Lipids as Modulators of Proteolytic Activity of BACE
2005; Elsevier BV; Volume: 280; Issue: 44 Linguagem: Inglês
10.1074/jbc.m504484200
ISSN1083-351X
AutoresLucie Kalvodova, Nicoletta Kahya, Petra Schwille, Robert Ehehalt, Paul Verkade, David Drechsel, Kai Simons,
Tópico(s)Lipid Membrane Structure and Behavior
ResumoThe β-secretase, BACE, is a membrane spanning aspartic protease, which cleaves the amyloid precursor protein (APP) in the first step of proteolytic processing leading to the formation of the neurotoxic β-amyloid peptide (Aβ). Previous results have suggested that the regulation of β-secretase and BACE access to APP is lipid dependent, and involves lipid rafts. Using the baculovirus expression system, we have expressed recombinant human full-length BACE in insect cells and purified milligram amounts to homogeneity. We have studied partitioning of fluorophor-conjugated BACE between the liquid ordered and disordered phases in giant (10–150 μm) unilamellar vesicles, and found ∼20% to associate with the raft-like, liquid-ordered phase; the fraction associated with liquid-ordered phase increased upon cross-linking of raft lipids. To examine involvement of individual lipid species in modulating BACE activity, we have reconstituted the purified BACE in large (∼100 nm) unilamellar vesicles, and determined its specific activity in vesicles of various lipid compositions. We have identified 3 groups of lipids that stimulate proteolytic activity of BACE: 1) neutral glycosphingolipids (cerebrosides), 2) anionic glycerophospholipids, and 3) sterols (cholesterol). The β-secretase, BACE, is a membrane spanning aspartic protease, which cleaves the amyloid precursor protein (APP) in the first step of proteolytic processing leading to the formation of the neurotoxic β-amyloid peptide (Aβ). Previous results have suggested that the regulation of β-secretase and BACE access to APP is lipid dependent, and involves lipid rafts. Using the baculovirus expression system, we have expressed recombinant human full-length BACE in insect cells and purified milligram amounts to homogeneity. We have studied partitioning of fluorophor-conjugated BACE between the liquid ordered and disordered phases in giant (10–150 μm) unilamellar vesicles, and found ∼20% to associate with the raft-like, liquid-ordered phase; the fraction associated with liquid-ordered phase increased upon cross-linking of raft lipids. To examine involvement of individual lipid species in modulating BACE activity, we have reconstituted the purified BACE in large (∼100 nm) unilamellar vesicles, and determined its specific activity in vesicles of various lipid compositions. We have identified 3 groups of lipids that stimulate proteolytic activity of BACE: 1) neutral glycosphingolipids (cerebrosides), 2) anionic glycerophospholipids, and 3) sterols (cholesterol). Amyloid precursor protein (APP) 2The abbreviations used are: APP, amyloid precursor protein; BACE, beta site amyloid cleaving enzyme; PA, phosphatidic acid; PC, phosphatidylcholine; POPC, palmitoyloleoyl phosphatidylcholine; DOPC, dioleoylphosphatidylcholine; PS, phosphatidylserine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; SM, sphingomyelin; DRMs, detergent-resistant membranes; GUV, giant unilamellar vesicle; LUV, large unilamellar vesicle; lo, liquid ordered; ld, liquid disordered; TBLE, total brain lipid extract; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; MOPS, 4-morpholinepropanesulfonic acid. 2The abbreviations used are: APP, amyloid precursor protein; BACE, beta site amyloid cleaving enzyme; PA, phosphatidic acid; PC, phosphatidylcholine; POPC, palmitoyloleoyl phosphatidylcholine; DOPC, dioleoylphosphatidylcholine; PS, phosphatidylserine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; SM, sphingomyelin; DRMs, detergent-resistant membranes; GUV, giant unilamellar vesicle; LUV, large unilamellar vesicle; lo, liquid ordered; ld, liquid disordered; TBLE, total brain lipid extract; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; MOPS, 4-morpholinepropanesulfonic acid. is an abundant type I membrane protein with homology to glycosylated cell surface receptors (1Kang J. Lemaire H.G. Unterbeck A. Salbaum J.M. Masters C.L. Grzeschik K.H. Multhaup G. Beyreuther K. Muller-Hill B. Nature. 1987; 325: 733-736Crossref PubMed Scopus (3930) Google Scholar) found in various mammalian tissues. Proteolytic processing of APP in human brain may give rise to the Aβ peptide, which is the major constituent of amyloid plaques in brains of patients suffering from Alzheimer disease (2Selkoe D.J. Curr. Opin. Neurobiol. 