900 was used as an internal standard. PCR primers for amplification of actin, tomosyn, and MLCK genes were as follows: actin-f (5′ CAGAAGCTCTCTTCCAGCCA 3′) and actin-r (5′ ACTCCTGCTTGGAAATCCACA 3′); tomosyn-f (5′ GCTTGGAGAGTTGTATGTGG 3′) and tomosyn-r (5′ CCTCTAGTTGACTCAGCTTG 3′); MLCK-f (5′ GGTATCCGGCAATCCAGTTC 3′) and MLCK-r (5′ CAGAGTCTTGTTCCGAGTCAG 3′). Primers of tomosyn and MLCK were designed based on annotated clones from SSH. PCR was manipulated with iTaq polymerase (iNtRon Biotechnology, Gyeonggi-do, Korea) and was carried out in the MiniCyclerTM PTC-150 (MJ Research, MA, U.S.A.). Expected sizes of tomosyn, MLCK, and actin were 312 basepairs (bp), 140 bp, and 269 bp, respectively. PCR thermal cycles were 94° C for 1 min followed by a predetermined number of PCR cycles, consisting in each cycle of 60° C for 1 min and 72° C for 1 min. PCR products were gel electrophoresed in a 0.5x TBE/1.2% agarose gel and visualized with UV light after staining with ethidium bromide. The RT-PCR band intensities were quantified using Quantity One® software (Bio-Rad, CA, U.S.A.). A comparison of tomosyn and MLCK expression levels between those of deltmethrin-exposed and unexposed mosquitoes was done after normalizing mean band intensities of three independent experiments with actin band intensities. The statistical significance of the differential expression between deltamethrin-exposed and unexposed mosquitoes was determined by a paired t-test. A total of 350 clones were obtained upon suppression subtraction using cDNAs from deltamethrin-exposed mosquitoes as testers and that of unexposed mosquitoes as drivers. The size of suppression subtracted inserted fragments ranged from 230–700 bp determined by PCR amplification of the pGem®-T Easy plasmid inserts. Upon hybridization of PCR-amplified product arrays of the 350 plasmids with different cDNA probes prepared from the deltamethrin-exposed and unexposed mosquitoes and subtracted samples, signals from 58 clones were equal to or more than two-fold over-expressed in deltamethrin-exposed survivors compared to unexposed mosquitoes. The cDNA inserts were subjected to DNA sequencing on both strands. Using NCBI BLAST and Ae. aegypti VectorBase BLAST programs, similarities of the clone sequences to the described database were obtained. The sequences of 58 cloned cDNAs revealed that some of the cDNAs represented independent clones of the same gene as shown in Table 1. For example, all 11 cDNA clones comprising MLCK are 99% homologous to each other and are most likely transcribed from the same gene. As summarized in Table 1, sequences from 36 clones corresponded to 11 functional genes, and eight clones were annotated as five hypothetical proteins. There were 14 clones of unknown function that could be located on the supercontig of the Ae. aegypti genome retrieved from the VectorBase database. Of the 11 functional genes, AY988440, XM_001655910, and XM_001650671 sequences, coding for small subunit ribosomal RNA gene, tropomyosin, and novex -3, were more than six-fold over-expressed upon deltamethrin treatment. The XM_001656550 sequence belonging to the RR1 cuticular protein Anopheles gambiae homolog contained two groups of similar sequences; the first group containing 11 cloned sequences was on average more than seven-fold up-regulated and one other RR1 cuticular protein homolog sequence (clone 238) was over three-fold up-regulated. Four cDNA sequences, including XM_001650669, XM_001652318, XM_001655293, and XM_001658703 sequences coding for MLCK, tomosyn protein, high mobility group non-histone protein, and glutathione-S-transferase theta, were found to be over-expressed an average of four- to five- fold in deltamethrin-exposed compared to unexposed mosquitoes. The other XM_001653094, XM_001654708, and XM_001654707 sequences with an approximately three-fold elevated expression corresponded to the heterogeneous nuclear ribonucleoprotein 27c, heat shock protein, and vacuolar ATP synthase 16kDa proteolipid subunit. To further verify mRNA over-expression of the candidate cDNA inserts obtained by SSH, expression levels of the tomosyn and MLCK genes that have not shown increased expression