Artigo Acesso aberto Revisado por pares

Conditional Osmotic Stress in Yeast

2004; Elsevier BV; Volume: 280; Issue: 8 Linguagem: Inglês

10.1074/jbc.m413210200

ISSN

1083-351X

Autores

Sara Karlgren, Nina Pettersson, Bodil Nordlander, John Mathai, Jeffrey L. Brodsky, Mark L. Zeidel, Roslyn M. Bill, Stefan Hohmann,

Tópico(s)

Endoplasmic Reticulum Stress and Disease

Resumo

The accumulation and transport of solutes are hallmarks of osmoadaptation. In this study we have employed the inability of the Saccharomyces cerevisiae gpd1Δ gpd2Δ mutant both to produce glycerol and to adapt to high osmolarity to study solute transport through aquaglyceroporins and the control of osmostress-induced signaling. High levels of different polyols, including glycerol, inhibited growth of the gpd1Δ gpd2Δ mutant. This growth inhibition was suppressed by expression of the hyperactive allele Fps1-Δ1 of the osmogated yeast aquaglyceroporin, Fps1. The degree of suppression correlated with the relative rate of transport of the different polyols tested. Transport studies in secretory vesicles confirmed that Fps1-Δ1 transports polyols at increased rates compared with wild type Fps1. Importantly, wild type Fps1 and Fps1-Δ1 showed similarly low permeability for water. The growth defect on polyols in the gpd1Δ gpd2Δ mutant was also suppressed by expression of a heterologous aquaglyceroporin, rat AQP9. We surmised that this suppression was due to polyol influx, causing the cells to passively adapt to the stress. Indeed, when aquaglyceroporin-expressing gpd1Δ gpd2Δ mutants were treated with glycerol, xylitol, or sorbitol, the osmosensing HOG pathway was activated, and the period of activation correlated with the apparent rate of polyol uptake. This observation supports the notion that deactivation of the HOG pathway is closely coupled to osmotic adaptation. Taken together, our "conditional" osmotic stress system facilitates studies on aquaglyceroporin function and reveals features of the osmosensing and signaling system. The accumulation and transport of solutes are hallmarks of osmoadaptation. In this study we have employed the inability of the Saccharomyces cerevisiae gpd1Δ gpd2Δ mutant both to produce glycerol and to adapt to high osmolarity to study solute transport through aquaglyceroporins and the control of osmostress-induced signaling. High levels of different polyols, including glycerol, inhibited growth of the gpd1Δ gpd2Δ mutant. This growth inhibition was suppressed by expression of the hyperactive allele Fps1-Δ1 of the osmogated yeast aquaglyceroporin, Fps1. The degree of suppression correlated with the relative rate of transport of the different polyols tested. Transport studies in secretory vesicles confirmed that Fps1-Δ1 transports polyols at increased rates compared with wild type Fps1. Importantly, wild type Fps1 and Fps1-Δ1 showed similarly low permeability for water. The growth defect on polyols in the gpd1Δ gpd2Δ mutant was also suppressed by expression of a heterologous aquaglyceroporin, rat AQP9. We surmised that this suppression was due to polyol influx, causing the cells to passively adapt to the stress. Indeed, when aquaglyceroporin-expressing gpd1Δ gpd2Δ mutants were treated with glycerol, xylitol, or sorbitol, the osmosensing HOG pathway was activated, and the period of activation correlated with the apparent rate of polyol uptake. This observation supports the notion that deactivation of the HOG pathway is closely coupled to osmotic adaptation. Taken together, our "conditional" osmotic stress system facilitates studies on aquaglyceroporin function and reveals features of the osmosensing and signaling system. Osmoregulation is a fundamental biological process that controls cellular water content and turgor pressure. The accumulation of compatible solutes is a well conserved strategy in osmoregulation, although the solute accumulated differs between organisms (1Yancey P.H. Clark M.E. Hand S.C. Bowlus R.D. Somero G.N. Science. 