1994; 4: 708-716Crossref PubMed Scopus (100) Google Scholar, 3Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5135) Google Scholar). APP is a substrate for at least 3 proteolytic ("secretase") activities (4De Strooper B. Annaert W. J. Cell Sci. 2000; 113: 1857-1870Crossref PubMed Google Scholar) designated α, β, and γ. The major proteolytic pathway, undertaken by ∼95% of the APP in neurons, is α-γ, i.e. APP is first cleaved by a α-secretase within the Aβ region, and consequently by the γ-secretase. The second proteolytic pathway, which leads to the formation of Aβ, is the β-γ pathway. In this case, APP is first cleaved by the β-secretase (BACE, beta-site amyloid cleaving enzyme (5Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar) to allow further processing by the γ-secretase to produce the 4-kDa Aβ peptide. Even though it is not the β-cleavage itself that would per se lead to the plaque formation, but rather the misfolding and aggregation of the generated peptide, up-regulation of the β-secretase activity is an issue in amyloidogenesis. Hence it is necessary to establish how access of the secretases to APP is regulated, and how are the proteolytic activities of the individual secretases modulated. One obvious way of restricting a contact between two different membrane proteins is confining them into distinct cellular compartments, and/or possibly dispatching them to separate trafficking routes. To a certain extent, access of BACE and other secretases to APP may be limited in this way (both APP and BACE cycle between the cell surface and intracellular membrane compartments). Because trafficking largely relies on interacting proteins responsible for sorting, modifying (e.g. phosphorylation), and "packing" of the cargo, these are also candidates for involvement in β-cleavage regulation (6Russo T. Faraonio R. Minopoli G. De Candia P. De Renzis S. Zambrano N. FEBS Lett. 1998; 434: 1-7Crossref PubMed Scopus (97) Google Scholar, 7He X. Chang W.P. Koelsch G. Tang J. FEBS Lett. 2002; 524: 183-187Crossref PubMed Scopus (106) Google Scholar). Another way to restrict contact between two different membrane proteins is by differential partitioning into distinct membrane microdomains, lipid rafts (8Simons K. Ikonen E. Nature. 1997; 387: 569-572Crossref PubMed Scopus (8052) Google Scholar). Indeed, rafts had already been implicated in APP processing (9Ehehalt R. Keller P. Haass C. Thiele C. Simons K. J. Cell Biol. 2003; 160: 113-123Crossref PubMed Scopus (913) Google Scholar). Decreased levels of cholesterol and sphingolipids, both of which are indispensable constituents of lipid rafts, correlate with reduced β-cleavage (9Ehehalt R. Keller P. Haass C. Thiele C. Simons K. J. Cell Biol. 2003; 160: 113-123Crossref PubMed Scopus (913) Google Scholar), whereas exogenously added cholesterol seems to decrease α-cleavage (10Bodovitz S. Klein W.L. J. Biol. Chem. 1996; 271: 4436-4440Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar); also ceramides, which have been suggested to play a role in subdomain organization and raft coalescence, were proposed as β-cleavage modulators (11Puglielli L. Ellis B.C. Saunders A.J. Kovacs D.M. J. Biol. Chem. 2003; 278: 19777-19783Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Besides, mutant BACE linked to a glycosylphosphatidylinositol anchor, which enhances its association with detergent-resistant membranes (DRMs), seems to cleave APP more efficiently than the wild type BACE (12Cordy J.M. Hussain I. Dingwall C. Hooper N.M. Turner A.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 11735-11740Crossref PubMed Scopus (310) Google Scholar). There is a large body of experimental work done on cells in culture as well as ex vivo concerning partitioning of APP and BACE into DRMs (13Rouvinski A. Gahali-Sass I. Stav I. Metzer E. Atlan H. Taraboulos A. Biochem. Biophys. Res. Commun. 