A Locus on Chromosome 7 Determines Dramatic Up-Regulation of Osteopontin in Dystrophic Cardiac Calcification in Mice
2004; Elsevier BV; Volume: 164; Issue: 4 Linguagem: Inglês
10.1016/s0002-9440(10)63224-5
ISSN1525-2191
AutoresZouhair Aherrahrou, Susanne B. Axtner, Piotr Kaczmarek, Alexandra Jurat, Susanne Korff, Lars C. Doehring, Dieter Weichenhan, Hugo A. Katus, Boris Ivandic,
Tópico(s)Dermatological and Skeletal Disorders
ResumoCalcification of necrotic tissue is frequently observed in chronic inflammation and atherosclerosis. A similar response of myocardium to injury, referred to as dystrophic cardiac calcinosis (DCC), occurs in certain inbred strains of mice. We now examined a putative inhibitor of calcification, osteopontin, in DCC after transdiaphragmal myocardial freeze-thaw injury. Strong osteopontin expression was found co-localizing with calcification in DCC-susceptible strain C3H/HeNCrlBr, which exhibited low osteopontin plasma concentrations otherwise. Osteopontin mRNA induction was 20-fold higher than in resistant strain C57BL/6NCrlBr, which exhibited fibrous lesions without calcification and little osteopontin expression. Sequence analysis identified several polymorphisms in calcium-binding and phosphorylation sites in osteopontin cDNA. Their potential relevance for DCC was tested in congenic mice, which shared the osteopontin locus with C57BL/6NCrlBr, but retained a chromosomal segment from C3H/HeNCrlBr on proximal chromosome 7. These mice exhibited strong osteopontin expression and DCC comparable to C3H/HeNCrlBr suggesting that a trans-activator of osteopontin transcription residing on chromosome 7 and not the osteopontin gene on chromosome 5 was responsible for the genetic differences in osteopontin expression. A known osteopontin activator encoded by a gene on chromosome 7 is the transforming growth factor-β1, which was more induced (3.5×) in C3H/HeNCrlBr than in C57BL/6NCrlBr mice. Calcification of necrotic tissue is frequently observed in chronic inflammation and atherosclerosis. A similar response of myocardium to injury, referred to as dystrophic cardiac calcinosis (DCC), occurs in certain inbred strains of mice. We now examined a putative inhibitor of calcification, osteopontin, in DCC after transdiaphragmal myocardial freeze-thaw injury. Strong osteopontin expression was found co-localizing with calcification in DCC-susceptible strain C3H/HeNCrlBr, which exhibited low osteopontin plasma concentrations otherwise. Osteopontin mRNA induction was 20-fold higher than in resistant strain C57BL/6NCrlBr, which exhibited fibrous lesions without calcification and little osteopontin expression. Sequence analysis identified several polymorphisms in calcium-binding and phosphorylation sites in osteopontin cDNA. Their potential relevance for DCC was tested in congenic mice, which shared the osteopontin locus with C57BL/6NCrlBr, but retained a chromosomal segment from C3H/HeNCrlBr on proximal chromosome 7. These mice exhibited strong osteopontin expression and DCC comparable to C3H/HeNCrlBr suggesting that a trans-activator of osteopontin transcription residing on chromosome 7 and not the osteopontin gene on chromosome 5 was responsible for the genetic differences in osteopontin expression. A known osteopontin activator encoded by a gene on chromosome 7 is the transforming growth factor-β1, which was more induced (3.5×) in C3H/HeNCrlBr than in C57BL/6NCrlBr mice. Soft tissue deposition of calcium phosphate and hydroxyapatite in the absence of systemic calcium or phosphate imbalances is referred to as dystrophic calcification. Generally, this form of soft tissue mineralization is associated with cell death and necrosis in degenerative (eg, aging) or chronic inflammatory conditions. Cardiovascular calcification is particularly common and is correlated with the risk of cardiovascular events in affected patients.1Beadenkopf WG Daoud AS Love BM Calcification in the coronary arteries and its relationship to arteriosclerosis and myocardial infarction.Am J Roentgenol. 