1982; 217: 1214-1222Crossref PubMed Scopus (3031) Google Scholar). The yeast Saccharomyces cerevisiae employs glycerol, whose production and transmembrane flux are tightly controlled by osmotic changes (2Hohmann S. Microbiol. Mol. Biol. Rev. 2002; 66: 300-372Crossref PubMed Scopus (1296) Google Scholar). In this work we have developed a "conditional osmotic stress" system in which a yeast mutant unable to produce glycerol is stressed by the addition of polyols and allowed to adapt by expression of aquaglyceroporins mediating polyol influx into the cell. We use this experimental set-up to illustrate that (i) different polyols can serve as osmostress agents as well as compatible solutes, (ii) to study polyol transport through aquaglyceroporins, and (iii) to probe the feedback mechanisms of the osmosensing/osmosignaling system. Glycerol is produced in yeast from the glycolytic intermediate dihydroxyacetonephosphate in two steps that are catalyzed by glycerol-3-phosphate dehydrogenase (Gpd) and glycerol-3-phosphatase (Gpp), respectively. Both enzymes exist in two isoforms, Gpd1 and Gpd2 as well as Gpp1 and Gpp2. Deletion of GPD1 and GPD2 or GPP1 and GPP2 abolishes glycerol production and causes strong osmosensitivity (3Larsson K. Eriksson P. Ansell R. Adler L. Mol. Microbiol. 1993; 10: 1101-1111Crossref PubMed Scopus (159) Google Scholar, 4Albertyn J. Hohmann S. Thevelein J.M. Prior B.A. Mol. Cell. Biol. 1994; 14: 4135-4144Crossref PubMed Scopus (611) Google Scholar, 5Norbeck J. Pa ̊hlman A.K. Akhtar N. Blomberg A. Adler L. J. Biol. Chem. 1996; 271: 13875-13881Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar, 6Ansell R. Granath K. Hohmann S. Thevelein J.M. Adler L. EMBO J. 1997; 16: 2179-2187Crossref PubMed Scopus (433) Google Scholar, 7Siderius M. Van Wuytswinkel O. Reijenga K.A. Kelders M. Mager W.H. Mol. Microbiol. 2000; 36: 1381-1390Crossref PubMed Scopus (85) Google Scholar, 8Pa ̊hlman A.K. Granath K. Ansell R. Hohmann S. Adler L. J. Biol. Chem. 2001; 276: 3555-3563Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). As in other yeasts, active glycerol uptake from the environment has been observed (9Lages F. Silva-Graca M. Lucas C. Microbiology. 1999; 145: 2577-2585Crossref PubMed Scopus (121) Google Scholar) but does not normally contribute to osmoadaptation in S. cerevisiae (10Holst B. Lunde C. Lages F. Oliveira R. Lucas C. Kielland-Brandt M.C. Mol. Microbiol. 2000; 37: 108-124Crossref PubMed Scopus (86) Google Scholar). Rather, intracellular glycerol levels are controlled by passive glycerol export, which is mediated by Fps1 (2Hohmann S. Microbiol. Mol. Biol. Rev. 2002; 66: 300-372Crossref PubMed Scopus (1296) Google Scholar, 11Luyten K. Albertyn J. Skibbe W.F. Prior B.A. Ramos J. Thevelein J.M. Hohmann S. EMBO J. 1995; 14: 1360-1371Crossref PubMed Scopus (337) Google Scholar, 12Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Crossref PubMed Scopus (296) Google Scholar, 13Oliveira R. Lages F. Silva-Graca M. Lucas C. Biochim. Biophys. Acta. 2003; 1613: 57-71Crossref PubMed Scopus (69) Google Scholar). Upon a hyperosmotic shock the transport capacity of Fps1 is rapidly diminished to ensure that glycerol is maintained inside the cell (2Hohmann S. Microbiol. Mol. Biol. Rev. 2002; 66: 300-372Crossref PubMed Scopus (1296) Google Scholar, 11Luyten K. Albertyn J. Skibbe W.F. Prior B.A. Ramos J. Thevelein