Regulation of Zipper-interacting Protein Kinase Activity in Vitro and in Vivo by Multisite Phosphorylation
2004; Elsevier BV; Volume: 280; Issue: 10 Linguagem: Inglês
10.1074/jbc.m412538200
ISSN1083-351X
AutoresPaul R. Graves, Karen M. Winkfield, Timothy Haystead,
Tópico(s)Biochemical and Structural Characterization
ResumoZipper-interacting protein kinase (ZIPK) is a widely expressed serine/threonine kinase implicated in cell death and smooth muscle contractility, but its mechanism of regulation is unknown. We have identified six phosphorylation sites in ZIPK that regulate both its enzyme activity and localization, including Thr180, Thr225, Thr265, Thr299, Thr306, and Ser311. Mutational analysis showed that phosphorylation of Thr180 in the kinase activation T-loop, Thr225 in the substrate-binding groove, and Thr265 in kinase subdomain X is essential for full ZIPK autophosphorylation and activity toward exogenous substrates. Abrogation of phosphorylation of Thr299, Thr306, and Ser311 had little effect on enzyme activity, but mutation of Thr299 and Thr300 to alanine resulted in redistribution of ZIPK from the cytosol to the nucleus. Mutation of Thr299 alone to alanine caused ZIPK to assume a diffuse cellular localization, whereas T299D redistributed the enzyme to the cytoplasm. C-terminal truncations of ZIPK at amino acid 273 or 342 or mutation of the leucine zipper motif increased ZIPK activity toward exogenous substrates by severalfold, suggesting a phosphorylation-independent autoinhibitory role for the C-terminal domain. Additionally, mutation of the leucine zipper reduced the ability of ZIPK to oligomerize and also caused ZIPK to relocalize from the cytoplasm to the nucleus in vivo. Together, our findings show that ZIPK is positively regulated by phosphorylation within its kinase domain and that it contains an inhibitory C-terminal domain that controls enzyme activity, localization, and oligomerization. Zipper-interacting protein kinase (ZIPK) is a widely expressed serine/threonine kinase implicated in cell death and smooth muscle contractility, but its mechanism of regulation is unknown. We have identified six phosphorylation sites in ZIPK that regulate both its enzyme activity and localization, including Thr180, Thr225, Thr265, Thr299, Thr306, and Ser311. Mutational analysis showed that phosphorylation of Thr180 in the kinase activation T-loop, Thr225 in the substrate-binding groove, and Thr265 in kinase subdomain X is essential for full ZIPK autophosphorylation and activity toward exogenous substrates. Abrogation of phosphorylation of Thr299, Thr306, and Ser311 had little effect on enzyme activity, but mutation of Thr299 and Thr300 to alanine resulted in redistribution of ZIPK from the cytosol to the nucleus. Mutation of Thr299 alone to alanine caused ZIPK to assume a diffuse cellular localization, whereas T299D redistributed the enzyme to the cytoplasm. C-terminal truncations of ZIPK at amino acid 273 or 342 or mutation of the leucine zipper motif increased ZIPK activity toward exogenous substrates by severalfold, suggesting a phosphorylation-independent autoinhibitory role for the C-terminal domain. Additionally, mutation of the leucine zipper reduced the ability of ZIPK to oligomerize and also caused ZIPK to relocalize from the cytoplasm to the nucleus in vivo. Together, our findings show that ZIPK is positively regulated by phosphorylation within its kinase domain and that it contains an inhibitory C-terminal domain that controls enzyme activity, localization, and oligomerization. Regulation of zipper-interacting protein kinase activity in vitro and in vivo by multisite phosphorylation. Vol. 280 (2005) 9363–9374Journal of Biological ChemistryVol. 