Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Carboxyl-terminal Domain of Bacteriophage T7 Single-stranded DNA-binding Protein Modulates DNA Binding and Interaction with T7 DNA Polymerase

2003; Elsevier BV; Volume: 278; Issue: 32 Linguagem: Inglês

10.1074/jbc.m304318200

ISSN

1083-351X

Autores

Zheng-Guo He, Lisa F. Rezende, Smaranda Willcox, Jack D. Griffith, Charles C. Richardson,

Tópico(s)

DNA Repair Mechanisms

Resumo

Gene 2.5 of bacteriophage T7 is an essential gene that encodes a single-stranded DNA-binding protein (gp2.5). Previous studies have demonstrated that the acidic carboxyl terminus of the protein is essential and that it mediates multiple protein-protein interactions. A screen for lethal mutations in gene 2.5 uncovered a variety of essential amino acids, among which was a single amino acid substitution, F232L, at the carboxyl-terminal residue. gp2.5-F232L exhibits a 3-fold increase in binding affinity for single-stranded DNA and a slightly lower affinity for T7 DNA polymerase when compared with wild type gp2.5. gp2.5-F232L stimulates the activity of T7 DNA polymerase and, in contrast to wild-type gp2.5, promotes strand displacement DNA synthesis by T7 DNA polymerase. A carboxyl-terminal truncation of gene 2.5 protein, gp2.5-Δ26C, binds single-stranded DNA 40-fold more tightly than the wild-type protein and cannot physically interact with T7 DNA polymerase. gp2.5-Δ26C is inhibitory for DNA synthesis catalyzed by T7 DNA polymerase on single-stranded DNA, and it does not stimulate strand displacement DNA synthesis at high concentration. The biochemical and genetic data support a model in which the carboxyl-terminal tail modulates DNA binding and mediates essential interactions with T7 DNA polymerase. Gene 2.5 of bacteriophage T7 is an essential gene that encodes a single-stranded DNA-binding protein (gp2.5). Previous studies have demonstrated that the acidic carboxyl terminus of the protein is essential and that it mediates multiple protein-protein interactions. A screen for lethal mutations in gene 2.5 uncovered a variety of essential amino acids, among which was a single amino acid substitution, F232L, at the carboxyl-terminal residue. gp2.5-F232L exhibits a 3-fold increase in binding affinity for single-stranded DNA and a slightly lower affinity for T7 DNA polymerase when compared with wild type gp2.5. gp2.5-F232L stimulates the activity of T7 DNA polymerase and, in contrast to wild-type gp2.5, promotes strand displacement DNA synthesis by T7 DNA polymerase. A carboxyl-terminal truncation of gene 2.5 protein, gp2.5-Δ26C, binds single-stranded DNA 40-fold more tightly than the wild-type protein and cannot physically interact with T7 DNA polymerase. gp2.5-Δ26C is inhibitory for DNA synthesis catalyzed by T7 DNA polymerase on single-stranded DNA, and it does not stimulate strand displacement DNA synthesis at high concentration. The biochemical and genetic data support a model in which the carboxyl-terminal tail modulates DNA binding and mediates essential interactions with T7 DNA polymerase. Gene 2.5 of bacteriophage T7 encodes a single-stranded DNA (ssDNA) 1The abbreviations used are: ssDNA, single-stranded DNA; wt, wild-type.-binding protein (gp2.5) that is essential for viral survival (1Kim Y.T. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10173-10177Crossref PubMed Scopus (60) Google Scholar). gp2.5 modulates several important reactions in DNA replication, recombination, and repair (1Kim Y.T. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10173-10177Crossref PubMed Scopus (60) Google Scholar, 2Reuben R.C. Gefter M.L. Proc. Natl. Acad. Sci. U. S. A. 1973; 70: 1846-1850Crossref PubMed Scopus (49) Google Scholar, 3Scherzinger E. Litfin F. Jost E. Mol. Gen. Genet. 1973; 123: 247-262Crossref PubMed Scopus (40) Google Scholar, 4Araki H. Ogawa H. Virology. 1981; 111: 509-515Crossref PubMed Scopus (18) Google Scholar, 5Araki H. Ogawa H. Mol. Gen. Genet. 