J.M. Hohmann S. EMBO J. 1995; 14: 1360-1371Crossref PubMed Scopus (337) Google Scholar). A specific domain within the N-terminal extension of Fps1 is needed to restrict glycerol transport, and deletion of this domain renders Fps1 hyperactive (12Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Crossref PubMed Scopus (296) Google Scholar, 14Tamás M.J. Karlgren S. Bill R.M. Hedfalk K. Allegri L. Ferreira M. Thevelein J.M. Rydstrom J. Mullins J.G. Hohmann S. J. Biol. Chem. 2003; 278: 6337-6345Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Yeast cells that express this hyperactive Fps1, Fps1-Δ1, fail to retain glycerol and hence are sensitive to high external osmolarity. Upon a hypo-osmotic shock Fps1 rapidly releases glycerol to prevent excessive cell swelling. Therefore, mutants lacking Fps1 are sensitive to hypo-osmotic shock (12Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Crossref PubMed Scopus (296) Google Scholar). Fps1 is a member of the aquaglyceroporin subgroup of MIP channel proteins (15Borgnia M. Nielsen S. Engel A. Agre P. Annu. Rev. Biochem. 1999; 68: 425-458Crossref PubMed Scopus (705) Google Scholar, 16Hohmann S. Nielsen S. Agre P. Aquaporins. Academic Press, San Diego, CA2001Google Scholar) and hence can mediate passive glycerol flux in both directions. MIP channels, now referred to as aquaporins, occur in all groups of organisms ranging from archea to humans and play important roles in mediating and controlling water and solute fluxes across cells and tissues (16Hohmann S. Nielsen S. Agre P. Aquaporins. Academic Press, San Diego, CA2001Google Scholar). Aquaglyceroporins have been shown to transport a range of compounds including polyols, urea, and even metalloids (17Sanders O.I. Rensing C. Kuroda M. Mitra B. Rosen B.P. J. Bacteriol. 1997; 179: 3365-3367Crossref PubMed Google Scholar, 18Fu D. Libson A. Miercke L.J. Weitzman C. Nollert P. Krucinski J. Stroud R.M. Science. 2000; 290: 481-486Crossref PubMed Scopus (889) Google Scholar, 19Tamás M.J. Wysocki R. Curr. Genet. 2001; 40: 2-12Crossref PubMed Scopus (61) Google Scholar), and thus the determination of the transport specificity of the many proteins in this ubiquitous family is of considerable importance in the elucidation of their physiological roles. In yeast, hyperosmotic stress is sensed and signaled by the high osmolarity glycerol (HOG) 1The abbreviations used are: HOG, high osmolarity glycerol; HA, hemagglutinin; MES, 4-morpholineethanesulfonic acid; CF, carboxyfluorescein. pathway, an elaborate mitogen-activated protein kinase signal transduction system (2Hohmann S. Microbiol. Mol. Biol. Rev. 2002; 66: 300-372Crossref PubMed Scopus (1296) Google Scholar, 20de Nadal E. Alepuz P.M. Posas F. EMBO Rep. 2002; 3: 735-740Crossref PubMed Scopus (183) Google Scholar, 21O'Rourke S.M. Herskowitz I. O'Shea E.K. Trends Genet. 2002; 18: 405-412Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). The activity of the pathway can be monitored by immunological determination of the level of phosphorylated Hog1 mitogen-activated protein kinase or by the mRNA level of target genes such as GRE2. Using such markers of HOG pathway activity, it has been demonstrated that a hyperosmotic shock leads to transient activation of the pathway. Negative regulation of the HOG pathway is exerted by protein phosphatases (2Hohmann S. Microbiol. Mol. Biol. Rev. 2002; 66: 300-372Crossref PubMed Scopus (1296) Google Scholar, 20de Nadal E. Alepuz P.M. Posas F. EMBO Rep. 2002; 3: 735-740Crossref PubMed Scopus (183) Google Scholar, 21O'Rourke S.M. Herskowitz I. O'Shea E.K. Trends Genet. 