2003; 308: 750-758Crossref PubMed Scopus (25) Google Scholar, 14Bouillot C. Prochiantz A. Rougon G. Allinquant B. J. Biol. Chem. 1996; 271: 7640-7644Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 15Riddell D.R. Christie G. Hussain I. Dingwall C. Curr. Biol. 2001; 11: 1288-1293Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar, 16Simons M. Keller P. De Strooper B. Beyreuther K. Dotti C.G. Simons K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6460-6464Crossref PubMed Scopus (1079) Google Scholar). Despite the usefulness of probing DRM association in early stages of characterization of the proteins, and especially for detecting changes in interactions of membrane components, this type of experimental approach cannot provide adequate insight into raft connections to APP processing. Possibilities to manipulate lipid composition of the cell membranes are limited, and often do not deliver clear-cut results because the risk of secondary effects is high (disruption of the SNARE clusters required for exocytosis (17Lang T. Bruns D. Wenzel D. Riedel D. Holroyd P. Thiele C. Jahn R. EMBO J. 2001; 20: 2202-2213Crossref PubMed Scopus (533) Google Scholar), block of the clathrin-coated pit formation (18Rodal S.K. Skretting G. Mol. Biol. Cell. 1999; 10: 961-974Crossref PubMed Scopus (820) Google Scholar, 19Subtil A. Gaidarov I. Kobylarz K. Lampson M.A. Keen J.H. McGraw T.E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6775-6780Crossref PubMed Scopus (483) Google Scholar), phosphatidylinositol (4,5)-bisphosphate delocalization from the plasma membrane (20Pike L.J. Miller J.M. J. Biol. Chem. 1998; 273: 22298-22304Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar)). In addition, β-secretase activity is likely to be regulated by direct modulation of the enzymatic activity of BACE. One such regulatory factor is the pH of the surrounding aqueous environment; another mechanism engages membrane lipids, either directly interacting with BACE as cofactors or costructures, or simply providing optimal bulk membrane properties. In this paper we therefore set about to characterize the lipid requirements for β-cleavage in an artificial, reconstituted system composed of purified proteins and defined lipids. Our data demonstrate that lipids directly regulate proteolytic activity of BACE. Reagents—Lipids were purchased from Avanti Polar Lipids as chloroform solutions or in powder form, and were used without further purification. Gangliosides, PC, PE, PS, and cerebrosides were from porcine brain, whereas PA was from egg PC, and PI from bovine liver. POPC and DOPC were synthetic. Triton X-100 was from Fluka, and dodecylmaltoside and HEGA10 detergents were acquired from Anatrace. OptiPrep density gradient media was from Axis-Shield (Oslo, Norway). Cell culture media and the NuPAGE 4–12% BisTris gels were from Invitrogen. IgG-Sepharose 6 Fast Flow, glutathione-Sepharose beads, and the amino-reactive dye CY5 was purchased from Amersham Biosciences, and the DiO fluorescent lipid analog as well as Alexa 488-cholera toxin subunit B conjugate were from Molecular Probes. All other chemicals were from Sigma and Merck. The recombinant human BACE ectodomain was from Oncogene, and the fluorogenic soluble peptide substrate for BACE (FS-1) was purchased from Bachem. Rabbit polyclonal antibody 7523 against BACE ectodomain was a kind gift from Christian Haass. Constructs, Primers, and Baculovirus Generation—Human wile type BACE1a was amplified by PCR with primers the introducing NcoI (containing initial ATG) site at the 5′ (CGTAGGCCATGGCCCAAGCCCTGCCCTGGCTC) end and XhoI at the 3′ end (GGAATTCTTAGCTCGAGCCCTTAAGCAGGGAGATGTCATCAGC). BACE was fused to a C-terminal TAP tag via a protease-resistant linker of the sequence (SSGPSGS) followed by the PreScission protease cleavage site (LEVLFQ|GP). The overall modular structure of the construct was thus BACE-linker-PreScission-TAP, which was cloned into the pFastBac vector (Invitrogen) under the control of the polyhedrin promoter. The recombinant baculovirus was generated according to the manufacturer's instructions. BACE Expression and Purification—All buffers used throughout the procedure were based on 50 mm HEPES, pH 7.25, 150 mm NaCl (HBS). The SF+ (Protein Sciences) cells were grown in suspension in a serumfree medium (SF900 II SFM) at 27 °C, and were infected with the recombinant baculovirus at the cell density of 1.5 × 10-6 cells/ml. The virus stock was roughly titrated by expression levels as judged from Western blotting. Cells were collected by centrifugation (30 min, 400 × g) 48 h post-infection, and frozen and stored at -80 °C. BACE was purified from isolated membranes of the collected cells. Cells were homogenized in the presence of protease inhibitors (chymostatin, 6 mg/ml; leupeptin, 0.5 μg/ml; antipain 10 μg/ml; aprotinin, 2 μg/ml; pepstatin, 0.7 μg/ml; 4-aminophenylmethane sulfonyl fluoride; 10 μg/ml; and E64, 0.1 mm) in HBS buffer containing 0.25 m sucrose in a hand-held glass homogenizer (20–30 strokes). The homogenate