Anchoring of Surface Proteins to the Cell Wall of Staphylococcus aureus
2004; Elsevier BV; Volume: 279; Issue: 36 Linguagem: Inglês
10.1074/jbc.m405282200
ISSN1083-351X
AutoresLuciano A. Marraffini, Hung Ton‐That, Yinong Zong, Sthanam V.L. Narayana, Olaf Schneewind,
Tópico(s)Glycosylation and Glycoproteins Research
ResumoSurface proteins of Staphylococcus aureus are anchored to the cell wall envelope by a mechanism requiring a C-terminal sorting signal with an LPXTG motif. Sortase A cleaves surface proteins between the threonine (T) and the glycine (G) residues of the LPXTG motif and catalyzes the formation of an amide bond between the carboxyl group of threonine at the C-terminal end of polypeptides and the amino group of pentaglycine cross-bridges of cell wall peptidoglycan. Previous work showed that Cys184 and His120 of sortase A are absolutely essential for catalysis; however an active site thiolateimidazolium ion pair may not be formed. The three-dimensional crystal structure of sortase A revealed that Arg197 is located in close proximity to both the active site Cys184 and the scissile peptide bond between threonine and glycine. We show here that substitution of Arg197 with alanine, lysine, or histidine severely reduced sortase A function both in vivo and in vitro, whereas Asn98, which had earlier been implicated in hydrogen bonding to His120, was found to be dispensable for catalysis. As the structural proximity of Arg197 and Cys184 is conserved in sortase enzymes and as ionization of the Cys184 sulfhydryl group seems required for sortase activity, we propose that Arg197 may function as a base, facilitating thiolate formation during sortase-mediated cleavage and transpeptidation reactions. Surface proteins of Staphylococcus aureus are anchored to the cell wall envelope by a mechanism requiring a C-terminal sorting signal with an LPXTG motif. Sortase A cleaves surface proteins between the threonine (T) and the glycine (G) residues of the LPXTG motif and catalyzes the formation of an amide bond between the carboxyl group of threonine at the C-terminal end of polypeptides and the amino group of pentaglycine cross-bridges of cell wall peptidoglycan. Previous work showed that Cys184 and His120 of sortase A are absolutely essential for catalysis; however an active site thiolateimidazolium ion pair may not be formed. The three-dimensional crystal structure of sortase A revealed that Arg197 is located in close proximity to both the active site Cys184 and the scissile peptide bond between threonine and glycine. We show here that substitution of Arg197 with alanine, lysine, or histidine severely reduced sortase A function both in vivo and in vitro, whereas Asn98, which had earlier been implicated in hydrogen bonding to His120, was found to be dispensable for catalysis. As the structural proximity of Arg197 and Cys184 is conserved in sortase enzymes and as ionization of the Cys184 sulfhydryl group seems required for sortase activity, we propose that Arg197 may function as a base, facilitating thiolate formation during sortase-mediated cleavage and transpeptidation reactions. The cell wall envelope of Gram-positive microbes functions as a surface organelle that allows bacterial pathogens to interact with their environment (1Foster T.J. Höök M. Trends Microbiol. 1998; 6: 484-488Abstract Full Text Full Text PDF PubMed Scopus (778) Google Scholar, 2Navarre W.W. Schneewind O. Microbiol. Mol. Biol. Rev. 1999; 63: 174-229Crossref PubMed Google Scholar). Gram-positive bacteria use cell wall-anchored surface proteins to invade, colonize, and replicate within their hosts (3Lecuit M. Vandormael-Pournin S. Lefort J. Huerre M. Gounon P. Dupuy C. Babinet C. Cossart P. Science. 