1981; 183: 66-73Crossref PubMed Scopus (15) Google Scholar, 6Nakai H. Richardson C.C. J. Biol. Chem. 1988; 263: 9831-9839Abstract Full Text PDF PubMed Google Scholar, 7Kim Y.T. Tabor S. Bortner C. Griffith J.D. Richardson C.C. J. Biol. Chem. 1992; 267: 15022-15031Abstract Full Text PDF PubMed Google Scholar, 8Kim Y.T. Tabor S. Churchich J.E. Richardson C.C. J. Biol. Chem. 1992; 267: 15032-15040Abstract Full Text PDF PubMed Google Scholar, 9Kong D. Nossal N.G. Richardson C.C. J. Biol. Chem. 1997; 272: 8380-8387Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 10Kong D. Richardson C.C. EMBO J. 1996; 15: 2010-2019Crossref PubMed Scopus (52) Google Scholar, 11Tabor, S., and Richardson, C. C. (July 9, 1996) U. S Patent 5534407Google Scholar, 12Yu M. Masker W. J. Bacteriol. 2001; 183: 1862-1869Crossref PubMed Scopus (13) Google Scholar). The fundamental reactions at the T7 phage replication fork can be reconstituted with only four proteins (13Richardson C.C. Cell. 1983; 33: 315-317Abstract Full Text PDF PubMed Scopus (98) Google Scholar, 14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar): T7 gene 5 DNA polymerase, its processivity factor Escherichia coli thioredoxin (15Huber H.E. Tabor S. Richardson C.C. J. Biol. Chem. 1987; 262: 16212-16223Abstract Full Text PDF PubMed Google Scholar, 16Tabor S. Richardson C.C. J. Biol. Chem. 1987; 262: 16224-16232Abstract Full Text PDF PubMed Google Scholar), T7 gene 4 helicase/primase (17Bernstein J.A. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 85: 396-400Crossref Scopus (93) Google Scholar, 18Egelman E.H. Yu X. Wild R. Hingorani M.M. Patel S.S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3869-3873Crossref PubMed Scopus (252) Google Scholar, 19Mendelman L.V. Richardson C.C. J. Biol. Chem. 1991; 266: 23240-23250Abstract Full Text PDF PubMed Google Scholar), and T7 gp2.5. gp2.5 physically interacts with T7 DNA polymerase and T7 helicase/primase to stimulate their activities (6Nakai H. Richardson C.C. J. Biol. Chem. 1988; 263: 9831-9839Abstract Full Text PDF PubMed Google Scholar, 8Kim Y.T. Tabor S. Churchich J.E. Richardson C.C. J. Biol. Chem. 1992; 267: 15032-15040Abstract Full Text PDF PubMed Google Scholar). The binding of gp2.5 to ssDNA is critical because it affects both specific DNA-protein and protein-protein interactions in the replisome (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 20Kong D. Richardson C.C. J. Biol. Chem. 1998; 273: 6556-6564Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). In this regard it is essential for coupling leading and lagging strand DNA synthesis in vitro (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). gp2.5 is also essential for recombination in T7 phage-infected cells, and in addition to the interactions described above, it also mediates homologous base pairing (11Tabor, S., and Richardson, C. C. (July 9, 1996) U. S Patent 5534407Google Scholar). Despite a lack of sequence homology, T7 gp2.5 is functionally similar to the extensively studied SSB protein of E. coli and the gene 32 protein of bacteriophage T4. Like gp2.5, they are both ssDNA-binding proteins, a class of ubiquitous proteins that are not only essential in DNA replication but also play key roles in DNA recombination and repair (7Kim Y.T. Tabor S. Bortner C. Griffith J.D. Richardson C.C. J. Biol. Chem. 1992; 267: 15022-15031Abstract Full Text PDF PubMed Google Scholar, 21Chase J.W. Williams K.R. Annu. Rev. Biochem. 1986; 55: 103-136Crossref PubMed Scopus (448) Google Scholar). Biochemical studies have shown that these proteins, like T7 gp2.5, interact with other proteins at the replication fork. E. coli SSB protein interacts with E. coli DNA polymerase II, exonuclease I, and other proteins involved in replication (22Sigal N. Delius H. Kornberg T. Gefter M.L. Alberts B. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 3537-3541Crossref PubMed Scopus (241) Google Scholar, 23Molineux I.J. Gefter M.L. J. Mol. Biol. 1975; 98: 811-825Crossref PubMed Scopus (74) Google Scholar, 24Low R.L. Shlomai J. Kornberg P.K. J. Biol. Chem. 1982; 257: 6242-6250Abstract Full Text PDF PubMed Google Scholar). T4 gene 32 protein physically interacts with at least 10 T4-encoded proteins, including T4 DNA polymerase, that are involved in T4 metabolism (25Formosa T. Burke R.L. Alberts B.M. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 2442-2446Crossref PubMed Scopus (90) Google Scholar). The crystal structure of a carboxyl-terminal deleted T7 gp2.5 reveals a conserved oligosaccharide/oligonucleotide binding fold, similar to that of T4 gene 32 protein and E. coli SSB protein. The structure also suggests models for DNA binding and dimerization of gp2.5 (26Hollis T. Stattel J.M. Walther D.S. Richardson C.C. Ellenberger T. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9557-9562Crossref PubMed Scopus (82) Google Scholar). Genetic and biochemical experiments suggest that the physical interactions of gp2.5 are specific, as neither E. coli SSB protein nor T4 gene 32 protein can functionally replace gene 2.5 protein in vivo (1Kim Y.T. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10173-10177Crossref PubMed Scopus (60) Google Scholar, 20Kong D. Richardson C.C. J. Biol. Chem. 1998; 273: 6556-6564Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). T7 gene 4 primase-helicase is unable to load onto ssDNA coated with gene 32 protein, a reaction that occurs readily with T7 gp2.5 protein-coated DNA (9Kong D. Nossal N.G. Richardson C.C. J. Biol. Chem. 1997; 272: 8380-8387Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). E. coli SSB protein, on the other hand, can stimulate T7 DNA polymerase activity, support strand displacement DNA synthesis (8Kim Y.T. Tabor S. Churchich J.E. Richardson C.C. J. Biol. Chem. 1992; 267: 15032-15040Abstract Full Text PDF PubMed Google Scholar, 27Rigler M.N. Romano L.J. J. Biol. Chem. 1995; 270: 8910-8919Abstract Full Text Full Text PDF PubMed Scopus (6) Google Scholar, 28Myers T.W. Romano L.J. J. Biol. Chem. 1988; 263: 17006-17015Abstract Full Text PDF PubMed Google Scholar), as well as permit T7 primase-helicase to load onto ssDNA. Moreover, gp2.5 increases the frequency of initiation by T7 primase-helicase, whereas E. coli SSB protein does not (6Nakai H. Richardson C.C. J. Biol. Chem. 1988; 263: 9831-9839Abstract Full Text PDF PubMed Google Scholar). This specificity for gp2.5 is not surprising as there is little sequence homology between the proteins, and gp2.5 differs from the other proteins significantly in a number of biochemical properties. For instance, the T7 protein binds to ssDNA with a lower affinity than E. coli SSB protein or T4 gene 32 protein (7Kim Y.T. Tabor S. Bortner C. Griffith J.D. Richardson C.C. J. Biol. Chem. 1992; 267: 15022-15031Abstract Full Text PDF PubMed Google Scholar). The oligomeric state of these proteins also differs with gp2.5 existing as a stable dimer in solution (7Kim Y.T. Tabor S. Bortner C. Griffith J.D. Richardson C.C. J. Biol. Chem. 1992; 267: 15022-15031Abstract Full Text PDF PubMed Google Scholar), whereas E. coli SSB protein forms a tetramer (29Weiner J.H. Bertsch L.L. Kornberg A. J. Biol. Chem. 1975; 250: 1972-1980Abstract Full Text PDF PubMed Google Scholar). T4 gene 32 protein is a monomer that forms multimers at high concentrations (30Von Hippel P.H. Kowalczykowski S.C. Lonberg N. Newport J.W. Paul L.S. Stormo G.D. Gold L. J. Mol. Biol. 1982; 162: 795-818Crossref PubMed Scopus (76) Google Scholar, 31Carroll R.B. Neet K. Goldthwait D.A. J. Mol. Biol. 1975; 91: 275-291Crossref PubMed Scopus (41) Google Scholar). A number of genetic and biochemical studies have focused on the carboxyl-terminal region of gp2.5 (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 20Kong D. Richardson C.C. J. Biol. Chem. 1998; 273: 6556-6564Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 32Kim Y.T. Richardson C.C. J. Biol. Chem. 1994; 269: 5270-5278Abstract Full Text PDF PubMed Google Scholar), an essential domain of the protein. The carboxyl-terminal tail is quite acidic and is required to mediate interactions with the T7 replication proteins described above (32Kim