1964; 92: 865-871Google Scholar, 2Niskanen LK Suhonen M Siitonen O Lehtinen JM Uusitupa MI Aortic and lower limb artery calcification in type II (non-insulin-dependent) diabetic patients and non-diabetic control subjects: a five year follow-up study.Atherosclerosis. 1990; 84: 61-71Abstract Full Text PDF PubMed Scopus (65) Google Scholar, 3Lehto S Niskanen LK Suhonen L Ronnemaa T Laakso M Medial artery calcification: a neglected harbinger of cardiovascular complications in non-insulin-dependent diabetes mellitus.Arterioscler Thromb Vasc Biol. 1996; 16: 978-983Crossref PubMed Scopus (478) Google Scholar Accumulating evidence suggested that calcium deposition in the cardiovascular system is an actively regulated process: vascular cells may shed apoptotic bodies as membranous nucleators for mineralization,4Anderson HC Matrix vesicle calcification: review and update.Bone and Mineral Research. Elsevier Science Publishers, Chicago1985Google Scholar and secrete various noncollagenous bone matrix proteins such as calcium-binding Gla proteins, osteoprotegerin, and osteopontin (Opn).5Boskey AL Matrix proteins and mineralization: an overview.Connect Tissue Res. 1996; 35: 357-363Crossref PubMed Scopus (169) Google Scholar, 6Gorski JP Acidic phosphoproteins from bone matrix: a structural rationalization of their role in biomineralization.Calcif Tissue Int. 1992; 50: 391-396Crossref PubMed Scopus (205) Google Scholar Targeted gene inactivation of the matrix Gla protein7Luo G Ducy P McKee MD Pinero GJ Loyer E Behringer R Karsenty G Spontaneous calcification of arteries and cartilage in mice lacking matrix Gla protein.Nature. 1997; 386: 78-81Crossref PubMed Scopus (1714) Google Scholar or osteoprotegerin8Bucay N Sarosi I Dunstan CR Morony S Tarpley J Capparelli C Scully S Tan HL Xu W Lacey DL Boyle WJ Simonet WS Osteoprotegerin-deficient mice develop early onset osteoporosis and arterial calcification.Genes Dev. 1998; 12: 1260-1268Crossref PubMed Scopus (2091) Google Scholar caused spontaneous vascular calcification suggesting their involvement in this form of pathological calcification. Opn, also known as Spp1 or Eta-1, is a secreted sialic acid-rich phosphoprotein, that appeared particularly interesting for studies aiming at the causes and mechanisms of dystrophic calcification. Firstly, Opn can bind hydroxyapaptite9Steitz SA Speer MY McKee MD Liaw L Almeida M Yang H Giachelli CM Osteopontin inhibits mineral deposition and promotes regression of ectopic calcification.Am J Pathol. 2002; 161: 2035-2046Abstract Full Text Full Text PDF PubMed Scopus (340) Google Scholar and was associated with cardiovascular calcification in human atherosclerosis,10Shanahan CM Cary NRB Metcalfe JC Weissberg PL High expression of genes for calcification-regulating proteins in human atherosclerotic plaques.J Clin Invest. 1994; 93: 2393-2402Crossref PubMed Scopus (556) Google Scholar, 11Bini A Mann KG Kudryk BJ Schoen FJ Non-collagenous bone matrix proteins, calcification, and thrombosis in carotid artery atherosclerosis.Arterioscler Thromb Vasc Biol. 1999; 19: 1852-1861Crossref PubMed Scopus (139) Google Scholar, 12Giachelli CM Bae N Almeida M Denhardt DT Alpers CE Schwartz SM Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques.J Clin Invest. 