2002; 18: 405-412Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). Studies on mutants unable either to produce or retain glycerol or to accumulate glycerol faster than wild type have indicated that deactivation of the HOG pathway correlates with glycerol accumulation and hence successful adaptation (7Siderius M. Van Wuytswinkel O. Reijenga K.A. Kelders M. Mager W.H. Mol. Microbiol. 2000; 36: 1381-1390Crossref PubMed Scopus (85) Google Scholar, 23Krantz M. Nordlander B. Valadi H. Johansson M. Gustafsson L. Hohmann S. Eukaryot. Cell. 2004; 3: 1381-1390Crossref PubMed Scopus (51) Google Scholar). 2E. Klipp, B. Nordlander, R. Krüger, P. Gennemark, and S. Hohmann, submitted for publication. The HOG pathway controls glycerol production at at least two levels. First, Hog1 activates the enzyme phosphofructo-2-kinase, leading to stimulation of glycolytic flux and enhanced glycerol production (24Dihazi H. Kessler R. Eschrich K. J. Biol. Chem. 2004; 279: 23961-23968Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). In addition, Hog1 mediates enhanced expression of the genes GPD1 and GPP2 (4Albertyn J. Hohmann S. Thevelein J.M. Prior B.A. Mol. Cell. Biol. 1994; 14: 4135-4144Crossref PubMed Scopus (611) Google Scholar, 5Norbeck J. Pa ̊hlman A.K. Akhtar N. Blomberg A. Adler L. J. Biol. Chem. 1996; 271: 13875-13881Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar, 25Hirayama T. Maeda T. Saito H. Shinozaki K. Mol. Gen. Genet. 1995; 249: 127-138Crossref PubMed Scopus (94) Google Scholar) and hence increased capacity to produce glycerol. In this work we make use of the osmosensitive gpd1Δ gpd2Δ mutant as well as the hyperactive Fps1-Δ1. Expression of Fps1-Δ1, or rat AQP9, a mammalian aquaglyceroporin, suppresses the growth defect of the gpd1Δ gpd2Δ mutant in the presence of high concentrations of polyols that can be transported by Fps1-Δ1 or AQP9. This has allowed us to establish an experimental "conditional osmotic stress" system to study polyol transport and osmosignaling. Strains and Plasmids—The yeast strains used in this study are W303-1A (MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1-100 GAL SUC2 mal0) (26Thomas B.J. Rothstein R.J. Cell. 1989; 56: 619-630Abstract Full Text PDF PubMed Scopus (1355) Google Scholar) plus its isogenic mutants YSH 642 (gpd1Δ::TRP1 gpd2Δ::URA3) (6Ansell R. Granath K. Hohmann S. Thevelein J.M. Adler L. EMBO J. 1997; 16: 2179-2187Crossref PubMed Scopus (433) Google Scholar) and YMT2 (fps1Δ::HIS3) (14Tamás M.J. Karlgren S. Bill R.M. Hedfalk K. Allegri L. Ferreira M. Thevelein J.M. Rydstrom J. Mullins J.G. Hohmann S. J. Biol. Chem. 2003; 278: 6337-6345Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Solute transport studies utilized secretory vesicles prepared from strain SY1 (MATaura3-52 leu2-3,112 his4-619 sec6-4) (27Nakamoto R.K. Rao R. Slayman C.W. J. Biol. Chem. 1991; 266: 7940-7949Abstract Full Text PDF PubMed Google Scholar) containing a URA3-marked vector (pCu426) (28Labbe S. Thiele D.J. Methods Enzymol. 1999; 306: 145-153Crossref PubMed Scopus (111) Google Scholar) to drive the copper-inducible, high level expression of hemagglutinin (HA) epitope-tagged FPS1 or FPS1-Δ1. YEpmyc-FPS1 is a 2μ LEU2 plasmid expressing a c-myc epitope-tagged Fps1, and YEp-mycFPS1-Δ1 mediates expression of a truncated, hyperactive Fps1-Δ1, which lacks amino acids 12–231 (12Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Crossref PubMed Scopus (296) Google Scholar). The rat AQP9 gene (kindly provided by S. Nielsen) was amplified by PCR and inserted between the EcoRI and SmaI sites of the pYX242 vector (multi-copy 2μ vector, constitutive TPI1 promoter, HA tag). The construct was confirmed by sequencing. Growth Conditions—Yeast cells were grown in 2% peptone, 1% yeast extract, 2% glucose (YPD). Selection and growth of transformants was performed in synthetic medium (YNB, 2% glucose) (29Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1983Google Scholar). For growth assays cells were pregrown for 2 days on YNB plates and resuspended in YNB to A600 nm = 0.4, and 5 μl of a 10-fold dilution series were spotted onto agar plates supplemented with osmotica as indicated. Growth was monitored for 2–7 days in 30 °C. For growth curves the cells were pregrown in YNB for 24 h. The cells were adjusted to A600 nm = 0.15 in 350 μl of YNB supplemented with compounds as indicated and transferred to Bioscreen plates (30Warringer J. Blomberg A. Yeast. 2003; 20: 53-67Crossref PubMed Scopus (204) Google Scholar). The cells were grown at 30 °C with agitation for 60 s every second minute. The A600 nm values were automatically recorded at 20-min intervals. Polyol Transport in Whole Yeast Cells—The cells were harvested by centrifugation in mid-exponential phase, washed, and suspended in ice-cold MES buffer (10 mm MES, pH 6.0) to 60 mg/ml. 30 μl of unlabeled polyol solution was mixed with 0.5 μCi of [14C]glycerol, [3H]xylitol, or [3H]sorbitol respectively in MES buffer and added to 20 μl of cell suspension to give a final polyol concentration of 100 mm. The reactions were stopped at 15, 30, and 60 s by transferring the cells to ice-cold water and collecting them on filters. Radioactivity was monitored in a scintillation counter. The samples for dry weight were collected on filters and dried at 80 °C. The initial uptake rates were determined by the slope. For each value the average value obtained with transformants carrying the corresponding empty plasmid was subtracted. Presented is the average of at least four individual experiments. Membrane Preparation and Western Blot Analysis of rAQP9 —Transformed cells were harvested in mid-exponential phase, washed (10 mm Tris-HCl, pH 7.5, 0.5 m sucrose, 2.5 mm EDTA), and resuspended in homogenization buffer (50 mm Tris-HCl, pH 7.5, 0.3 m sucrose, 5 mm EDTA, 1 mm EGTA, 5 mg/ml bovine serum albumin, 2 mm dithiothreitol, protease inhibitor mixture (Roche Applied Science)). The cells were disrupted in a Fast-prep (BIO101) and centrifuged at 10,000 × g for 10 min, and the supernatant was centrifuged at 100,000 × g for 90 min. The membrane pellet was resuspended (10 mm Tris-HCl, pH 7.0, 1 mm EGTA, 1 mm dithiothreitol, 20% (v/v) glycerol, protease inhibitor mixture), 50 μg of protein were separated by SDS-PAGE and blotted (Hybond-ECL; Amersham Biosciences). The membranes were blocked in phosphate-buffered saline Tween 20, 5% milk and probed for 1.5 h with 1:2,000 diluted anti-HA mouse monoclonal antibody (Roche Applied Science), washed, and incubated for 1 h with secondary antibody (horseradish peroxidase-conjugated anti-mouse IgG (Promega), diluted 1:2,500) in phosphate-buffered saline Tween 20, 5% milk. The membranes were incubated with Lumi-Light for detection. Western Blot Analysis of Hog1—The cells were prepared as described previously (31Tamás M.J. Rep M. Thevelein J.M. Hohmann S. FEBS Lett. 2000; 472: 159-165Crossref PubMed Scopus (76) Google Scholar). For AQP9, cells were grown to mid-logarithmic phase and were subsequently stressed with polyols. The samples were rapidly cooled in a dry ice/ethanol bath. The cells were resuspended in loading buffer (100 mm Tris-HCl, pH 6.8, 200 mm dithiothreitol, 4% SDS, 20% glycerol, 0.2% bromphenol blue, 20 mm mercaptoethanol, 10 mm NaF, 0.1 mm sodium vanadate, Protease inhibitor (Complete EDTA-free Protease Inhibitor mixture tablets; Roche Applied Science)) and thereafter boiled at 100 °C for 10 min. The filters were blocked with 5% skimmed milk