Y.T. Richardson C.C. J. Biol. Chem. 1994; 269: 5270-5278Abstract Full Text PDF PubMed Google Scholar). A truncated gene 2.5 protein, gp2.5-Δ21C, which lacks the carboxyl-terminal 21 amino acids, cannot support T7 phage growth (32Kim Y.T. Richardson C.C. J. Biol. Chem. 1994; 269: 5270-5278Abstract Full Text PDF PubMed Google Scholar). Purified gp2.5-Δ21C does not form a dimer and does not interact with T7 DNA polymerase or T7 primase-helicase (32Kim Y.T. Richardson C.C. J. Biol. Chem. 1994; 269: 5270-5278Abstract Full Text PDF PubMed Google Scholar). Unlike the wild-type protein, gp2.5-Δ21C does not support the coordination of leading and lagging strand DNA synthesis in vitro (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). The similar arrangement of domains in E. coli SSB protein, T4 gene 32 protein, and T7 gp2.5 suggests that the acidic carboxyl-terminal domains of these three proteins are functionally homologous (20Kong D. Richardson C.C. J. Biol. Chem. 1998; 273: 6556-6564Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Interestingly, when the carboxyl-terminal acidic region of either E. coli SSB protein or T4 gene 32 protein replace the acidic tail of gp2.5, the chimeric proteins can substitute for T7 gene 2.5 protein to support the growth of phage T7, albeit less efficiently. In contrast, chimeric proteins in which the carboxyl-terminal tail of gp2.5 replaces that of E. coli SSB protein or T4 gene 32 protein cannot support growth of T7 phage (20Kong D. Richardson C.C. J. Biol. Chem. 1998; 273: 6556-6564Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). These results show that although the carboxyl terminus of gp2.5 is essential for protein-protein interaction, it alone cannot account for the specificity of the interaction. To address further the role of gp2.5 in T7 DNA metabolism, we recently examined mutations in gene 2.5 from a random mutagenic screen of gp2.5 (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Taken together with the crystal structure, these studies have provided insight into DNA binding and dimerization of the protein (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 34Hyland E.M. Rezende L.F. Richardson C.C. J. Biol. Chem. 2003; 278: 7247-7256Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar). In this mutagenic screen, several amino acid changes were identified in the carboxyl-terminal tail. However, except for one mutant, all had multiple amino acid changes that accounted for their lethality. One mutant, however, had a single amino acid substitution, leucine replacing phenylalanine at position 232. This altered gp2.5-F232L could not complement T7 Δ2.5 lacking gene 2.5. In this paper we show that gp2.5-F232L binds more tightly to ssDNA and enables T7 DNA polymerase to catalyze strand displacement DNA synthesis. These studies, taken together with studies on gp2.5-Δ26C, support a role of the carboxyl terminus in modulating ssDNA binding and in interacting with T7 DNA polymerase. Bacterial Strains, Bacteriophages, and Plasmids—E. coli BL21(DE3)- (F– ompT hsdS B (rB–mB–) gal – dcm (DE3)) (Novagen) was used as the host strain to express T7 gene 2.5 and to purify wild-type and mutant gp2.5. Wild-type and mutant gene 2.5 are expressed from the pET17b plasmid (Novagen) containing the T7 RNA polymerase promoter. DNAs encoding His-tagged gene 2.5 proteins were cloned into the NdeI and BamHI restriction sites of modified pET19bPPS vector as described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Details of the cloning procedure have been described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). T7 gp2.5-Δ26C was obtained from Edel Hyland (Harvard Medical School). DNA and Oligonucleotides—The 70-mer oligonucleotide GACCATATCCTCCACCCTCCCCAATATTGACCATCAACCCTTCACCTCACTTCACTCCACTATACCACTC-3′ (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar), provided by J. Lee (Harvard Medical School), was used in electrophoretic mobility shift assays for assessing binding of gp2.5 to ssDNA. M13mp18(+) and poly(dA)390, templates used for DNA synthesis, were purchased from Amersham Biosciences. 