280Issue 24PreviewPage 9373, under "Acknowledgments": The following was inadvertently omitted from this section: A cDNA clone expressing the full-length sequence of human ZIP kinase was very kindly provided by Dr. Hiroshi Hosoya (Department of Biological Sciences, Graduate School of Science, Hiroshima University, Higashi-Hiroshima, Japan). Full-Text PDF Open Access Zipper-interacting protein kinase (ZIPK) 1The abbreviations used are: ZIPK, zipper-interacting protein kinase; DAPK, death-associated protein kinase; HEK293, human embryonic kidney 293; WT, wild-type; HPLC, high performance liquid chromatography; ESI-MS, electrospray ionization mass spectrometry; MS/MS, tandem mass spectrometry; PBS, phosphate-buffered saline; GFP, green fluorescent protein; MAPK, mitogen-activated protein kinase. is a serine/threonine protein kinase that has been functionally linked to cell motility (1Komatsu S. Ikebe M. J. Cell Biol. 2004; 165: 243-254Crossref PubMed Scopus (77) Google Scholar), smooth muscle contractility (2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar, 3Borman M.A. MacDonald J.A. Muranyi A. Hartshorne D.J. Haystead T.A. J. Biol. Chem. 2002; 277: 23441-23446Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 4Karim S.M. Rhee A.Y. Given A.M. Faulx M.D. Hoit B.D. Brozovich F.V. Circ. Res. 2004; 95: 612-618Crossref PubMed Scopus (39) Google Scholar), and cell death processes (5Kawai T. Matsumoto M. Takeda K. Sanjo H. Akira S. Mol. Cell. Biol. 1998; 18: 1642-1651Crossref PubMed Scopus (202) Google Scholar, 6Kawai T. Akira S. Reed J.C. Mol. Cell. Biol. 2003; 23: 6174-6186Crossref PubMed Scopus (85) Google Scholar). ZIPK is a member of a larger family of protein kinases known as the death-associated protein kinases, which include DAPK, DRP-1 (DAPK-related protein-1), DRAK1, and DRAK2 (7Cohen O. Kimchi A. Cell Death Differ. 2001; 8: 6-15Crossref PubMed Scopus (105) Google Scholar). ZIPK itself is composed of an N-terminal protein kinase domain and a C-terminal domain that contains a leucine zipper motif. ZIPK shares 80% identity within its kinase domain with DAPK, but shows no homology in its C-terminal domain to other DAPK family members and, in contrast to DAPK, does not contain a death or calmodulin-binding domain, and its activity is regulated independently of calcium (8Shohat G. Shani G. Eisenstein M. Kimchi A. Biochim. Biophys. Acta. 2002; 1600: 45-50Crossref PubMed Scopus (63) Google Scholar). Like other members of the DAPK family, ZIPK causes cell death upon overexpression in a variety of cell types, suggesting that the enzyme may play a role in apoptosis (5Kawai T. Matsumoto M. Takeda K. Sanjo H. Akira S. Mol. Cell. Biol. 1998; 18: 1642-1651Crossref PubMed Scopus (202) Google Scholar, 6Kawai T. Akira S. Reed J.C. Mol. Cell. Biol. 2003; 23: 6174-6186Crossref PubMed Scopus (85) Google Scholar, 9Kogel D. Plottner O. Landsberg G. Christian S. Scheidtmann K.H. Oncogene. 1998; 17: 2645-2654Crossref PubMed Scopus (99) Google Scholar). Cells that overexpress ZIPK typically show signs of rounding, membrane blebbing, DNA fragmentation, and detachment from the matrix. However, it remains unclear what the mechanism of cell death is since some indicators of apoptosis, such as caspase-3 activation and poly(ADP-ribose) polymerase cleavage, are not associated with ZIPK overexpression (10Shani G. Marash L. Gozuacik D. Bialik S. Teitelbaum L. Shohat G. Kimchi A. Mol. Cell. Biol. 2004; 24: 8611-8626Crossref PubMed Scopus (97) Google Scholar). It has been argued that cell death induced by ZIPK and other DAPK family members may be a result of autophagy as opposed to apoptosis (10Shani G. Marash L. Gozuacik D. Bialik S. Teitelbaum L. Shohat G. Kimchi A. Mol. Cell. Biol. 2004; 24: 8611-8626Crossref PubMed Scopus (97) Google Scholar). Some insight into the phenotype caused by the overexpression of ZIPK may be gained from studying its candidate substrate proteins. Like other members of the DAPK family, ZIPK is capable of phosphorylating smooth muscle and non-muscle myosin light chains (1Komatsu S. Ikebe M. J. Cell Biol. 2004; 165: 243-254Crossref PubMed Scopus (77) Google Scholar, 2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar, 3Borman M.A. MacDonald J.A. Muranyi A. Hartshorne D.J. Haystead T.A. J. Biol. Chem. 2002; 277: 23441-23446Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 11Murata-Hori M. Suizu F. Iwasaki T. Kikuchi A. Hosoya H. FEBS Lett. 1999; 451: 81-84Crossref PubMed Scopus (116) Google Scholar). Indeed, phosphorylation of myosin light chain is known to cause reorganization of the actin cytoskeleton, and this could explain, at least in part, some of the cellular phenotypes observed with ZIPK overexpression such as membrane blebbing and cell rounding (13Murata-Hori M. Fukuta Y. Ueda K. Iwasaki T. Hosoya H. Oncogene. 2001; 20: 8175-8183Crossref PubMed Scopus (76) Google Scholar, 14Bialik S. Bresnick A.R. Kimchi A. Cell Death Differ. 2004; 11: 631-644Crossref PubMed Scopus (79) Google Scholar). ZIPK has also been implicated in smooth muscle contraction and relaxation. Smooth muscle contraction is regulated by the phosphorylation state of myosin light chain, which is regulated, in part, by the myosin light chain phosphatase SMPP-1M (15Hartshorne D.J. Ito M. Erdodi F. J. Biol. Chem. 2004; 279: 37211-37214Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). SMPP-1M is a phosphoprotein, and phosphorylation of at least two sites (Thr696 and Ser850) within its 110–130-kDa regulatory subunit, MYPT1 (myosin phosphatase targeting subunit-1), inhibits phosphatase activity (2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar, 16Lontay B. Serfozo Z. Gergely P. Ito M. Hartshorne D.J. Erdodi F. J. Comp. Neurol. 2004; 478: 72-87Crossref PubMed Scopus (30) Google Scholar, 17Muranyi A. MacDonald J.A. Deng J.T. Wilson D.P. Haystead T.A. Walsh M.P. Erdodi F. Kiss E. Wu Y. Hartshorne D.J. Biochem. J. 2002; 366: 211-216Crossref PubMed Google Scholar, 18Velasco G. Armstrong C. Morrice N. Frame S. Cohen P. FEBS Lett. 2002; 527: 101-104Crossref PubMed Scopus (181) Google Scholar, 19Kimura K. Ito M. Amano M. Chihara K. Fukata Y. Nakafuku M. Yamamori B. Feng J. Nakano T. Okawa K. Iwamatsu A. Kaibuchi K. Science. 1996; 273: 245-248Crossref PubMed Scopus (2444) Google Scholar). MYPT1 is phosphorylated and inhibited during calcium sensitization, a process in which muscle contraction occurs at constant concentrations of calcium (20Somlyo A.P. Somlyo A.V. Nature. 1994; 372: 231-236Crossref PubMed Scopus (1733) Google Scholar). To better understand how SMPP-1M is regulated, a proteomics approach was performed to identify protein kinases in smooth muscle capable of phosphorylating MYPT1. A protein kinase that associated with and phosphorylated Thr696 of MYPT1 was identified as a fragment of ZIPK (2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar). More recently, it was shown that ZIPK is the major MYPT1-associated kinase in smooth muscle aortic cells (4Karim S.M. Rhee A.Y. Given A.M. Faulx M.D. Hoit B.D. Brozovich F.V. Circ. Res. 2004; 95: 612-618Crossref PubMed Scopus (39) Google Scholar). Other targets for ZIPK in smooth muscle that may contribute to the Ca2+-sensitizing effects of the enzyme, including the SMPP-1M inhibitor protein CPI-17 (21MacDonald J.A. Eto M. Borman M.A. Brautigan