1993; 92: 1686-1696Crossref PubMed Scopus (585) Google Scholar valvular calcification,13Mohler ER Adam LP McClelland P Graham L Hathaway DR Detection of osteopontin in calcified human aortic valves.Arterioscler Thromb Vasc Biol. 1997; 17: 547-552Crossref PubMed Scopus (157) Google Scholar and Mönckeberg's disease.14Shanahan CM Cary NR Salisbury JR Proudfoot D Weissberg PL Edmonds ME Medial localization of mineralization-regulating proteins in association with Monckeberg's sclerosis: evidence for smooth muscle cell-mediated vascular calcification.Circulation. 1999; 100: 2168-2176Crossref PubMed Scopus (563) Google Scholar The biological function of Opn may be influenced by extensive posttranslational modification including glycosylation15Singh K DeVouge MW Mukherjee BB Physiological properties and differential glycosylation of phosphorylated and nonphosphorylated forms of osteopontin secreted by normal rat kidney cells.J Biol Chem. 1990; 265: 18696-18701Abstract Full Text PDF PubMed Google Scholar and transglutamination.16Beninati S Senger DR Cordella-Miele E Mukherjee AB Chackalaparampil I Shanmugam V Singh K Mukherjee BB Osteopontin: its transglutaminase-catalyzed posttranslational modifications and cross-linking to fibronectin.J Biochem. 1994; 115: 675-682Crossref PubMed Scopus (82) Google Scholar Phosphorylation of Opn appeared to be required for inhibition of mineralization.17Jono S Peinado C Giachelli CM Phosphorylation of osteopontin is required for inhibition of vascular smooth muscle cell calcification.J Biol Chem. 2000; 275: 20197-20203Crossref PubMed Scopus (282) Google Scholar Secondly, Opn has an Arg-Gly-Asp (RGD) amino acid sequence motif18Oldberg A Franzen A Heinegard D Cloning and sequence analysis of rat bone sialoprotein (osteopontin) cDNA reveals an Arg-Gly-Asp cell-binding sequence.Proc Natl Acad Sci USA. 1986; 83: 8819-8823Crossref PubMed Scopus (912) Google Scholar serving as a ligand for integrins, a family of cell surface receptors promoting cell adhesion and migration.19Denhardt DT Giachelli CM Rittling SR Role of osteopontin in cellular signaling and toxicant injury.Annu Rev Pharmacol Toxicol. 2001; 41: 723-749Crossref PubMed Scopus (306) Google Scholar, 20Giachelli CM Lombardi D Johnson RJ Murry CE Almeida M Evidence for a role of osteopontin in macrophage infiltration in response to pathological stimuli in vivo.Am J Pathol. 1998; 152: 353-358PubMed Google Scholar Cells binding to Opn via the αVβ3 integrin include osteoclasts and macrophages.21Reinholt FP Hultenby K Oldberg A Heinegard D Osteopontin—a possible anchor of osteoclasts to bone.Proc Natl Acad Sci USA. 1990; 87: 4473-4475Crossref PubMed Scopus (693) Google Scholar Thirdly, strong expression of Opn has been demonstrated in macrophages in necrotic lesions of human myocardial infarction and after myocardial freeze-thaw injury in rats.22Murry CE Giachelli CM Schwartz SM Vracko R Macrophages express osteopontin during repair of myocardial necrosis.Am J Pathol. 1994; 145: 1450-1462PubMed Google Scholar Dystrophic calcification of necrotic myocardium has been observed in some gene-targeted mouse models of cardiomyopathy23McConnel BK Jones KA Fatkin D Arroyo LH Lee RT Aristizabal O Turnbull DH Georgakopoulos D Kass D Bond M Niimura H Schoen FJ Conner D Fischman DH Seidman CE Seidman JG Dilated cardiomyopathy in homozygous myosin-binding protein-C mutant mice.J Clin Invest. 1999; 104: 1235-1244Crossref PubMed Scopus (197) Google Scholar, 24Fatkin D Christe ME Aristizabal O McConnel BK Srinivasan S Schoen FJ Seidman CE Turnbull DH Seidman JG Neonatal cardiomyopathy in mice homozygous for the Arg403Gln mutation in the α cardiac myosin heavy chain gene.J Clin Invest. 1999; 103: 147-153Crossref PubMed Scopus (92) Google Scholar, 25Mavroidis M Capetanaki Y Extensive induction of important mediators of fibrosis and dystrophic calcification in desmin-deficient cardiomyopathy.Am J Pathol. 