5′-33P-End-labeled primer was annealed to M13mGP1-2, a 9950-nucleotide derivative of vector M13mp8 (35Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4767-4771Crossref PubMed Scopus (1687) Google Scholar), and used for DNA synthesis. Oligonucleotide 5′-GTTTTCCCAGTCACGAC-3′ and poly(dT)22 used as primers for DNA synthesis were purchased from Amersham Biosciences. The 34-oligonucleotide TG, 5′-CTAATCAGGAGGTCATAGCTGTTTCCTGTGTGAA-3′ that can be partially annealed to M13mp18 (unannealed nucleotides are underlined in the primer sequence), was synthesized by Integrated DNA Technologies. For cloning purposes the following oligonucleotides were purchased from Oligos Etc: T72.5 NdeI, 5′-CGTAGGATCCATATGGCTAAGAAGATTTTCACCTC-3′; and T72.5BamHI, 5′-CGTAGGATCCACTTAGAGGTCTCCGTC-3′. The oligonucleotides pET17b upstream, 5′-CTTTAAGAAGGAGATATACATATG-3′, and pET17b downstream, 5′-GCTAGTTATTGCTCAGCGG-3′, used for DNA sequencing were synthesized by the Biopolymer Facility, Harvard Medical School. All radioactive nucleotides were purchased from Amersham Biosciences. Proteins, Enzymes, and Chemicals—Restriction enzymes, polynucleotide kinase, T4 DNA ligase, and calf intestinal phosphatase were purchased from New England Biolabs. E. coli SSB protein was purchased from U. S. Biochemical Corp. Donald Johnson (Harvard Medical School) supplied T7 DNA polymerase. All chemicals and reagents were from Sigma unless otherwise noted. Mutagenesis of T7 gp2.5—pET17b plasmids expressing lethal mutations in gene 2.5 were generated by a random mutagenesis as described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). The plasmid harboring the altered gene 2.5 (694T→ C) from which gp2.5-F232L was expressed was isolated from this library as described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Expression and Purification of gp2.5—wt and gp2.5-F232L were purified as described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar) with the following changes. The plasmids pETGp2.5 and pETGp2.5-F232L were transformed into competent E. coli BL21(DE3) cells (Novagen). Eight liter cultures were grown in LB with 60 μg/ml ampicillin to an A 595 of 1.0. Cells harboring pETGp2.5 were induced at 37 °C for 4 h after adding isopropyl-β-d-thiogalactoside to a final concentration of 1 mm. Cells harboring pETGp2.5-F232L were induced at 30 °C for 6 h after adding isopropyl-β-d-thiogalactoside to a final concentration of 1 mm. Purified wt gp2.5 and gp2.5-F232L were greater than 99% pure as determined by SDS-PAGE and subsequent staining by Coomassie Blue. Protein concentrations were determined by spectrophotometric absorbance at 260 nm using the extinction coefficient of 2.58 × 104m– 1cm–1 calculated according to Gill and Hippel (36Gill S.C. Hippel P.H. Anal. Biochem. 1989; 182: 319-326Crossref PubMed Scopus (5070) Google Scholar). Molecular Weight Approximation by Gel Filtration Analysis—Gel filtration analysis was performed as described previously (7Kim Y.T. Tabor S. Bortner C. Griffith J.D. Richardson C.C. J. Biol. Chem. 1992; 267: 15022-15031Abstract Full Text PDF PubMed Google Scholar, 33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). gp2.5, gp2.5-F232L, and gp2.5-Δ26C were applied to a Superdex 75 column (Amersham Biosciences) and eluted in buffer G (50 mm KPO4, pH 7.0, 150 mm NaCl, 0.1 mm EDTA, 10% glycerol) at 4 °C. The fractional retention, K av, was calculated for each of the standard proteins using the equation K av = (V e – V 0)/(V t – V 0). A plot of K av value versus log10 M r generated an equation, and from this the molecular weight of each gene 2.5 variant could be approximated based on its peak elution volume. Electrophoretic Mobility Shift Assay—The binding of gp2.5 to ssDNA was performed on a 70-mer oligonucleotide using a modification of an electrophoretic mobility shift assay described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 34Hyland E.M. Rezende L.F. Richardson C.C. J. Biol. Chem. 2003; 278: 