2001; 292: 1722-1725Crossref PubMed Scopus (486) Google Scholar, 4Herwald H. Cramer H. Morgelin M. Russel W. Sollenberg U. Norrby-Teglund A. Flodgaard H. Lindbom L. Bjorck L. Cell. 2004; 116: 367-379Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar, 5Ponnuraj K. Bowden M.G. Davis S. Gurusiddappa S. Moore D. Choe D. Xu Y. Hook M. Narayana S.V. Cell. 2003; 115: 217-228Abstract Full Text Full Text PDF PubMed Scopus (235) Google Scholar), as polypeptides can promote bacterial attachment to specific host molecules or prevent escape from host immune responses (6Gaillard J.-L. Berche P. Frehel C. Gouin E. Cossart P. Cell. 1991; 65: 1127-1141Abstract Full Text PDF PubMed Scopus (634) Google Scholar, 7Fischetti V.A. Fischetti V.A. Novick R.P. Ferretti J.J. Portnoy D.A. Rood J.I. Gram-positive Pathogens. American Society for Microbiology, Washington, D. C.2000: 11-24Google Scholar). Sortase A (SrtA) 1The abbreviations used are: SrtA, sortase A; Abz, 2-aminobenzoyl; Dnp, diaminopropionic acid (2,4-dinitrophenyl); GlcNAc, N-acetylglucosamine; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; MurNAc, N-acetylmuramic acid; RP-HPLC, reversed phase high performance liquid chromatography; Seb, staphylococcal enterotoxin B; Spa, staphylococcal protein A; RIPA, radioimmune precipitation assay buffer. provides one mechanism for the attachment of proteins to the cell wall envelope of Gram-positive bacteria (8Mazmanian S.K. Liu G. Ton-That H. Schneewind O. Science. 1999; 285: 760-763Crossref PubMed Scopus (787) Google Scholar, 9Mazmanian S.K. Liu G. Jensen E.R. Lenoy E. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5510-5515Crossref PubMed Scopus (382) Google Scholar, 10Mazmanian S.K. Ton-That H. Su K. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2293-2298Crossref PubMed Scopus (309) Google Scholar, 11Cossart P. Jonquieres R. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5013-5015Crossref PubMed Scopus (167) Google Scholar). The enzyme recognizes and processes cell wall sorting signals of surface proteins (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar, 13Ton-That H. Mazmanian H. Faull K.F. Schneewind O. J. Biol. Chem. 2000; 275: 9876-9881Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar), C-terminal peptides with an LPXTG motif, a hydrophobic domain, and a positively charged tail (14Schneewind O. Model P. Fischetti V.A. Cell. 1992; 70: 267-281Abstract Full Text PDF PubMed Scopus (438) Google Scholar, 15Schneewind O. Mihaylova-Petkov D. Model P. EMBO. 1993; 12: 4803-4811Crossref PubMed Scopus (360) Google Scholar). Sortase A cleaves surface protein substrates between the threonine (T) and glycine (G) residues of the LPXTG motif (16Navarre W.W. Schneewind O. Mol. Microbiol. 1994; 14: 115-121Crossref PubMed Scopus (310) Google Scholar). The C-terminal end of cleaved surface proteins is then tethered to the cell wall envelope, i.e. the pentaglycine cell wall cross-bridges of staphylococci. Lipid II, GlcNAc-(β1-4)-MurNAc-[l-Ala-d-iGln-l-Lys-(NH2-Gly5)-d-Ala-d-Ala]-P-P-undecaprenol, is the peptidoglycan substrate of Staphylococcus aureus sortase A (17Ruzin A. Severin A. Ritacco F. Tabei K. Singh G. Bradford P.A. Siegel M.M. Projan S.J. Shlaes D.M. J. Bacteriol. 2002; 184: 2141-2147Crossref PubMed Scopus (74) Google Scholar). The product of the sorting reaction, surface protein linked to lipid II, is incorporated into the cell wall envelope via the transglycosylation and transpeptidation reactions of cell wall biosynthesis (18Ton-That H. Schneewind O. J. Biol. Chem. 1999; 274: 24316-24320Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 19Perry A.M. Ton-That H. Mazmanian S.K. Schneewind O. J. Biol. Chem. 2002; 277: 16241-16248Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar, 20Strominger J.L. Harvey Lectures. 