2002; 160: 943-952Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar: in mice with inactivation of desmin, the authors reported strong Opn expression in co-localization with calcified myocardial necrosis, yet function and regulation of Opn were not elucidated further.25Mavroidis M Capetanaki Y Extensive induction of important mediators of fibrosis and dystrophic calcification in desmin-deficient cardiomyopathy.Am J Pathol. 2002; 160: 943-952Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar Certain predisposed inbred mouse strains, including DBA/2, BALB/c, and C3H/He, also develop dystrophic peri-/myocardial calcification spontaneously or in response to high-fat/low-protein diets,26Eaton GJ Custer RP Johnson FN Stabenow KT Dystrophic cardiac calcinosis in mice: genetic, hormonal, and dietary influences.Am J Pathol. 1978; 90: 173-186PubMed Google Scholar, 27Everitt JI Olson LM Mangum JB Viskek WJ High mortality with severe dystrophic cardiac calcinosis in C3H/OUJ mice fed high fat purified diets.Vet Pathol. 1988; 25: 113-118Crossref PubMed Scopus (28) Google Scholar viral myocarditis,28Gang DL Barrett LV Wilson EJ Rubin RH Medearis DN Myopericarditis and enhanced dystrophic cardiac calcification in murine cytomegalovirus infection.Am J Pathol. 1986; 124: 207-215PubMed Google Scholar or direct freeze-thaw injury.29Brunnert SR Morphologic response of myocardium to freeze-thaw injury in mouse strains with dystrophic cardiac calcification.Lab Anim Sci. 1997; 47: 11-18PubMed Google Scholar This recessive phenotype has been termed dystrophic cardiac calcinosis or DCC, yet pathogenetic mechanisms remained hardly understood. In this study we investigated the development of DCC in predisposed C3H/He and resistant C57BL/6 mice after myocardial freeze-thaw injury. In particular, we sought to examine the tentative association of Opn and DCC suggested previously.22Murry CE Giachelli CM Schwartz SM Vracko R Macrophages express osteopontin during repair of myocardial necrosis.Am J Pathol. 1994; 145: 1450-1462PubMed Google Scholar, 25Mavroidis M Capetanaki Y Extensive induction of important mediators of fibrosis and dystrophic calcification in desmin-deficient cardiomyopathy.Am J Pathol. 2002; 160: 943-952Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar We examined systemic and myocardial expression levels of Opn in a temporal and spatial distribution to determine genetic differences in regulation. A novel congenic mouse model was analyzed to test linkage of the structural Opn locus with its regulation and with the DCC phenotype. Inbred C57BL/6 and C3H/He strains were purchased from Charles River (Sulzbach-Rosenberg, Germany). Congenic strains were bred in our own mouse colony: at the outset (C57BL/6 × C3H/He) F1 male mice were backcrossed to female C57BL/6 mice. Selected progeny was further backcrossed to female C57BL/6 mice for another nine generations with the aim to preserve (C57BL/6 × C3H/He) heterozygosity on proximal chromosome 7. This was assessed by genotyping of microsatellite markers D7Mit56, D7Mit247, D7Mit229, D7Mit82, D7Mit31, D7Mit40, and D7Mit332 as described previously.30Ivandic BT Qiao JH Machleder D Liao F Drake TA Lusis AJ A locus on chromosome 7 determines myocardial cell necrosis and calcification (dystrophic cardiac calcinosis) in mice.Proc Natl Acad Sci USA. 1996; 93: 5483-5488Crossref PubMed Scopus (63) Google Scholar Further brother × sister matings produced a chromosomal segment with homozygous alleles of the susceptible donor strain C3H/He. A detailed histological and genetic characterization of congenic strain B6.C3-(D7Mit56-D7Mit230) is in preparation. Throughout the entire experiment all animals had free access to water and Altromin 1324 chow (Altromin, Lage, Germany), and were maintained with a 12-hour light:dark cycle. At