was centrifuged at ∼100,000 × g for 45 min at 4 °C. The supernatant was removed, and the resulting pellet was resuspended with the help of the glass homogenizer in HBS + 1% (w/v) dodecylmaltoside, supplemented with protease inhibitors. The lysate was incubated at room temperature with stirring for ∼30 min, followed by centrifugation at ∼100,000 × g for 45 min at 4 °C. The resulting supernatant was immediately loaded on an equilibrated IgG-Sepharose column (1.5-ml beads for 1-liter cell cultures) and washed with 10 column volumes of the running buffer (RB) (HBS + 5% glycerol, 0.5% (w/v) Triton X-100, pH 7.6), 1 column volume of RB + 5 mm ATP, 2 column volumes of RB, 2 column volumes of RB 2 mm EDTA, and finally 5 column volumes of RB. The flow was then stopped and ∼150 μl of the PreScission protease (0.5 mg/ml) was added to the beads, mixed, and incubated either 3–4 h at room temperature or 12–16 h at 4 °C. The tagless protein was then eluted at a concentration of 0.25–0.5 mg/ml with RB supplemented with 10–50% glycerol. To remove the PreScission protease (glutathione S-transferase-tagged), the eluate was incubated with glutathione transferase beads for ∼30 min, and the beads were removed by centrifugation. Purified BACE was stored at 4 °C, or mixed with 50% glycerol and stored at -20 °C, or frozen in liquid nitrogen for long-term storage. Preparation of Large Unilamellar Vesicles (LUVs)—Large unilamellar vesicles were prepared from a hydrated suspension of multilamellar vesicles by extrusion. Briefly, lipids were mixed in chloroform in a borosilicate glass test tube, and the solvent was evaporated under a stream of nitrogen for ∼1 h. The dry lipid film (which was consequently left under vacuum when the original volume of organic solvent was greater than 200 μl) was then hydrated with the LUV buffer (50 mm HEPES, 150 mm NaCl, 0.2 mm EDTA, pH 7.25), which was preheated to or above Tm of the lipid mixture. Hydration was carried out at or above the Tm with occasional vortexing for at least 30 min, or until the suspension appeared homogenous. The resulting suspension was subjected to 3–4 freeze-thaw cycles, and finally extruded through 100-nm pore diameter polycarbonate membrane using the Avanti mini-extruder. Reconstitution of BACE to Form Proteoliposomes—Typically, LUVs were diluted to ∼1 mg/ml, and the HEGA10 detergent was added to the final concentration corresponding to the "onset of solubilization" (23Rigaud J.L. Braz. J. Med. Biol. Res. 2002; 35: 753-766Crossref PubMed Scopus (58) Google Scholar), which was determined by turbidity measurements. Typically, this value would be ∼0.26% (w/v), differing slightly for each lipid mixture. The liposomes were then incubated for 10 min at room temperature to allow the detergent to equilibrate between the aqueous phase and the liposomes, and consequently, concentrated BACE (0.25–0.5 mg/ml in 0.4–0.5% Triton X-100 and 10–50% glycerol) was added at a protein to lipid ratio 1:70 to 1:150 (w/w). The Triton X-100 concentration was maintained safely below the critical micellular concentration of Triton X-100 (typically 80% ectodomain outside, supplemental Fig. S2) in large unilamellar vesicles; the yield was typically 15–30% of protein input by weight. The sidedness of the insertion did not depend on the lipid composition of the vesicles. Stable membrane-spanning insertion of BACE was confirmed by treatment with 0.1 m Na2CO3, pH 11.3, followed by flotation in a density gradient. Virtually all BACE (as judged by silver stained SDS-PAGE) remained associated with the lipids (floating fraction, supplemental Fig. S3). In addition, we performed immunoelectron microscopy of the total brain lipid proteoliposomes. We observed vesicles ∼50–200 nm in diameter, heavily labeled with anti-BACE antibody (Fig. 2). Virtually all immunodetected BACE was found to be membrane associated. The specific activity of BACE reconstituted in total brain lipid vesicles was at least 3-fold higher than that of the purified BACE in 0.02% Triton X-100, as judged by cleavage of the soluble fluorogenic substrate, which mimics the cleavage site of the Swedish APP mutant. Proteoliposomes consisting of BACE and total brain lipids were characterized by high reconstitution efficiency, reproducible activity, and stability (activity remains unchanged for several months when stored at 4 °C). BACE reconstituted in total brain lipid liposomes was therefore chosen as a standard, and reconstitution in total brain lipid liposomes was always