1968; 64: 179-213PubMed Google Scholar). S. aureus sortase A is a 206-residue enzyme with an N-terminal signal peptide/membrane anchor sequence for insertion in the cytoplasmic membrane (9Mazmanian S.K. Liu G. Jensen E.R. Lenoy E. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5510-5515Crossref PubMed Scopus (382) Google Scholar). Removal of the first 59 residues of sortase A, SrtAΔN59, results in a soluble, fully functional polypeptide that can be purified by affinity chromatography from the cytoplasm of Escherichia coli (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar, 21Ilangovan U. Ton-That H. Iwahara J. Schneewind O. Clubb R.T. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6056-6061Crossref PubMed Scopus (254) Google Scholar). Purified SrtAΔN59 catalyzes the cleavage of LPXTG peptides between the threonine and the glycine residues as well as transpeptidation in the presence of polypeptide (LPETG) and peptidoglycan substrates (NH2-Gly3, NH2-Gly5, or lipid II), generating LPET-Gly3, LPET-Gly5, or LPET-lipid II, respectively (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar, 17Ruzin A. Severin A. Ritacco F. Tabei K. Singh G. Bradford P.A. Siegel M.M. Projan S.J. Shlaes D.M. J. Bacteriol. 2002; 184: 2141-2147Crossref PubMed Scopus (74) Google Scholar, 22Huang X. Aulabaugh A. Ding W. Kapoor B. Alksne L. Tabei K. Ellestad G. Biochemistry. 2003; 42: 11307-11315Crossref PubMed Scopus (145) Google Scholar, 23Kruger R.G. Otvos B. Frankel B.A. Bentley M. Dostal P. McCafferty D.G. Biochemistry. 2004; 43: 1541-1551Crossref PubMed Scopus (111) Google Scholar). The three-dimensional structure of SrtAΔN59 has been determined by NMR spectroscopy and by x-ray crystallography (21Ilangovan U. Ton-That H. Iwahara J. Schneewind O. Clubb R.T. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6056-6061Crossref PubMed Scopus (254) Google Scholar, 24Zong Y. Bice T.W. Ton-That H. Schneewind O. Narayana S.V.L. J. Biol. Chem. 2004; 279: 31383-31389Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Sortase A folds into an 8-stranded β-barrel with one α-helix and two 3-turn helices connecting the β-strands (24Zong Y. Bice T.W. Ton-That H. Schneewind O. Narayana S.V.L. J. Biol. Chem. 2004; 279: 31383-31389Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 25Zong Y. Mazmanian S.K. Schneewind O. Narayana S.V. Structure. 2004; 12: 105-112Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) (Fig. 1A). A pocket formed by the β4-, β7-, and β8-strands serves as the binding site for the peptide substrate and delineates the active site of the enzyme (24Zong Y. Bice T.W. Ton-That H. Schneewind O. Narayana S.V.L. J. Biol. Chem. 2004; 279: 31383-31389Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar)(Fig. 1A). A conserved cysteine residue (Cys184) resides in the β7-strand (24Zong Y. Bice T.W. Ton-That H. Schneewind O. Narayana S.V.L. J. Biol. Chem. 2004; 279: 31383-31389Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar) and is part of the LXTC signature motif that characterizes the active site of sortases (8Mazmanian S.K. Liu G. Ton-That H. Schneewind O. Science. 