the age of 6 to 8 weeks myocardial freeze-thaw injury was produced in C3H/He, C57BL/6, and congenic strains essentially as described.29Brunnert SR Morphologic response of myocardium to freeze-thaw injury in mouse strains with dystrophic cardiac calcification.Lab Anim Sci. 1997; 47: 11-18PubMed Google Scholar In brief, the abdomen of an anesthetized animal (intraperitoneal injection of 250 mg/kg body weight of a 12.5-mg/ml 2,2,2-tri-bromo-ethanol solution, prepared freshly in 2-methyl-2-butanol) was opened in midline. The left lobe of the liver was gently flipped over to allow visualization of the beating heart through the translucid diaphragmal base. A blunt steel pin (5 mm in diameter), precooled in liquid nitrogen, was pressed gently for 10 seconds onto the diaphragm aiming at the heart. Then, the abdomen was closed using 7.0 suture material. At the indicated time points after myocardial injury mice were sacrificed by cervical dislocation before the hearts were quickly excised, rinsed with phosphate-buffered saline, and analyzed as indicated. Serial 8-μm cryosections throughout the ventricles were prepared and collected on poly-d-lysine-coated slides. Immunostaining was performed with a polyclonal anti-mouse Opn antibody at 5 μg/ml (R&D Systems, Wiesbaden, Germany) and a macrophage-specific anti-rat monoclonal antibody (MOMA2) at 5 μg/ml (BMA, Augst, Switzerland). Bound primary antibodies were detected using biotinylated secondary antibodies that were visualized using a streptavidin-horseradish peroxidase complex and diaminobenzidine as supplied with the ABC Vectra staining kit (Vector Laboratories, Santa Cruz, CA). Slides were then counterstained with hematoxylin. Controls were performed without primary antibodies. Nonspecific binding of antibodies to calcified tissue was excluded by treatment of some specimens with citric acid before immunohistological staining.31Gadeau A-P Chaulet H Daret D Kockx M Daniel-Lamaziere J-M Desgranges C Time course of osteopontin, osteocalcin, and osteonectin accumulation and calcification after acute vessel wall injury.J Histochem Cytochem. 2001; 49: 79-86Crossref PubMed Scopus (69) Google Scholar Plasma Opn concentrations were determined using an anti-mouse Opn enzyme-linked immunosorbent assay from Immuno Biological Laboratories, Hamburg, Germany. Blood samples were obtained by retro-orbital bleeding into lithium-heparin plasma separator tubes (Becton Dickinson, Heidelberg, Germany). After centrifugation plasma samples were diluted with saline (1:50) and processed as directed by the manufacturer. On harvesting, whole hearts were quickly dissected to obtain comparable specimens from necrotic and noninjured myocardium. Samples were homogenized on ice in RNAclean (Hybaid-AGS, Heidelberg, Germany) to isolate total RNA. After DNase treatment and electrophoretic quality control, samples were reverse-transcribed and subsequently amplified using a Tth polymerase-based one-step reverse transcriptase-polymerase chain reaction (RT-PCR) kit (RNA Master SYBR Green I) for the LightCycler thermocycler (Roche, Mannheim, Germany). PCR product formation was assessed in real-time using SYBR Green I fluorescence. Relative gene induction was calculated using the ΔΔCt method comparing gene induction at various time points after freeze-thaw injury to baseline after normalization to 18S rRNA.32Winer J Jung CKS Shackel I Williams PM Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro.Anal Biochem. 