7247-7256Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar, 37Talor J. Ackroyd A. Halford S. Kneale G. Methods in Molecular Biology: DNA-Protein Interactions: Principles and Protocols. Vol. 30. Humana Press Inc., Totowa, NJ1994: 263-279Google Scholar). The oligonucleotide was radioactively labeled at its 5′ terminus with 32P using T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP. The labeled oligonucleotide was purified using micro Bio-Spin P-30 chromatography columns (Bio-Rad). The reactions (15 μl) for measuring the mobility shift contained 3.3 nm32P-labeled 70-mer oligonucleotide and various concentrations (from 0 to 16,000 nm) of gp2.5 diluted in buffer containing 20 mm Tris-Cl, pH 7.5, 10 mm β-mercaptoethanol, and 500 μg/ml bovine serum albumin. The reaction buffer contained 15 mm MgCl2, 5 mm dithiothreitol, 50 mm KCl, 10% glycerol, 0.01% bromphenol blue. Reactions were performed on ice for 15 min, loaded onto 10% TBE pre-cast gels (Bio-Rad), and run at 300 V for 10 min and 170 V for 40 min at 4 °C using 0.5× Tris-glycine running buffer (12.5 m Tris base, 95 mm glycine, 0.5 mm EDTA). Gels were dried and exposed to a FujiX PhosphorImager plate, and the fraction of DNA bound by gp2.5 was measured using ImageQuant software. Binding of gp2.5 ssDNA for Electron Microscopy—wt and altered gp2.5 were diluted to 50 ng/ml in 20 mm Hepes/NaOH, pH 7.5, 20% glycerol and then mixed with wt M13 ssDNA at 10 ng/ml in a buffer containing 10 mm Hepes, pH 7.5, 50 mm NaCl final concentration. Binding reactions with protein to DNA ratios (g/g) ranging from 40:1 for wt gp2.5 protein to 10:1 for mutant protein were incubated for 15 min at room temperature in a 10-μl total reaction volume. Electron Microscopy—gp2.5 bound to ssDNA was fixed with an equal volume of 1.2% glutaraldehyde for 5 min at room temperature. Sample volume was increased to 50 μl with a buffer containing spermidine (38Griffith J.D. Christiansen G. Cold Spring Harbor Symp. Quant. Biol. 1978; 42: 215-226Crossref PubMed Google Scholar) and quickly applied to a mesh copper grid coated with a thin carbon film, glow-charged shortly before sample application. Following adsorption of the samples to the EM support for 1–2 min, the grids were subjected to a dehydration procedure in which the water content of the washes was gently replaced by a serial increase in ethanol concentration to 100% and then air-dried. The samples were then rotary shadowcast with tungsten at 10–7 torr and examined in a Philips CM 12 TEM instrument at 40 kV. Micrographs, taken at ×46,000, were scanned using a Nikon LS-4500AF film scanner, and panels were arranged using Adobe Photoshop. Expression and Purification of Gene 2.5 Histidine Fusion Proteins— pET19bPPS2.5, pET19bPPS-F232L, and pET19bPPS-Δ26C were transformed into E. coli BL21 (DE3) competent cells. One-liter cultures of each were grown in LB media containing ampicillin, and the cells induced at 37 °C were harvested as described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). The cell pellet was resuspended in 25 ml of buffer B (50 mm Tris-Cl, pH 7.5, 500 mm NaCl, 70 mm imidazole). Following three freeze-thaw cycles, the cells were lysed by incubation for 1 h at 4 °C with lysozyme at a final concentration of 0.5 mg/ml. The cell debris was collected by centrifugation at 8,000 × g for 30 min at 4 °C, and the supernatant was filtered through a 0.22-μm bottle top filter. The resulting filtrate was introduced onto a nickel-nitrilotriacetic acid-agarose column (Qiagen) with a bed volume of 5 ml. The resin was washed with 10 column volumes of buffer B, and the protein was eluted in 8 ml of buffer B containing 500 mm imidazole. Each protein was then dialyzed against buffer S and stored at –20 °C. Surface Plasmon Resonance Analysis of T7 DNA Polymerase-gp2.5 Interaction—The interaction of gp2.5 with T7 DNA polymerase was examined using surface plasmon resonance as described previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). DNA Synthesis Catalyzed by T7 DNA Polymerase—The