D.L. Haystead T.A. FEBS Lett. 2001; 493: 91-94Crossref PubMed Scopus (103) Google Scholar) and myosin light chain itself (1Komatsu S. Ikebe M. J. Cell Biol. 2004; 165: 243-254Crossref PubMed Scopus (77) Google Scholar, 2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar, 12Niiro N. Ikebe M. J. Biol. Chem. 2001; 276: 29567-29574Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar), have also been identified. Direct evidence in support of a role for ZIPK in Ca2+ sensitization has come from experiments showing that addition of the purified recombinant enzyme to Triton X-100-skinned muscle fibers causes profound contraction at submaximal Ca2+ concentrations (3Borman M.A. MacDonald J.A. Muranyi A. Hartshorne D.J. Haystead T.A. J. Biol. Chem. 2002; 277: 23441-23446Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Although the mechanism of ZIPK regulation is unknown, evidence suggests that ZIPK is regulated by phosphorylation in vivo. First, ZIPK phosphorylation and activity are increased in smooth muscle in response to carbachol (2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar). Second, treatment of ZIPK with protein phosphatase inactivates the enzyme (12Niiro N. Ikebe M. J. Biol. Chem. 2001; 276: 29567-29574Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). Third, ZIPK can be phosphorylated by DAPK in vitro, and this phosphorylation was reported to control the localization of ZIPK and to affect its ability to induce cell death (10Shani G. Marash L. Gozuacik D. Bialik S. Teitelbaum L. Shohat G. Kimchi A. Mol. Cell. Biol. 2004; 24: 8611-8626Crossref PubMed Scopus (97) Google Scholar). Finally, ZIPK autophosphorylates in vitro (2MacDonald J.A. Borman M.A. Muranyi A. Somlyo A.V. Hartshorne D.J. Haystead T.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2419-2424Crossref PubMed Scopus (194) Google Scholar, 5Kawai T. Matsumoto M. Takeda K. Sanjo H. Akira S. Mol. Cell. Biol. 1998; 18: 1642-1651Crossref PubMed Scopus (202) Google Scholar). However, the phosphorylation sites and their functional significance have not been determined. We have undertaken a comprehensive study to identify ZIPK phosphorylation sites in vitro and in vivo and to determine their physiological relevance. We defined six sites of phosphorylation within ZIPK that regulate both its activity and localization within cells. We show that three sites in the conserved kinase domain (Thr180, Thr225, and Thr265) are essential for kinase activation, whereas phosphorylation of three sites in the C-terminal domain (Thr299, Thr306, and Ser311) has little effect on enzyme activity toward exogenous substrates. However, phosphorylation of ZIPK at Thr299 regulates the intracellular location of ZIPK. Collectively, these results demonstrate that ZIPK is highly regulated by multisite phosphorylation, and since five of the identified phosphorylation sites in ZIPK are conserved in other DAPK family members, our findings may have implications for the regulation of these highly related enzymes. Materials—[γ-32P]ATP was obtained from MP Biomedicals (Irvine, CA). ANTI-FLAG® M2 monoclonal antibody, 3X FLAG® peptide, and ANTI-FLAG® M2 antibody affinity gel were obtained from Sigma. Sequencing grade modified porcine trypsin (V5111) was from Promega, and chymotrypsin was obtained from Calbiochem. Anti-ZIPK antibodies directed against amino acids 279–298 were from Calbiochem, and anti-c-Myc antibody 9E10-agarose and anti-c-Myc (A-14) antibodies were from Santa Cruz Biotechnology. Plasmid Construction—For 3X FLAG-ZIPK, full-length human ZIPK was amplified by PCR using the following primers (which contain HindIII and BamHI sites, respectively): forward