in the insecticide resistant mosquitoes were examined with semi-quantitative RT-PCR (Figure 1). To semi-quantitatively determine expression levels, the average band intensity ratio of tomosyn and MLCK RT-PCR products was measured and normalized with that of actin genes as shown in Table 2. The results demonstrated that tomosyn expression levels were elevated over two-fold in deltamethrin-exposed survivors compared to unexposed mosquitoes (p = 0.0015), and the expression level of MLCK was over two-fold higher in deltamethrin-exposed mosquitoes (p = 0.0394). Thus, levels of expression determined by SSH could be overestimated compared with the semi-quantitative RT-PCR method. However, the over-expression ratio obtained by semi-quantitative RT-PCR was in agreement with data from the SSH method, and the repetition of clones containing identical sequences shown in Table 1 could reflect an over-expression of the same gene. Expression of tomosyn, myosin light chain kinase (MLCK), and actin mRNAs. Total RNA templates isolated from deltamethrin-exposed and unexposed Ae. aegypti were RT-PCR amplified with specific primers for the three genes and expression levels were compared. Lane M is 100 bp ladder marker. Lanes 1–6 are tomosyn unexposed, tomosyn deltamethrin-exposed, MLCK unexposed, MLCK deltamethrin-exposed, actin unexposed, and actin deltamethrin-exposed samples, respectively. We investigated the genes that were differentially expressed in insecticide-resistant Ae. aegypti from the Mae Wong population after high-dose deltamethrin exposure using the SSH method. Since the exposed mosquitoes originated from the unexposed parent Mae Wong population, they were thus similar in genetic background. Therefore, any cDNA sequences with differential expression obtained could reflect resistance from high-dose deltamethrin toxicity. However, although not included in the scope of this study, there was a limited detection of the cDNA sequences that play an important role in the cause of deltamethrin resistance in the Mae Wong population. Several studies have reported up-regulation of cytochrome P450 enzymes and GSTs in insecticide-resistant mosquitoes, including An. stephensi selected with permethrin (Vontas et al. 2007) and An. gambiae resistant/exposed to permethrin (Müller et al. 2007, Awolola et al. 2009). Induction of cytochrome P450 enzyme activities was also observed in Ae. aegypti exposed to permethrin, fluoranthene, and copper (Poupardin et al. 2008), but SSH of permethrin-treated Ae. aegypti did not show significant up-regulation of detoxification enzyme genes (Pridgeon et al. 2009). In this study we did not detect differential expression of detoxification genes, possibly due to limitations of methodology and different responses of insecticide-resistant mosquitoes after high-dose deltamethrin exposure. A mechanism of resistance found in insecticide-resistant An. stephensi and pyrethroid-resistant An. gambiae mosquitoes could be the reduction of the insecticide penetration rate by high expression levels of cuticular protein genes resulting in a thickening of the insect cuticle (Vontas et al. 2007, Awolola et al. 2009). DDT-resistant Drosophila also showed an elevated structural constituent of cuticle activity (Pedra et al. 2004), while environmental stresses can induce expression of cuticular protein genes in Leptinotarsa decemlineata (Zhang et al. 2008). In this study, the over-expression of cuticular protein genes in deltamethrin-exposed mosquitoes was identified. Short-term treatment of permethrin against a pyrethroid-resistant strain of An. gambiae has shown an over-expression of insect cuticle protein compared to permethrin-untreated mosquitoes (Vontas et al. 2005). The nervous system is the main target of insecticides, such as the pyrethroids that alter functional properties of sodium and calcium channels (Soderlund and Bloomquist 1989, Zlotkin 1999). In this study, the results of up-regulation of tomosyn, MLCK, and vacuolar ATP synthase 16 kDa proteolipid subunit genes in deltamethrin-exposed mosquitoes could be an indication of their additional adaptation to deltamethrin neurotoxicity. Increasing expression of MLCK