1999; 285: 760-763Crossref PubMed Scopus (787) Google Scholar, 12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar, 13Ton-That H. Mazmanian H. Faull K.F. Schneewind O. J. Biol. Chem. 2000; 275: 9876-9881Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar, 18Ton-That H. Schneewind O. J. Biol. Chem. 1999; 274: 24316-24320Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 26Ton-That H. Mazmanian S.K. Alksne L. Schneewind O. J. Biol. Chem. 2002; 277: 7447-7452Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). The side chain thiol of Cys184 is presumed to attack the carbonyl group of the scissile peptide bond, thereby generating a thioacyl intermediate (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar). Supporting this model are three different observations. First, sortase A can be inhibited both in vivo and in vitro with thiolate reagents such as methylmethane thiosulfonate (e.g. MTSET) or para-hydroxymercuribenzoic acid, but not with a sulfhydryl reagent such as iodoacetate or iodoacetamide (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar, 18Ton-That H. Schneewind O. J. Biol. Chem. 1999; 274: 24316-24320Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Second, surface protein can be released from staphylococci with C-terminal threonine hydroxamate after treatment of bacteria with hydroxylamine (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar), a strong nucleophile that is known to attack thioacyl intermediates (27Lipmann F. Tuttle L.C. J. Biol. Chem. 1945; 161: 415-416Abstract Full Text PDF PubMed Google Scholar). Third, sortase A-mediated hydroxylaminolysis or cell wall anchoring of surface proteins in vivo requires Cys184 as well as His120, another charged residue that is conserved in all sortases (26Ton-That H. Mazmanian S.K. Alksne L. Schneewind O. J. Biol. Chem. 2002; 277: 7447-7452Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). The sortase A thioacyl intermediate is thought to be resolved by the nucleophilic attack of the amine of the pentaglycine moiety within staphylococcal lipid II (17Ruzin A. Severin A. Ritacco F. Tabei K. Singh G. Bradford P.A. Siegel M.M. Projan S.J. Shlaes D.M. J. Bacteriol. 2002; 184: 2141-2147Crossref PubMed Scopus (74) Google Scholar, 19Perry A.M. Ton-That H. Mazmanian S.K. Schneewind O. J. Biol. Chem. 2002; 277: 16241-16248Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). Cys184 and His120 are absolutely required for sortase A-mediated LPXTG peptide cleavage or transpeptidation in vitro (13Ton-That H. Mazmanian H. Faull K.F. Schneewind O. J. Biol. Chem. 2000; 275: 9876-9881Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar, 26Ton-That H. Mazmanian S.K. Alksne L. Schneewind O. J. Biol. Chem. 2002; 277: 7447-7452Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Analysis of the three-dimensional structure of sortase A with or without bound substrate revealed that His120 is positioned at a distance (7 Å) from Cys184 (24Zong Y. Bice T.W. Ton-That H. Schneewind O. Narayana S.V.L. J. Biol. Chem. 2004; 279: 31383-31389Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). This measurement is not consistent with the formation of a thiolate-imidazolium ion bond as is known to occur in papain and papain-like cysteine proteases (28Drenth J. Jansonius J.N. KoeKoek R. Swen H.M. Wolthers B.G. Nature. 1968; 218: 929-932Crossref PubMed Scopus (365) Google Scholar, 29Lewis S.D. Johnson F.A. Shafer J.A. Biochemistry. 1981; 20: 48-51Crossref PubMed Scopus (155) Google Scholar, 30Storer A.C. Menard R. Methods Enzymol. 