primer, AGTCAAGCTTTCCACGTTCAGGCAGGAGGAC; and reverse primer, CAGTGGATCCCTAGCGCAGCCCGCACTCCAC. The PCR product was digested with HindIII and BamHI and ligated into the corresponding sites in the p3XFLAG-CMV-10 expression vector (Sigma). This vector encodes three adjacent FLAG epitopes with the N-terminal sequence MDYKDHDGDYKDHDIDYKDDDDK preceding ZIPK. For Myc-ZIPK, full-length human ZIPK was amplified by PCR using the following primers (which contain XhoI and BamHI sites, respectively) to incorporate a Myc tag: forward primer, TGCACTCGAGATGGCAGAACAGAAGCTCATTTCTGAAGAAGACTTGTCCACGTTCAGGCAGGAGGAC; and reverse primer, CAGTGGATCCCTAGCGCAGCCCGCACTCCAC. The PCR product was digested with XhoI and BamHI and ligated into the corresponding sites in pcDNA3.1 (Invitrogen). This strategy encodes a Myc tag with the N-terminal sequence MAEQKLISEEDL preceding ZIPK. Site-directed Mutagenesis—All ZIPK mutants were created with the QuikChange mutagenesis kit (Stratagene) and completely sequenced for confirmation. Cell Culture, Transfections, and Expression and Purification of ZIPK—HeLa and human embryonic kidney 293 (HEK293) cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% bovine calf serum. Transfections were performed using Superfect (QIAGEN Inc.) according to the manufacturer's instructions. For expression of ZIPK, four 100-cm dishes of HEK293 cells were transfected with ZIPK DNA and incubated for 48 h. Cells were harvested and homogenized in cell lysis buffer containing 50 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1% Nonidet P-40, 1 mm dithiothreitol, 2 mm EDTA, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 100 μg/ml Pefabloc. Cell lysates were clarified by centrifugation for 15 min at 13,000 × g, and the supernatant was mixed with ANTI-FLAG® M2 antibody affinity gel for 1 h at 4 °C. The ANTI-FLAG® M2 antibody affinity gel was then washed four times with cell lysis buffer and two times with Tris-buffered saline before elution of ZIPK with 150 μm 3X FLAG® peptide in Tris-buffered saline. In Vivo Labeling with [32P]Orthophosphate—HEK293 cells were transfected with wild-type (WT) or kinase-inactive (D161A) ZIPK for 48 h, washed three times with phosphate-free medium (phosphate-free Dulbecco's modified Eagle's medium supplemented with 10% dialyzed fetal bovine serum), and incubated in phosphate-free medium for an additional 2 h. Cells were then incubated in phosphate-free medium containing 1 mCi/ml [32P]orthophosphate for an additional 4 h at 37 °C. 32P-Labeled ZIPK was isolated from cells as described above. Protein Kinase Assays and Determination of Phosphorylation Stoichiometry—Purified ZIPK from HEK293 cells was assayed for kinase activity in 30 μl of kinase reaction buffer consisting of 50 mm Tris (pH 7.5), 10 mm MgCl2, 1 mm dithiothreitol, 100 μm ATP, [γ-32P]ATP (specific activity of ∼7500 cpm/pmol), and 0.5 mg/ml myosin phosphatase regulatory subunit peptide (M110 peptide) or myosin light chain peptide. Kinase reactions were initiated by addition of ZIPK and terminated after 10 min by addition of 20 μl of 20 mm H3PO4. Aliquots of the reaction mixture (20 μl) were spotted onto P-81 papers, which were washed three times with 20 mm H3PO4 before measuring 32P incorporation by Cerenkov radiation. For ATP preincubation studies, ZIPK was incubated for the indicated times (minutes) at 4 °C in kinase reaction buffer with or without 100 μm ATP. Following preincubation, the ATP concentration for all samples was adjusted to 100 μm with [γ-32P]ATP (∼7500 cpm/pmol), and kinase assays were performed for 30 s using myosin light chain peptide as substrate. To measure the stoichiometry of ZIPK autophosphorylation, 1 