in Tris-buffered saline with Tween 20. The antibody recognizing the dually phosphorylated Hog1 (phospho-p38 mitogen-activated protein kinase (Thr180/Tyr182); Cell Signaling) was diluted 1:1000 in 5% bovine serum albumin dissolved in Tris-buffered saline with Tween 20, and the membrane was incubated overnight at 4 °C. An antibody against total Hog1 was used as a loading control (yC-20; Santa Cruz Biotechnology) and was diluted 1:200 in 5% milk, Tris-buffered saline with Tween 20. The membrane was incubated for 1 h at room temperature. The secondary antibodies (horseradish peroxidase-conjugated anti-rabbit IgG, Cell signaling; and donkey horseradish peroxidase-conjugated anti-goat IgG, Santa Cruz Biotechnology) were used in 1:2000 and 1:1500 dilutions, respectively. The Lumi-Light Western blotting Substrate (Roche Applied Science) as well as the FUJIFILM LAS-1000 camera was used for visualization. Northern Blot Analysis—RNA extraction and electrophoresis were performed as described previously (32De Winde J.H. Crauwels M. Hohmann S. Thevelein J.M. Winderickx J. Eur. J. Biochem. 1996; 241: 633-643Crossref PubMed Scopus (107) Google Scholar). PCR fragments of the GRE2 open reading frame and the 18 S RNA were prepared from genomic DNA template using primers with the following sequences (listed 5′ to 3′): GRE2, TTCAGGTGCTAACGGGTTCA and AATTTGGGAGGCAGTGTCGT; and 18 S RNA, CTATCAACTTTCGATGGTAGG and TATGGTTAAGACTACGACGGT. Probes were labeled with [α-32P]dCTP using the Megaprime kit (Amersham Biosciences) purified on Nick columns (Amersham Biosciences) and employed with an activity of 1,000,000 cpm/ml. To detect and quantify signals the Molecular Imager FX, the Exposure cassette K (Bio-Rad) and the Quantity One software v 4.2.3 (Bio-Rad) were used. 18 S RNA was used to normalize transcript levels. Water and Solute Transport Measurements—Yeast cells defective for the fusion of terminal secretory vesicles with the plasma membrane (sec6) at a nonpermissive temperature of 37 °C were first grown at 26 °C to a final A600 nm of ∼1.0 in synthetic complete medium lacking uracil (see above) to maintain the wild type or mutant FPS1 expression vector. Copper sulfate was added to a final concentration of 100 μm, and the cells were incubated at 37 °C with shaking for another 2 h. The cells were harvested, washed, and converted to spheroplasts as described (33Brodsky J.L. Hamamoto S. Feldheim D. Schekman R. J. Cell Biol. 1993; 120: 95-102Crossref PubMed Scopus (130) Google Scholar). Carboxyfluorescein (CF)-loaded secretory vesicles were prepared as published (34Coury L.A. Zeidel M.L. Brodsky J.L. Methods Enzymol. 1999; 306: 169-186Crossref PubMed Scopus (5) Google Scholar, 35Coury L.A. Mathai J.C. Prasad G.V. Brodsky J.L. Agre P. Zeidel M.L. Am. J. Physiol. 1998; 274: F34-F42PubMed Google Scholar) and washed three times by centrifugation at 144,000 × g to remove unincorporated CF. Water transport was measured by stopped flow fluorescence as described previously (35Coury L.A. Mathai J.C. Prasad G.V. Brodsky J.L. Agre P. Zeidel M.L. Am. J. Physiol. 1998; 274: F34-F42PubMed Google Scholar). In brief, the vesicles were subjected to an abrupt doubling of external osmotic pressure, and the time course of vesicle shrinkage was monitored as a decrease in fluorescence intensity. The time course of volume change was fitted to a single exponential, and the osmotic water permeability was calculated as described (36Zeidel M.L. Ambudkar S.V. Smith B.L. Agre P. Biochemistry. 