1999; 270: 41-49Crossref PubMed Scopus (1206) Google Scholar Ct was obtained by crossing point analysis of triplicate amplifications after applying the second derivative maximum method implemented in the LightCycler Software. Primer pairs used for amplification were: ACACTTTCACTCCAATCGTCC/TGCCCTTTCCGTTGTTGTCCfor Opn, CTGCTGACCCCCACTGATAC/GTTGGACAACTGCTCCACCT for Tgfb1, and TCAAGAACGAAAGTCGGAGG/GGACATCTAAGGGCATCACA for 18S rRNA. mRNA was isolated from necrotic lesions of C3H/He hearts 3 days after freeze-thaw injury, reverse-transcribed to cDNA, and then amplified using these primer pairs for Opn: GTGGGCCTTGCTTGGGTT/TTCTGTGGCGCAAGGAGATT (GenBank BC002113), CCCGGTGAAAGTGACTGATTC/CAGAGGGCATGCTCAGAAGC, and CACATGAAGAGCGGTGAGTCTAA/AAGCTTTTGGTTACAACGGTGTTT (GenBank NM_009263). The PCR amplification products overlapped and covered the entire coding sequence of the Opn gene. PCR was performed using the Expand Fidelity PCR kit containing a Taq/Pfu polymerase mix (Roche). The thermocycler program included an initial 94°C denaturing step followed by 45 cycles consisting of short denaturing at 94°C (15 seconds), annealing at 58°C for 30 seconds, and extension at 72°C for 45 seconds. Annealing temperature was lowered by 2°C every 15 cycles. A final extension step at 72°C for 5 minutes concluded the cycling program. PCR products were sequenced in both directions by a commercial sequencing service (Seqlab, Goettingen, Germany). Necrotic lesions were usually detectable by gross inspection as early as 1 day after freeze-thaw injury. On light microscopy, lesions appeared circumscript and exhibited fibrosis and inflammatory cell infiltration (Figure 1). In the lesions of C3H/He hearts (Figure 1A) infiltrating cells were inhomogeneous with respect to distribution and shape ranging from small spindle-like cells with dense, basophilic nuclei to large, more globular cells with large nuclei that stained only faintly basophilic and were mostly positive for MOMA-2, a macrophage-specific antibody (data not shown). Focal agglomerations of macrophages surrounding calcified material were noticed throughout the lesions. Polynuclear giant cells were not seen. In comparison, necrotic lesions of C57BL/6 hearts exhibited a more homogenous distribution of predominantly spindle-like cells consistent with fibroblasts (Figure 1B). At day 3, necrotic tissue appeared completely phagocytosed and replaced by fibrotic tissue. In this regard, wound healing appeared more advanced compared to C3H/He mice exhibiting histomorphological changes that were suggestive for delayed debridement. Myocardial calcium deposits stained dark basophilic with hematoxylin, and were first noticed 2 days after freeze-thaw injury. In agreement with earlier observations, calcifications were absent in C56BL/6 mice (Figure 1B). This was also confirmed by calcium-specific Alizarin Red S staining (data not shown). In C3H/He strains calcification was seen only within the necrotic lesion area mostly close to noninjured, viable myocardium. Small foci of calcification developed into larger patches and streaks after 3 to 5 days (Figure 1A), and persisted at least up to 3 weeks (data not shown). In C3H/He, intense immunohistological staining of Opn was found strictly co-localizing with calcium deposition beginning at day 2 (Figure 1A). In contrast, at day 3, C57BL/6 mice exhibited lesions staining for Opn rather diffusely and much less intensely compared to C3H/He mice (Figure 1B). Note that the extracellular matrix of the noninjured myocardium surrounding the lesion exhibited some faint Opn staining as well (Figure 1B). Opn gene induction was examined by quantitative real-time RT-PCR. Groups of four mice were sacrificed immediately after freeze-thaw injury (baseline) as well as 1, 2, 3, and 5 days after injury. Tissue samples were taken from lesions and from noninjured, healthy myocardium (only at baseline and days 1, 2, and 3). Necrotic and noninjured specimens were analyzed separately to exclude a significant contribution of Opn transcripts from myocardial remodeling in response to injury.33Graf K Do YS Ashizawa N Meehan WP Giachelli CM Marboe CC Fleck E Hsueh WA Myocardial osteopontin expression is associated with left ventricular hypertrophy.Circulation. 