μg of purified WT ZIPK was incubated in kinase reaction buffer with 2.5 mm ATP and [γ-32P]ATP (specific activity of 394,800 cpm/nmol) for 10 min at 37 °C before addition of 1 mg of bovine serum albumin and 100 μl of 100% trichloroacetic acid. Following incubation on ice for 10 min, the precipitant was collected by centrifugation at 13,000 × g and washed three times with ice-cold 10% trichloroacetic acid before 32P incorporation was measured by Cerenkov radiation. Autophosphorylation, HPLC, Edman Degradation, and Phosphoamino Acid Analysis—For autophosphorylation, purified ZIPK was incubated in kinase reaction buffer as described above with 50 μm ATP and [γ-32P]ATP (>100,000 cpm/nmol) for 30 min at 30 °C. Autophosphorylated ZIPK was resolved by 10% SDS-PAGE, visualized by silver staining, and in gel-digested with trypsin or chymotrypsin (1.5 μg) overnight at 37 °C. The protein digests were acidified by addition of 0.1% trifluoroacetic acid and applied to a reverse-phase C18 column (30 × 0.1 cm) equilibrated in 0.1% trifluoroacetic acid. The peptides were eluted from the column with a linear gradient of acetonitrile in 0.1% trifluoroacetic acid (0–60% in 60 min) at a flow rate of 1 ml/min. One-ml fractions were collected, and phosphopeptides were detected by Cerenkov radiation. Selected phosphopeptides were immobilized on Immobilon membrane (Millipore Corp.) according to the manufacturer's instructions and subjected to sequential Edman degradation with a vapor-phase amino acid sequencer (Applied Biosystems Procise 494). Phosphorylation sites were assigned with the aid of the CRP (cleaved radioactive analysis of phosphopeptides) program (available at fasta. bioch.virginia.edu/crp/). Selected phosphopeptides were also subjected to phosphoamino acid analysis. To this end, specific HPLC fractions were incubated with 5.3 m HCl at 100 °C for 1 h, followed by evaporation of the acid. Phosphoamino acids were spotted onto thin-layer cellulose plates (Fisher), and electrophoresis was carried out in one dimension for 60 min at 1000 V in buffer containing 5.9% acetic acid, 0.8% formic acid, and 0.3% pyridine at pH 2.5. Phosphoamino acid standards were visualized by spraying with 0.2% ninhydrin in acetone, and 32P was detected by autoradiography. Mass Spectrometry—Purified ZIPK from transfected HEK293 cells was in gel-digested with trypsin (0.6 μg), and the tryptic peptides were subjected to nanospray electrospray ionization mass spectrometry (ESI-MS) on an Applied Biosystems QSTAR® pulsar mass spectrometer. In some cases, ZIPK tryptic peptides were first resolved by HPLC, and individual fractions were subjected to analysis by ESI-MS. Positive mode time of flight was used to identify ZIPK peptides, and individual peptides were sequenced by ESI-MS/MS using BioAnalyst software. ZIPK Immunoprecipitation and Immunoblot Analysis—FLAG-ZIPK or Myc-ZIPK was transfected in HEK293 cells, and lysates were prepared as described above. FLAG-ZIPK or Myc-ZIPK was immunoprecipitated with FLAG-agarose or Myc-agarose, respectively, and washed four times with lysis buffer. Immunoprecipitates were boiled in SDS sample buffer, and proteins were resolved by 10% SDS-PAGE and transferred to nitrocellulose membranes. Nonspecific proteins were blocked with 5% milk in Tris-buffered saline containing 0.1% Tween 20. Membranes were incubated with ANTI-FLAG® M2 monoclonal antibody (1:10,000) or anti-c-Myc antibody (1:1000), followed by horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies (1:2000; Amersham Biosciences). Proteins were visualized using the ECL chemiluminescence system (Amersham Biosciences). Indirect Immunofluorescence Microscopy—HeLa