assay for T7 DNA polymerase was a modification of one described previously (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson C.C. Mol. Cell. 1998; 1: 1001-1010Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 15Huber H.E. Tabor S. Richardson C.C. J. Biol. Chem. 1987; 262: 16212-16223Abstract Full Text PDF PubMed Google Scholar, 20Kong D. Richardson C.C. J. Biol. Chem. 1998; 273: 6556-6564Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). The reaction mixture contained 50 mm Tris-Cl, pH 7.5, 10 mm MgCl2, 50 mm potassium glutamate, 100 μg/μl bovine serum albumin, and the indicated ssDNA-binding proteins. For the assay of stimulation of DNA synthesis by ssDNA-binding proteins, poly(dA)390-(dT)22 was used as a primer-template. A final concentration of 10 nm T7 DNA polymerase was added in the reaction. The reactions were carried out at 25 °C as described previously (15Huber H.E. Tabor S. Richardson C.C. J. Biol. Chem. 1987; 262: 16212-16223Abstract Full Text PDF PubMed Google Scholar). For the assay of stimulation of strand displacement activity of T7 DNA polymerase by ssDNA-binding proteins, primed M13 ssDNA was used as template. A final concentration of 100 nm T7 DNA polymerase was added in the reaction. The reaction was carried out at 37 °C. The reaction mixtures were preincubated for 5 min, and the reactions were initiated by the addition of T7 DNA polymerase. Five-μl aliquots were withdrawn at the indicated times and the reactions quenched by adding EDTA to a final concentration of 25 mm. The reaction mixture was transferred to Whatman DE81 filter, dried at room temperature for 30 min, and then washed with 0.3 m ammonium formate, pH 8.0, four times and once with 95% ethanol. The filters were dried, and the radioactivity retained on the filters was determined by scintillation counting. Alkaline-Agarose Gel Electrophoresis—Alkaline-agarose gels were prepared as described (39Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 6.12-6.21Google Scholar). Ten μl of DNA synthesis reaction samples were added to 5 μl of alkaline loading buffer containing 0.25% bromphenol, 0.25% xylene cyanol FF, 30% glycerol, 50 mm NaOH, and 1 mm EDTA. The sample was loaded onto the gel and electrophoresed at 25 V for 14–18 h at room temperature. The gel was dried and exposed to a FujiX PhosphorImager plate, and the fraction of DNA bound by gp2.5 protein was measured using ImageQuant software. gp2.5-F232L Is a Dimer—wt gp2.5 is a homodimer in solution with a molecular weight of 51,124 (7Kim Y.T. Tabor S. Bortner C. Griffith J.D. Richardson C.C. J. Biol. Chem. 1992; 267: 15022-15031Abstract Full Text PDF PubMed Google Scholar). gp2.5-Δ21C, lacking the 21 carboxyl-terminal residues, on the other hand, is a monomer in solution (32Kim Y.T. Richardson C.C. J. Biol. Chem. 1994; 269: 5270-5278Abstract Full Text PDF PubMed Google Scholar). To ascertain whether gp2.5-F232L is a monomer or dimer, we estimated its molecular weight by gel filtration analysis. wt gp2.5 and gp2.5-F232L eluted from a Superdex 75 column at almost the same volume, whereas gp2.5-Δ26C eluted in a considerably larger volume. By using a standard curve derived from the elution volume of four commercially available proteins standards, the molecular weight of gp2.5-F232L was estimated to be 58,000 (Fig. 1), consistent with the protein being a dimer. The value is nearly identical to that of 57,000 estimated for the wt gp2.5. As shown previously (33Rezende L.F. Hollis T. Ellenberger T. Richardson C.C. J. Biol. Chem. 2002; 277: 50643-50653Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar), gp2.5-Δ26C elutes at a volume consistent with a monomer. These results show that the single amino acid change does not disrupt dimer formation, and we conclude that the protein is likely to be properly folded. ssDNA Binding Properties of gp2.5-F232L—In a separate report we have described a gel shift assay to assess the binding of gp2.5 to ssDNA (34Hyland E.M. Rezende L.F. Richardson C.C. J. Biol. Chem. 2003; 278

Referência(s)