1997; 96: 3063-3071Crossref PubMed Scopus (123) Google Scholar Examination of necrotic tissue revealed comparable induction of Opn (∼12-fold) in both C57BL/6 and C3H/He 1 day after injury (Figure 2A). Coincident with increasing calcification of necrosis, up-regulation of Opn began at day 2 and peaked at day 3 in the C3H/He strain: compared to baseline, up-regulation reached ∼1300-fold, 20-times more than observed in C57BL/6 mice showing a maximal 65-fold increase relative to baseline. The significant strain-dependent difference (P < 0.05, Mann-Whitney U-test) persisted up to day 5 when Opn induction was declining in both strains. In contrast, in healthy myocardium of C57BL/6 mice Opn was up-regulated maximally ∼3.5-fold at day 2 compared to baseline, whereas Opn induction remained approximately twofold in strain C3H/He (Figure 2B). We examined Opn plasma concentrations to determine whether up-regulation of Opn was exclusively limited to necrotic tissue. Basal Opn plasma concentrations were approximately twofold higher in strain C57BL/6 than in C3H/He (Figure 3). In C3H/He, however, Opn plasma concentrations followed the time pattern of Opn up-regulation in necrotic tissue and reached nearly the plasma concentrations of C57BL/6 at day 3 after injury. We also analyzed separate groups of mice (n = 4 to 5) 3 days after myocardial freeze-thaw injury and after sham treatment. Consistent with a strain-dependent specific response to myocardial injury, Opn plasma concentrations were increased by 74% in C3H/He mice with myocardial injury compared to sham-operated mice. In C57BL/6 mice, myocardial injury increased levels observed in sham-treated animals by an additional 27%. Therefore, strong local Opn expression in the necrotic myocardium may have influenced systemic Opn levels as well. A number of polymorphisms have been identified in Opn in various inbred mouse strains.34Ono M Yamamoto T Nose M Allelic difference in the nucleotide sequence of the Eta-1/Op gene transcript.Mol Immunol. 1995; 32: 447-448Crossref PubMed Scopus (16) Google Scholar, 35Miyazaki Y Setoguchi M Yoshida S Higuchi Y Akizuki S Yamamoto S The mouse osteopontin gene. Expression in monocytic lineages and complete nucleotide sequence.J Biol Chem. 1990; 265: 14432-14438Abstract Full Text PDF PubMed Google Scholar We sequenced the entire Opn cDNA derived from calcified necrotic myocardium (day 3 after freeze-thaw injury) to examine strain differences and tissue-specific RNA splicing. Compared to C57BL/6, strain C3H/He exhibited one codon insertion (resulting in the insertion of K31) and 16 base differences, 9 of which translated into amino acid substitutions (Figure 4). A S101N and a D189N substitution affected two (S101-E112, S187-D189) of several phosphorylation sites, while a K208R substitution occurred in the middle of a calcium-binding domain (D202-S213). One of two putative heparin-binding sites (D276-I283) exhibited an R277H substitution. Additional V123F, N143D, D172Y, R225S, and Q233H amino acid substitutions did not occur in any known relevant protein motif including the signal peptide (M1-S16), the aspartic acid-rich hydroxyapatite-binding site (D86-D95), the RGD-motif (R145-D147) and additional integrin binding sites (S148-L153), the thrombin cleavage site (R154-S155), and the remaining phosphorylation and glycosylation sites.19Denhardt DT Giachelli CM Rittling SR Role of osteopontin in cellular signaling and toxicant injury.Annu Rev Pharmacol Toxicol. 