could mediate proper mobilization of synaptic vesicles at presynaptic terminals, while increased tomosyn expression down-regulated the number of fusion-competent vesicles as previously reported (Yizhar et al. 2004) and ATP synthases participated in synaptic vesicle fusion via binding to t-SNARE proteins (Hiesinger et al. 2005). On the other hand, ATP synthases could play other biological roles such as providing a supply of energy. Using MLCK inhibitors on synaptic transmission in acute mouse brain stem slices, Srinivasan et al. (2008) discovered that MLCK plays a key role in controlling releasable vesicles. Together, this could help mosquitoes respond to increased calcium influx effects and neurotransmitter release affected by neurotoxic deltamethrin. A study using SSH and cDNA macroarray with pyrethroid-resistant Culex quinquefasciatus mosquito revealed the up-regulation of a set of genes, including those involving vesicular and molecular transport and neuronal survival (Liu et al. 2007). Interestingly, Cx. quinquefasciatus mosquitoes are resistant to pyrethroids by multiple resistance mechanisms, including detoxification and target site insensitivity (Xu et al. 2005, 2006). In a deltamethrin-resistant Cx. pipiens pallens strain, over-expression of myosin regulatory light chain (MRLC) protein is suggested to play a role in protecting mosquitoes (Yang et al. 2008). Moreover, studies of insecticide-resistant An. stephensi and An. gambiae observed down-regulation of sodium/potassium/calcium exchanger protein homologs, perhaps to regulate proper intracellular calcium concentration at the presynaptic junction in response to the neurotoxic effects of pyrethroids (Vontas et al. 2005, 2007). These results are consistent with the data we obtained for tomosyn and MLCK showing increased gene expression upon insecticide exposure. Alternatively MLCK, tropomyosin, and novex-3 (titin isoform) could indicate their possible involvement at the neuromuscular junction with flight muscles. In Drosophila, genes involved in muscle function were elevated when exposed to pepper Piper nigrum extracts, where toxic effects caused uncoordination (Jensen et al. 2006). In insecticide-resistant An. stephensi, myosin light chain alkali, troponin C isoforms 1 and 2, tropomyosin, and flightin were found to be over-expressed (Vontas et al. 2007). Other over-expressed protein genes that could be associated with a response to the neurotoxic effects of deltamethrin included XM_001661393 and XM_001649545 sequences that contained domains coding for the SOX transcription factor and the Drosophila ortholog beta-1,4-mannosyltransferase. Group B Drosophila SOX proteins are present in the developing central nervous system and could play an essential role in embryogenesis and neural specification (Sanchez-Soriano and Russell 1998, Wilson and Dearden 2008). The Drosophila beta-1,4-mannosyltransferase is predicted to be in-volved in glyco-sphingolipid biosynthesis and is required for a compartment boundary between lamina glia and lobula cortex. It is also implicated in epithelial development and as a component of a differential oocyte-follicle cell adhesive system (Wandall 2003). Other genes that were found to be increasingly expressed in this study included homologues of genes, including heat shock protein, ribosomal genes, heterogeneous nuclear ribonucleoprotein, and GST theta, but their exact roles in response to deltamethrin exposure are not known. The up-regulated genes reported here could be the response of Ae. aegypti to the neurotoxic effects of deltamethrin. The up-regulated tomosyn and MLCK genes not previously found to be associated with insecticide resistance in Ae. aegypti were identified. The increased expression of cuticular protein genes, genes responding to deltamethrin neurotoxic effects, and high activities of detoxification enzymes could together allow mosquitoes to effectively adapt and survive high-dose insecticide toxicity. Further experiments should include functional studies and examine the potential role of these candidate genes operating in Ae. aegypti. This work was supported by the Thailand Tropical Diseases Research Program (T2).