cells (104) were grown on glass coverslips in 35-mm dishes (Fisher) for 24 h and then transfected using Superfect and allowed to grow for an additional 24 h. Coverslips were removed and washed with phosphate-buffered saline (PBS; pH 7.4), and cells were fixed with 2% paraformaldehyde in PBS for 15 min at room temperature. After fixation, cells were permeabilized with 0.1% Triton X-100 in PBS for 15 min and blocked with PBS containing 2% bovine serum albumin and 0.1% Nonidet P-40 for 30 min. After blocking, cells were incubated for 1 h with anti-FLAG antibody diluted 1:1000 in the blocking solution or with anti-c-Myc antibody (1:1000) and then washed three times with PBS containing 0.1% Nonidet P-40 for 10 min. Cells were incubated with Cy3-conjugated goat anti-mouse antibody (Jackson ImmunoResearch Laboratories, Inc.) diluted 1:200 in the blocking solution for 1 h and stained with 4′,6-diamidino-2-phenylindole at 0.1 μg/ml in 0.1% Nonidet P-40 in PBS. Following washing four times with PBS containing 0.1% Nonidet P-40, coverslips were mounted on glass slides using mounting medium (ProLong antifade kit, Molecular Probes, Inc.) and sealed with nail polish. Cells were imaged with a Zeiss Axioskop fluorescence microscope. Cell Adherence Assays—HEK293 cells were seeded in 100-cm dishes in triplicate and transfected 24 h later with a combination of ZIPK DNA (14 μg) and enhanced green fluorescent protein (GFP) DNA (2 μg). At 24 h after transfection, the medium was harvested, and the unattached cells were collected by centrifugation at 1000 × g for 5 min. Cells were washed once with PBS and then suspended in cell lysis buffer as described above. Following clarification by centrifugation at 13,000 × g for 15 min, cell lysates were measured for GFP fluorescence using a POLARstar Galaxy fluorescence plate reader (BMG LABTECH GmbH). Cell lysates prepared from the non-adherent cells were also subjected to immunoblotting for FLAG-ZIPK with anti-FLAG antibody. Identification of ZIPK Autophosphorylation Sites—It was shown previously that ZIPK undergoes autophosphorylation; but the sites of phosphorylation were not identified, and their function was not addressed (5Kawai T. Matsumoto M. Takeda K. Sanjo H. Akira S. Mol. Cell. Biol. 1998; 18: 1642-1651Crossref PubMed Scopus (202) Google Scholar). Therefore, we sought to identify all ZIPK phosphorylation sites in the full-length enzyme and to determine their significance. To this end, we transiently expressed full-length FLAG-tagged ZIPK in HEK293 cells, immunoprecipitated the enzyme with anti-FLAG antibody, and eluted it with a FLAG peptide to obtain a highly pure enzyme preparation (>90% as judged by silver staining) (Fig. 1A). If incubated with [γ-32P]ATP in vitro, purified ZIPK was found to readily autophosphorylate at serine and threonine residues (Fig. 1A). Autophosphorylation activity was abolished following mutation of Asp161 to Ala (Fig. 1A). Asp161 is part of the highly conserved DFG sequence that comprises the so-called "T-loop" of subdomain VII found in all protein kinases, and loss of this residue is likely to cause disruption of catalytic activity because of the involvement of the DFG sequence in the coordination of Mg2+ with the α- and β-phosphates of ATP (22Hanks S.K. Hunter T. FASEB J. 1995; 9: 576-596Crossref PubMed Scopus (2296) Google Scholar). In vivo labeling of ZIPK with [32P]orthophosphate showed that WT ZIPK underwent autophosphorylation in intact cells, and expression of the D161A mutant of ZIPK indicated that the majority of ZIPK phosphorylation under basal conditions was due to ZIPK autophosphorylation (Fig. 1A). To identify both the in vitro autophosphorylation