1994; 244: 487-500Google Scholar). Experimental determination of the pKa for Cys184 thiol (9.4) and for the His120 imidazolium (7.0) further corroborates the notion that sortase A catalysis may occur by a mechanism that does not involve a thiolate-imidazolium ion bond (31Conolly K.M. Smith B.T. Pilpa R. Ilangovan U. Jung M.E. Clubb R.T. J. Biol. Chem. 2003; 278: 34061-34065Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). The three-dimensional structure of sortase A bound to the LPETG substrate revealed the presence of Arg197 on the β8-strand, in close proximity to Cys184 and to the scissile peptide bond (Fig. 1B). We show here that substitution of Arg197 with alanine, lysine or histidine severely reduced sortase A function, whereas Asn98 was found to be dispensable for catalysis. As the structural proximity of Arg197 and Cys184 is conserved in sortase enzymes (32Pallen M.J. Lam A.C. Antonio M. Dunbar K. Trends Microbiol. 2001; 9: 97-101Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar, 33Comfort D. Clubb R.T. Infect. Immun. 2004; 72: 2710-2722Crossref PubMed Scopus (171) Google Scholar) and as ionization of the Cys184 sulfhydryl group appears to be required for sortase activity (12Ton-That H. Liu G. Mazmanian S.K. Faull K.F. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12424-12429Crossref PubMed Scopus (475) Google Scholar, 26Ton-That H. Mazmanian S.K. Alksne L. Schneewind O. J. Biol. Chem. 2002; 277: 7447-7452Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), we propose that Arg197 may act as a base, facilitating thiolate formation during sortase A cleavage and transpeptidation reactions. Bacterial Strains and Plasmids—Plasmid pHTT27, with an in-frame insertion of SrtAΔN59 coding sequence into the six histidyl tag expression vector pQE30 (Qiagen), has been previously described (22Huang X. Aulabaugh A. Ding W. Kapoor B. Alksne L. Tabei K. Ellestad G. Biochemistry. 2003; 42: 11307-11315Crossref PubMed Scopus (145) Google Scholar, 26Ton-That H. Mazmanian S.K. Alksne L. Schneewind O. J. Biol. Chem. 2002; 277: 7447-7452Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). pHTT27 and its mutant derivatives were transformed into E. coli XL-1 Blue and selected on Luria agar containing 100 μg/ml ampicillin. The sortase A mutant S. aureus strains SKM1 (pGL4), SKM1 (pGL4, pSrtA), and SKM1 (pGL4, pOS1) have also been previously described (9Mazmanian S.K. Liu G. Jensen E.R. Lenoy E. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5510-5515Crossref PubMed Scopus (382) Google Scholar). Mutant derivatives of the pSrtA plasmid were transformed into SKM1 (pGL4) and selected on tryptic soy agar supplemented with 10 μg/ml chloramphenicol and 2.5 μg/ml tetracycline. pGL4, a pT181-type shuttle vector, provides for the expression of Seb-Spa490-524, a model surface protein substrate for analysis of the S. aureus cell wall sorting pathway (8Mazmanian S.K. Liu G. Ton-That H. Schneewind O. Science. 1999; 285: 760-763Crossref PubMed Scopus (787) Google Scholar). Site-directed Mutagenesis—Mutations in srtA, i.e. the sortase A gene, were generated by high fidelity polymerase chain reaction (PCR) amplification using pSrtA or pHTT27 templates and Pfu polymerase (Invitrogen). The Arg197 codon was mutated to encode Ala197 using the primers R197A-T (CAGGCGTTTGGGAAAAAGCTAAAATCTTTGTAGCTAC) and R197A-B (GTAGCTACAAAGATTTTAGCTTTTTCCCAAACGCCTG), with lysine using the primers R197K-T (CAGGCGTTTGGGAAAAAAAGAAAATCTTTGTAGCTAC) and R197K-B (GTAGCTACAAAGATTTTCTTTTTTTCCCAAACGCCTG) or with histidine using the primers R197H-T (CAGGCGTTTGGGAAAAACATAAAATCTTTGTAGCTAC) and R197H-B (GTAGCTACAAAGATTTTATGTTTTTCCCAAACGCCTG). The double substitution variant, SrtA C184R/R197C, was assembled in two steps. First, the Cys184 codon was mutated to encode Arg184 with the primers C184R-T (CAATTAACATTAATTACTCGTGATGATTACAATGAAAAG) and C184R-B (CTTTTCATTGTAATCATCACGAGTAATTAATGTTAATTG). Then, the Arg197 codon was changed to encode Cys197 using plasmid template from the previous mutagenesis and the primers R197C-T (CAGGCGTTTGGGAAAAATGTAAAATCTTTGTAGCTAC) and R197C-B (GTAGCTACAAAGATTTTACATTTTTCCCAAACGCCTG). The Asn98 codon was mutated to encode Ala98 using the primers N98A-T (GCAACACCTGAACAATTAGCTAGAGGTGTAAGCTTTGC) and N98A-B (GCAAAGCTTACACCTCTAGCTAATTGTTCAGGTGTTGC) or Gln98 using the primers N98Q-T (GCAACACCTGAACAATTACAGAGAGGTGTAAGCTTTGC) and N98Q-B (GCAAAGCTTACACCTCTCTGTAATTGTTCAGGTGTTGC) (underlined nucleotides mark mutational changes). DpnI digestion of PCR amplification products was used to destroy methylated parental DNA; newly synthesized plasmid DNA encoding the mutant sequences was then transformed into bacteria. All mutations were confirmed by DNA sequencing of purified plasmid DNA. Pulse-chase Experiments—Staphylococcal cultures were grown overnight in tryptic soy broth media supplemented with 10 μg/ml chloramphenicol and 2.5 μg/ml tetracycline at 37 °C. Overnight cultures were diluted into fresh media and grown until OD600 reached 0.5. Cells were harvested by centrifugation, washed, and suspended in minimal medium lacking methionine and cysteine (14Schneewind O. Model P. Fischetti V.A. Cell. 1992; 70: 267-281Abstract Full Text PDF PubMed Scopus (438) Google Scholar). Cells were labeled with 100 μCi of [35S]Promix (Amersham Biosciences) for 2 min. After labeling, 50 μl of chase solution were added (100 mg/ml casamino acids, 10 mg/ml methionine) and at timed intervals (0, 2, and 10 min after the chase), 250 μl of cells were removed and transferred into an Eppendorf tube containing an equal volume of 15% trichloroacetic acid to quench all further processing of surface proteins. After 30 min of incubation on ice, cells and precipitated proteins were collected by centrifugation at 14,000 × g for 10 min, washed in ice-cold acetone, sedimented again by centrifugation at 14,000 × g for 10 min, and then dried. Samples were suspended in 1 ml of 0.5 m Tris-HCl, pH 6.8 and the peptidoglycan digested by adding either 150 μg mutanolysin or 100 μg of lysostaphin with incubation for 4 hours at 37 °C and intermittent mixing of samples. Digests were precipitated by the addition of 7.5% trichloroacetic acid and incubation on ice for 30 min. The precipitate was collected by centrifugation at 14,000 × g for 10 min, washed in ice-cold acetone, and then sedimented by centrifugation at 14,000 × g for 10 min and dried. Samples were solubilized by boiling in 50 μl of 0.5 m Tris-HCl, 4% SDS, pH 8.0. 40 μl aliquots were transferred to 1 ml of RIPA buffer containing 1 μl of rabbit α-Seb antibody. Antigen-antibody complexes were captured on 100 μl of preswollen protein A CL 4B-Sepharose, washed five times with RIPA buffer, and solubilized by boiling in sample buffer. Immunoprecipitates were separated on 12% SDS-PAGE, dried, and analyzed by phosphorimager. Measuring Sortase Expression in Vivo—A 1-ml aliquot of staphylococci was grown in tryptic soy broth until an OD600 of 0.5. Bacteria and soluble proteins were sedimented by the addition of trichloroacetic acid to 7.5% and incubated 30 min on ice. The precipitate was collected by centrifugation, washed with ice-cold acetone, and again centrifuged. The sediment was suspended in sample buffer, boiled, and subjected to SDS-PAGE followed by immunoblotting with a rabbit α-sortase antibody. Hydroxylaminolysis of Surface Proteins in Vivo—Cells were grown and pulse-labeled for 1 min and chased for 5 min as described above, however this reaction was performed either in the presence or absence of 0.1 m NH2OH. A 0.5-ml aliquot was centrifuged at 15,000 × g for 5 min, and the supernatant was precipitated with 0.5 ml of 15% trichloroacetic acid. The remaining 0.5-ml culture aliquot was also precipitated but then suspended in 1 ml of 0.5 m Tris-HCl (pH 7.5) containing 100 μg of lysostaphin to digest the peptidoglycan for 1 h at 37 °C. All four samples were treated with 7.5% trichloroacetic acid to precipitate soluble proteins. The sediment was washed in acetone, dried, and then boiled in 50 μl of 0.5 m Tris-HCl, 4% SDS, pH 8.0. 