1992; 31: 7436-7440Crossref PubMed Scopus (521) Google Scholar). The transport of other polyols was measured after loading vesicles with the indicated polyol in a 1 m solution for 30 min, and the efflux of each polyol was monitored as a decrease in CF-mediated fluorescence over time after the vesicles were rapidly mixed into an iso-osmolar solution lacking the polyol. The permeability coefficients of various sugars were computed from a single exponential fit, as described (37Lande M.B. Donovan J.M. Zeidel M.L. J. Gen. Physiol. 1995; 106: 67-84Crossref PubMed Scopus (315) Google Scholar) using equations formulated for each osmotic gradient (dVrel/dt = (Psolute)(SAV)(0.000763)(1611/Vrel-2117)). The vesicle size (to calculate the surface area of the vesicle (SAV)) was measured by laser light scattering using a DynaPro particle sizer. Expression of Hyperactive Fps1 Suppresses the Growth Defect of the gpd1Δ gpd2Δ Mutant on Polyols—A gpd1Δ gpd2Δ double mutant is unable to produce glycerol and hence does not grow in the presence of 0.8 m NaCl (6Ansell R. Granath K. Hohmann S. Thevelein J.M. Adler L. EMBO J. 1997; 16: 2179-2187Crossref PubMed Scopus (433) Google Scholar) (Fig. 1A). Growth was also inhibited in the presence of 2 m glycerol or 1 m erythritol, ribitol, xylitol, mannitol, or sorbitol (Fig. 1, A and B). When transformed with a plasmid mediating expression of hyperactive Fps1-Δ1, the wild type strain grew poorly on 0.8 m NaCl (Fig. 1A) because it was unable to retain glycerol inside the cell (12Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Crossref PubMed Scopus (296) Google Scholar). The Fps1-Δ1-expressing gpd1Δ gpd2Δ double mutant grew almost like wild type in the presence of 2 m glycerol and 1 m erythritol, ribitol, and xylitol (Fig. 1A). In other words, Fps1-Δ1 suppressed the growth defect of the gpd1Δ gpd2Δ double mutant on medium with high concentrations of polyols of five or fewer carbon atoms. Growth curves in liquid culture (Fig. 2) both confirmed and added further insight to the observed pattern. Wild type and gpd1Δ gpd2Δ mutant grew equally well in synthetic growth medium (YNB). As expected, the gpd1Δ gpd2Δ mutant did not grow in medium containing 0.8 m NaCl, irrespective of the plasmid it contained. Growth of the wild type was reduced when transformed with hyperactive Fps1-Δ1, as explained above. Interestingly, the effects conferred by polyols were less severe in liquid medium than on plates. Growth on 2 m glycerol resulted in a lag phase for the gpd1Δ gpd2Δ mutant, which was suppressed by hyperactive Fps1-Δ1 (not shown). In a similar manner, xylitol caused a lag phase and slower growth for the gpd1Δ gpd2Δ mutant, but when expressing hyperactive Fps1-Δ1 the growth profile was similar to that of wild type (Fig. 2). Hyperactive Fps1-Δ1 allowed some growth even in the presence of mannitol (not shown) or sorbitol, although to a much lesser extent than in xylitol-containing medium (Fig. 2). However, hyperactive Fps1-Δ1 caused a growth inhibition in wild type cells grown in the presence of sorbitol, probably because sorbitol uptake could not fully compensate for the simultaneous glycerol loss (see below for a description of relative uptake rates). Because the Fps1-Δ1-expressing gpd1Δ gpd2Δ mutant grew in the presence of 1 m sorbitol or mannitol in liquid medium but not on plates, we tested plate growth with lower polyol concentrations. Indeed, at 0.75 m sorbitol or mannitol, Fps1-Δ1 suppressed the growth defect of the gpd1Δ gpd2Δ mutant. At 0.5 m, the vector control grew slowly, and this growth was clearly improved by expression of Fps1-Δ1. Hence, Fps1-Δ1 weakly suppressed the growth defect of the gpd1Δ gpd2Δ mutant in the presence of sorbitol and mannitol. Fps1-mediated Polyol Transport—We surmised that suppression of the growth defect of the gpd1Δ gpd2Δ mutant by expression of Fps1-Δ1 was due to influx of polyols, resulting in equilibration across the plasma membrane and relief from osmostress. Influx of polyols may be more effective in liquid medium than on plates because cells are fully surrounded by medium. Indeed, the extent to which Fps1-Δ1 suppressed the growth defect of the gpd1Δ gpd2Δ mutant seemed to correlate well with the reported relative transport rates for these substrates through aquaglyceroporins (18Fu D. Libson A. Miercke L.J. Weitzman C. Nollert P. Krucinski J. Stroud R.M. Science. 