and in vivo phosphorylation sites in ZIPK, the in vitro autophosphorylated enzyme and the enzyme isolated from 32P-labeled HEK293 cells were digested with trypsin. The phosphotryptic peptides were resolved by reverse-phase HPLC and collected, and the radioactivity was measured. Four distinct peaks of radioactivity were recovered from the tryptic cleavage of both the in vitro autophosphorylated and in vivo phosphorylated enzymes (Fig. 1, B and D, respectively), suggesting that the same sites are labeled in both proteins. The major difference between the in vitro and in vivo phosphorylated enzymes was the presence of an additional peak (fraction 27) present only in the in vitro phosphorylated enzyme (Fig. 1B). Phosphoamino acid analysis of fraction 27 revealed the presence of phosphothreonine and phosphotyrosine, and Edman degradation and 32P cycle release determined that the tyrosine phosphorylation occurred within the FLAG peptide sequence (data not shown). In agreement with this result, phosphoamino acid analysis of Myc-tagged ZIPK (which does not contain tyrosine in its epitope) did not reveal any phosphotyrosine (data not shown). To identify the phosphorylation sites in ZIPK, the phosphopeptides generated from the tryptic cleavage of ZIPK were cross-linked to Immobilon-P, and any radioactivity released after each round of Edman cycling was measured. As shown in Fig. 1G, the majority of the radioactivity was detected in cycles 3 and 5, with some radioactivity also detected in cycle 4 of fractions 23 and 32. Using the CRP algorithm (23MacDonald J.A. Mackey A.J. Pearson W.R. Haystead T.A. Mol. Cell. Proteomics. 2002; 1: 314-322Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 24Mackey A.J. Haystead T.A. Pearson W.R. Nucleic Acids Res. 2003; 31: 3859-3861Crossref PubMed Scopus (12) Google Scholar), we identified all possible serine and threonine residues that are 3, 4, or 5 amino acids away from an arginine or lysine (the cleavage site for trypsin). This analysis identified 15 potential phosphorylation sites at Ser51, Ser52, Ser57, Thr112, Thr180, Thr225, Thr227, Thr265, Ser288, Thr306, Ser311, Ser312, Ser371, Ser373, and Ser429. To further narrow down the candidate phosphorylation sites, phosphoamino acid analysis was performed on the phosphotryptic peptides (Fig. 1C). Phosphotryptic fraction 30 contained a cycle 3 and 5 release, and phosphoamino acid analysis indicated that only phosphothreonine was present (Fig. 1, G and C, respectively). This analysis eliminated Ser373 as a potential phosphorylation site and identified Thr180 or Thr227 as a phosphorylation site. To further narrow down the number of phosphorylation sites, autophosphorylated ZIPK was digested with chymotrypsin, and the resulting peptides were resolved by HPLC (Fig. 1E). In this case, four major peaks of radioactivity were identified, and Edman analysis of HPLC fractions 5, 22, 29, and 32 detected radioactivity at cycles 2, 1, 6, and 8, respectively (Fig. 1, E and H). Phosphoamino acid analysis of chymotryptic fraction 5 indicated that it contained only phosphothreonine (Fig. 1F) and generated a cycle 2 release, unambiguously identifying Thr180 as a ZIPK phosphorylation site (Fig. 1H). Although we could not unequivocally identify other phosphorylation sites from the chymotryptic digest of ZIPK, an Edman cycle release at positions 1, 6, and 8 is consistent with phosphorylation of Thr306, Ser311, and Thr225, respectively (Fig. 1H). To further narrow down the number of possible ZIPK phosphorylation sites, Ser-to-Ala and Thr-to-Ala point mutations were introduced at the putative phosphorylation sites. All of the ZIPK mutants ge
Referência(s)