40-μl aliquots were immunoprecipitated with α-Seb as described above, subjected to SDS-PAGE, and then analyzed by phosphorimager. Purification and Characterization of Recombinant Sortases—E. coli XL-1 blue harboring plasmids that provide for the expression of SrtAΔN59 and wild-type or mutant sortases, were grown at 37 °C in Luria broth supplemented with 100 μg/ml ampicillin until an OD600 of 0.7. Gene expression was the induced by the addition of 1 mm isopropyl-1-thio-β-d-galactopyranoside, and cultures were grown for an additional 2 hours. Cells were collected by centrifugation at 6000 × g, suspended in 30 ml of C buffer (50 mm Tris-HCl, 150 mm NaCl, 10% glycerol, pH 7.5), and lysed in a French pressure cell at 14,000 psi. The extract was centrifuged at 29,000 × g for 30 min, and the supernatant applied to a 1.5-ml Ni-NTA resin pre-equilibrated with C buffer. The column was washed with 40 ml of C buffer, and bound protein was eluted in 4 ml of C buffer containing 0.5 m imidazole. To characterize purified enzymes, the average mass of 1 μg of wild-type or mutant sortase was determined in an ion trap mass spectrometry instrument (Agilent 1100 LC/MSD XCT). The average observed mass of all enzymes was within the error rate (0.01%) of the calculated average masses. To exclude the possibility that the introduced mutations produced structurally unstable enzymes, mutant as well as wild-type sortases were subjected to circular dichroism. Buffer was changed to 10 mm phosphate, pH 7.5, and CD spectra from 260 to 190 nm were recorded with an AVIV 202 Circular Dichroism Spectrometer. In Vitro Analysis of Sortase Enzymes—Sortase activity was assayed in buffer R (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, and 5 mm CaCl2) at 37 °C for 30 min. The Abz-LPETG-Dnp peptide was dissolved in dimethyl sulfoxide and added to the reaction at a final concentration of 5 μm. Purified SrtAΔN59 or its mutant variants were added to the reaction at a final concentration of 10 μm. Reactions were quenched by boiling samples for 5 min and peptide cleavage was monitored by fluorescence at 420 nm after excitation at 320 nm. The mean and standard deviation of three independent measurements are reported. Initial velocity assays were carried out under the same conditions and reaction rates were determined by monitoring fluorescence over 100 s or 2-h time periods. The average of three independent experiments is reported. Kinetic parameters of wild-type and mutant enzymes were measured in the conditions above detailed, varying the concentration of Abz-LPETG-Dpn substrate in a range from 5 to 160 μm and at a constant concentration sortase of 5 μm. The fluorescence increment detected was used to calculate the initial velocity as previously reported (13Ton-That H. Mazmanian H. Faull K.F. Schneewind O. J. Biol. Chem. 2000; 275: 9876-9881Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar). Average and error of three independent measures were used to obtain Vmax and Km values from Lineweaver Burk plots (34Fersht A. Enzyme Structure and Mechanism. 