2000; 290: 481-486Crossref PubMed Scopus (889) Google Scholar). To directly measure transport rate, the uptake of three commercially available radiolabeled polyols, glycerol, xylitol, and sorbitol, was monitored (Fig. 3). Fps1-Δ1 transported glycerol with a relatively high rate, whereas wild type Fps1 mediated only moderate glycerol transport, as observed previously (12Tamás M.J. Luyten K. Sutherland F.C.W. Hernandez A. Albertyn J. Valadi H. Li H. Prior B.A. Kilian S.G. Ramos J. Gustafsson L. Thevelein J.M. Hohmann S. Mol. Microbiol. 1999; 31: 1087-1104Crossref PubMed Scopus (296) Google Scholar, 14Tamás M.J. Karlgren S. Bill R.M. Hedfalk K. Allegri L. Ferreira M. Thevelein J.M. Rydstrom J. Mullins J.G. Hohmann S. J. Biol. Chem. 2003; 278: 6337-6345Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Fps1-Δ1 also mediated xylitol uptake, although at a clearly lower rate than glycerol uptake, whereas transport of sorbitol was barely detectable. Wild type Fps1 did not mediate detectable uptake of xylitol or sorbitol in this assay. Hence, Fps1-Δ1 mediates uptake of glycerol, xylitol, and sorbitol with progressively decreasing rates. Purified and reconstituted Fps1 is so far not available. To study transport through Fps1 and Fps1-Δ1 in a more defined system, we purified secretory vesicles from a sec6 mutant (expressing Fps1 or Fps1-Δ1) following a shift to restrictive temperature, which induces vesicle accumulation. Such vesicles indeed contained the proteins (Fig. 4A), and secretory vesicles for further functional studies were isolated at the time point at which expression was maximal. Transport assays were performed by monitoring the kinetics of osmotic shrinkage of polyol and CF loaded vesicles upon dilution into an iso-osmolar buffer lacking the polyol. Polyol efflux causes fluorescence quenching of CF. Using this system, we found that wild type Fps1 mediated glycerol transport as well as transport of xylitol and ribitol, although the two pentiols were transported at a rate ∼1 order of magnitude lower than glycerol (Fig. 4B). Moreover, Fps1-Δ1 mediated an ∼2–3-fold higher transport rate than wild type Fps1 for all substrates tested. Hence, these data confirmed and were fully consistent with the data obtained using whole yeast cells. For Fps1 to function properly as an osmogated glycerol channel in osmoregulation it would be important not to transport significant amounts of water simultaneously. The yeast vesicle system allowed testing of whether Fps1 facilitates water transport. For this, osmotic shrinkage of vesicles containing Fps1 or Fps1-Δ1 was compared with that of secretory vesicles containing AQP1, which is specific for water transport (15Borgnia M. Nielsen S. Engel A. Agre P. Annu. Rev. Biochem. 1999; 68: 425-458Crossref PubMed Scopus (705) Google Scholar). We first found that AQP1 mediated significant water transport (Fig. 4C), as described previously (35Coury L.A. Mathai J.C. Prasad G.V. Brodsky J.L. Agre P. Zeidel M.L. Am. J. Physiol. 1998; 274: F34-F42PubMed Google Scholar), whereas neither Fps1 nor Fps1-Δ1 mediated significant water uptake. Hence, it appears that Fps1 mediates no or o

Referência(s)