performed as a control together with other samples. In this paper, we express specific activity of BACE as a percentage of the specific activity determined for brain lipid proteoliposomes. Activity in Complex Lipid Mixtures—There are hundreds of lipid species present in cells, and the reasons for such diversity are poorly understood. One way to study this complexity is to analyze how lipids regulate activities of membrane proteins in a reconstituted system. We therefore dissected the total brain lipid extract, and attempted to elucidate which lipid species are responsible for supporting BACE activity. As a control, a mixture mimicking the total brain lipid extract was mixed from individual components based on the known glycerophospholipid composition (data from Avanti catalog) and estimated amounts (TLC) of SM, glycosphingolipids, and cholesterol. The composition was as follows: PC:PE:SM:cerebrosides:cholesterol:gangliosides:PS:PA:PI (10:17:27:10:15:5:11:3:2, w/w). BACE activity in this mixture was determined to be 95 ± 12% of TBLE (total brain lipid extract). Because interpretation of the effects caused by a particular lipid species in complex lipid mixtures such as total brain lipids is problematic, we proceeded to investigate BACE activity in various simpler lipid mixtures of defined head group compositions, ranging from simple pseudobinary mixtures to more complicated mixtures of up to 6 components. Specific Activity of BACE Reconstituted in Glycerophospholipid and Glycerophospholipid:Cholesterol Vesicles—Glycerophospholipids are the most abundant phospholipids in living cells, of which phosphatidylcholine accounts typically for up to 50% in mammalian cells. Specific activity of BACE in pure PC (brain PC or synthetic POPC) vesicles was not determined because of extremely low recoveries (<5%). It was clear, however, that specific activity in PC vesicles was severalfold (at least 3–5-fold) lower than that of BACE in TBLE vesicles. Recoveries improved somewhat when cholesterol was included, therefore POPC:cholesterol (2:1, mol/mol), was used instead. Specific activity of BACE in POPC:cholesterol vesicles is ∼5-fold lower than in TBLE vesicles (Fig. 3). It has been shown that membrane proteins often require PE for activity, PE serving as a "chaperone" (28Bogdanov M. Sun J. Kaback H.R. Dowhan W. J. Biol. Chem. 1996; 271: 11615-11618Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar) and, along with other "nonbilayer lipids," PE seems to be important for maintaining the physical state of the bilayer, allowing the membrane to readily undergo local rearrangements in response to changes in external conditions (27van der Brink-van der Laan E. Killian J.A. de Kruijff B. Biochim. Biophys. Acta. 2004; 1666: 275-288Crossref PubMed Scopus (332) Google Scholar). However, in the case of BACE, including 20% PE did not lead to any significant increase in BACE activity (26 ± 12% relative to TBLE, Fig. 3). On the other hand, there was a strong effect of negatively charged phospholipids on BACE activity. PC:PS (80:20, w/w) supported BACE activity to 58 ± 4% of TBLE, whereas mixtures of PC:PE:PS and PC:PE:PA (60:20:20, w/w) brought the specific activity of BACE virtually to the level of TBLE, resulting in 99 ± 9 and 135 ± 31% of TBLE activity, respectively (Fig. 3). Specific Activity of BACE Reconstituted in Vesicles Composed of Glycerophospholipids, (Glyco)sphingolipids, and Cholesterol—Sphingolipids and cholesterol are essential components of lipid rafts, and various pseudo-ternary mixtures of PC, SM, and cholesterol mixed at ratios that allow for ld-lo phase coexistence, have been shown to be useful to imitate lipid rafts. Specific activity of BACE in the lo phase forming mixture of PC:SM:cholesterol (1:1:1 or 2:2:1 mol/mol) did not dramatically differ from POPC:cholesterol, resulting in 29 ± 16% of TBLE activity. To assess the role of cholesterol in modulating membrane properties relevant to BACE activity, we used proteoliposomes consisting of PC:PE:SM:gangliosides supplied with increasing amounts of cholesterol (0, 7.5, and 15%, w/w) substituting for SM (25, 17.5, and 10% (w/w) final) to yield cholesterol:sphingolipid molar ratios of 0:0.4:2.5. There was an increase in BACE activity along with increasing cholesterol:sphingolipid molar ratios as follows: 18 ± 1% for PC:PE:SM:gangliosides (50:20: 25:5, w/w), 28 ± 1% for PC:PE:SM:gangliosides:cholesterol (50:20:17.5: 5:7.5, w/w), and 36 ± 1% TBLE for PC:PE:SM:gangliosides:choleste
Referência(s)