2nd Ed. W. H. Freeman & Co., New York1985Google Scholar). HPLC Purification of Cleaved Products—A reaction containing 10 μm Abz-LPETG-Dnp and 15 μm recombinant enzyme in a final volume of 1 ml of buffer R (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, and 5 mm CaCl2) was incubated either in the presence or absence of 5 mm of triglycine at 37 °C for 16 h. The reaction was stopped by centrifugation in a Centricon-10 unit (Millipore) at 7,500 × g to separate enzyme from substrate and products. The filtrate was subjected to RP-HPLC separation on C-18 column (2 × 250-mm, C18 Hypersil, Keystone Scientific). Elution of cleaved products was monitored at 215 nm, and 1-min fractions were collected. Vacuum dried fractions were stored at 4 °C for MALDI-TOF mass spectrometry and tandem mass spectrometry analysis (ABI 4700, operated in reflection mode) to verify the structure of transpeptidation products. Arg197 Substitutions in Sortase A Interfere with S. aureus Surface Protein Anchoring in Vivo—Plasmids encoding either wild-type srtA or srtA variants with nucleotide substitutions in codon 197 were generated with site-directed mutagenesis. Four plasmids were transformed into S. aureus strain SKM1 [Δ(srtA)]: pSrtA, encoding the wild-type srtA gene; pLMR197A, encoding an R197A substitution; pLM-R197K; encoding an R197K substitution; and pLM-R197H, encoding an R197H substitution. As a control for adequate expression of sortase genes, cell extracts from equal numbers of staphylococci were analyzed for sortase expression by immunoblotting with α-SrtA (Fig. 2). To measure surface protein anchoring, staphylococci were pulse-labeled with [35S]methionine/cysteine for 2 min, followed by the addition of an excess of non-radioactive methionine and cysteine to quench the incorporation of all radio-labeled amino acids into polypeptides. During the pulse (0 min) or 2 and 10 min after the addition of the chase, all surface protein processing was quenched by the addition of 7.5% ice-cold trichloroacetic acid. The cell wall envelope of staphylococci was digested with lysostaphin, a glycyl-glycine endopeptidase that cuts the anchor structure of surface proteins at the pentaglycine cell wall cross-bridge (35Schindler C.A. Schuhardt V.T. Proc. Natl. Acad. Sci. U. S. A. 1964; 51: 414-421Crossref PubMed Scopus (323) Google Scholar), and Seb-Spa490-524 surface protein was immunoprecipitated using polyclonal α-Seb and protein A-Sepharose, followed by SDS-PAGE and phosphorimager analysis (15Schneewind O. Mihaylova-Petkov D. Model P. EMBO. 1993; 12: 4803-4811Crossref PubMed Scopus (360) Google Scholar)(Fig. 2). When analyzed for S. aureus strain SKM1 harboring pSrtA (9Mazmanian S.K. Liu G. Jensen E.R. Lenoy E. Schneewind O. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5510-5515Crossref PubMed Scopus (382) Google Scholar), Seb-Spa490-524 was synthesized as a P1 precursor carrying both an N-terminal signal peptide and a C-terminal sorting signal. P1 precrusor was rapidly cleaved to generate first the P2 precursor, lacking the signal peptide but still bearing the sorting signal, and then the mature cell wall anchored product without signal peptide and sorting signal (Fig. 2A). Ten minutes after the addition of the chase, essentially all Seb-Spa490-524 was processed to the mature anchored surface protein species. Treatment of the envelope of S. aureus SKM1 (pSrtA) with muramidase, an enzyme that cuts MurNAc-(β1-4)-GlcNAc glycosidic bonds of peptidoglycan (36Yokogawa K. Kawata S. Nishimura S. Ikeda Y. Yoshimura Y. Antimicrob. Agents Chemother. 1974; 6: 156-165Crossref PubMed Scopus (81) Google Scholar), released Seb-Spa490-524 as a spectrum of polypeptides with linked cell wall fragments of variable mass (Fig. 2A). Transformation of S. aureus strain SKM1 [Δ(srtA)] with empty vector pOS1 did not restore the sorting defect of the parent strain, as pulse-labeled staphylococci accumulated P2 precursor. Furthermore, lysostap
Referência(s)