2001; 41: 723-749Crossref PubMed Scopus (306) Google Scholar, 36Denhardt DT Guo X Osteopontin: a protein with diverse functions.EMBO J. 1993; 7: 1475-1482Google Scholar, 37O'Regan A Berman JS Osteopontin: a key cytokine in cell-mediated and granulomatous inflammation.Int J Exp Pathol. 2000; 81: 373-390Crossref PubMed Scopus (310) Google Scholar, 38Giachelli CM Steitz S Osteopontin: a versatile regulator of inflammation and biomineralization.Matrix Biol. 2000; 19: 615-622Crossref PubMed Scopus (459) Google Scholar The D172Y substitution may yet be functionally important, because it created a shift from an acidic to a basic amino acid. We used a novel congenic strain, B6.C3-(D7Mit56-D7Mit230), to determine whether any polymorphism at the Opn locus may be relevant for the differential regulation of Opn or the development of DCC. This congenic strain shared the genetic background with resistant C57BL/6 including the Opn locus residing on chromosome 5 and possessed an ∼24.5-cM segment of proximal chromosome 7 (extending from the acrocentric centromere to microsatellite marker D7Mit230). This segment was derived from C3H/He and rendered congenic mice susceptible to DCC as well. As illustrated in Figure 1, C and D, congenic mice exhibited macrophage infiltration and marked Opn expression in co-localization with calcification comparable to C3H/He mice. We concluded that the Opn locus on chromosome 5 is not necessary for DCC: the presumably functional calcium-binding and phosphorylation sites of the C57BL/6 Opn alleles could not prevent DCC. The strong expression of Opn in the necrotic lesions of DCC-susceptible strains C3H/He and B6.C3-(D7Mit56-D7Mit230) was determined by a locus on proximal chromosome 7. Tgfb1 has been identified as potent inducer of Opn12Giachelli CM Bae N Almeida M Denhardt DT Alpers CE Schwartz SM Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques.J Clin Invest. 1993; 92: 1686-1696Crossref PubMed Scopus (585) Google Scholar, 39Noda M Yoon K Prince CW Butler WT Rodan GA Transcriptional regulation of osteopontin production in rat osteosarcoma cells by type β transforming growth factor.J Biol Chem. 1988; 263: 13916-13921Abstract Full Text PDF PubMed Google Scholar, 40Noda M Rodan GA Type β transforming growth factor regulates expression of genes encoding bone matrix proteins.Connect Tissue Res. 1989; 21: 71-75Crossref PubMed Scopus (51) Google Scholar and is also located on proximal chromosome 7. The induction of Tgfb1 was assessed by quantitative RT-PCR. In necrotic lesions we found a maximal eightfold induction at day 3 in C3H/He while induction ranged from ∼1.5-fold to twofold throughout days 1 to 5 in C57BL/6 (Figure 5A). In healthy myocardium, we noticed early induction (maximally 2.5-fold compared to baseline) 1 day after injury in C3H/He mice (Figure 5B). In contrast, there was no relevant induction of Tgfb1 mRNA in C57BL/6 mice during the first 3 days. Strain-specific regulation and time course of Tgfb1 induction in necrotic myocardium suggested that Tgfb1 may be the hypothesized trans-activator of Opn transcription. Dystrophic calcification is a well recognized hallmark of degenerative disease, chronic inflammation, atherosclerosis, and other conditions associated with tissue necrosis. Extensive mechanistic and experimental evidence led to several models explaining calcium deposition in vascular tissue and bone. Physiological and certain forms of pathological calcification may share common elements (eg, the formation of matrix vesicles) depending on the type of tissue and the etiology of tissue injury.41Boström K Demer LL Regulatory mechanisms in vascular calcification.Crit Rev Eukaryot Gene Expr. 2000; 12: 151-158Google Scholar, 42Giachelli CM Ectopic calcification. Gathering hard facts about soft tissue mineralization.Am J Pathol. 1999; 154: 6
Referência(s)