Portal de Periódicos da CAPES

Artigo Acesso aberto Produção Nacional Revisado por pares

BIBTEX RIS

Mitochondrial and nuclear DNA characterization in the Melipona species (Hymenoptera, Meliponini) by RFLP analysis

2002; BioMed Central; Volume: 137; Issue: 3 Linguagem: Inglês

10.1034/j.1601-5223.2002.01685.x

1601-5223

Tânia M. Fernandes-Salomão, Júpiter Israel Muro-Abad, Lúcio Antônio de Oliveira Campos, Elza Fernandes de Araújo,

Insect and Arachnid Ecology and Behavior

The exclusively neotropical genus Melipona of stingless bees, is the most distinctive meliponine genus comprising approximately 40 described species with geographical distributions ranging from Mexico to Argentina (Michener 2000). These species are essential pollinators of native plants (Kerr et al. 1996) and crops (Heard 1999) and are vital agents for conservation of the flora and fauna of the South America. Increased environmental degradation has led to the decline of pollinators throughout the world and to the current crisis in pollination in the wild as well as in agricultural crops. The by Schwarz (1932) detailed revision of the genus Melipona, based on morphology, has been reviewed by Moure and Kerr (1950) and Moure (1992). Recently, Rocha and Pompolo (1998) and Rocha et al. (2002) studied karyotypes of different Melipona species and divided the species into two groups based on chromatin composition and on heterochromatin content and distribution. Group I species (M. bicolor, M. quadrifasciata, M. asilvai, M.marginata and M. subnitida) contain less than 50 % heterochromatin and highly heterogeneous chromatin compositions. Group II species (M. capixaba, M. compressipes, M. crinita, M. seminigra and M. scutellaris) contain more than 50 % heterochromatin and a homogeneous chromatin composition. Studies focusing on aspects of molecular biology of these species are now needed. Restriction analyses of mitochondrial DNA and the CO-I/CO-II (mtDNA) region have generated good markers for separation of species, subspecies and populations in the genus Apis, however, very few studies of Meliponini mtDNA have been reported. Recently, Francisco et al. (2001) characterized the mtDNA of five Plebeia bee species by RFLP. The authors detected a high level of interspecific variability and estimated a total mtDNA length of 18,500 bp. The internal transcribed spacers from nuclear rDNA (ITS-1 and ITS-2) are frequently used in insect taxonomic studies and restriction polymorphisms of ITS sequences have been used to distinguish related species, however, no ITS region characterization studies have yet been published for bee species. We attempt here to clarify Melipona phylogeny through an analysis of the mitochondrial genome and intergenic spacer region ITS-1 (rDNA) of the species in this genus in an attempt to better understand the relationships within this group. We report here the results of comparisons of RFLP patterns of the mitochondrial genome and the CO-I/CO-II (mtDNA) and ITS-1 (rDNA) regions of 16 Melipona species. Adult worker bees of sixteen Melipona species were collected in different Brazilian regions (Table 1). Species identification was based on morphology. One individual of each species was preserved in the bee collection of the Entomology Museum at the Federal University of Viçosa, Minas Gerais, Brazil. Mitochondrial DNA from M. bicolor was isolated by the method described for the grasshopper Chorthippus parallelus (Zhang et al. 1995), with minor modifications. This DNA was cleaved with Pst I and Hind III (Stratagene) as recommended by the suppliers. Total DNA from M. quadrifasciata, M. mandacaia, M. bicolor, M. marginata, M. rufiventris, M. scutellaris, M. quinquefasciata and M. compressipes was isolated from the bees thorax according to Waldschmidt et al. (1997) and cleaved with Hind III, Eco RI, Pst I, Bcl I and Hae III (Stratagene) as specified by the manufacturer. The digested DNA fragments were resolved by electrophoresis and transferred to nylon membranes (Stratagene) according to Southern (1975) and probed with mtDNA from M. bicolor that had been labeled with the non-radioactive Dig High Prime DNA Labeling and Detection Kit (Roche). Hybridization, washing and detection were carried out following suppliers’ suggestions. Membranes were exposed to XOMATK film (Kodak) for 15 minutes. Melipona template DNA was extracted from the thorax of individual bees and used for amplification of the CO-I/CO-II mtDNA region using the primers 5′ TCTATACCACGACGTTATTC 3′ and 5′ GATCAATATCATTGATGACC 3′ (Smith et al. 1997), and amplification of the ITS-1 rDNA region using the primers 5′ TAACAAGGTTTCCGTAGGTG 3′ and 5′ AGCTRGCTGCGTTCTTCATCGA 3′ (Sheppard and McPheron 1991). The PCR-amplified products were analyzed by electrophoresis on 2.0 % (w/v) high-resolution agarose gel (Sigma) or precipitated for restriction analysis. The amplified Melipona CO-I/C0-II region was digested with Dra I, Hinf I, Ssp I and Hae III (Stratagene) as specified by the manufacturer. Dra I, Hinc II, Nco I and Ava II were used to digest the amplified ITS-1 region. Restriction fragments were separated by electrophoresis on 2 % (w/v) high-resolution agarose gel. Alternatively, samples were loaded onto 12 % (w/v) polyacrylamide gels to obtain better band resolution. Detailed information of the methods used can be obtained from Fernandes-Salomão ([email protected]). The technique described by Zhang et al. (1995) resulted in isolation of M. bicolor mtDNA of excellent quality and at a concentration that permitted RFLP analysis in agarose gel. Furthermore, when utilized as probe, highly reproducible RFLP fragments of mtDNA from different Melipona species were detected. Techniques for identifying polymorphisms in mtDNA are generally difficult or expensive, although rapid mtDNA isolation techniques (minipreps) have been used to obtain mtDNA adequate for RFLP analyses in insects (Latorre et al. 1986; Smith and Brown 1990). Only DNA from M. quadrifasciata, M. mandacaia, M. bicolor and M. marginata presented restriction profiles typical of mtDNA, indicating the need for standardization of specimen and total DNA conservation methods. Different species can require different DNA extraction protocols for this kind of analysis (Francisco et al. 2001). A unique restriction site was detected for Hae III. A high level of interspecific variability was observed for Pst I, Bcl I, Hind III and Eco RI. The electrophoretic band pattern obtained with Eco RI was species-specific and total length of Melipona mtDNA was estimated at 18,500±100 bp. The estimated mtDNA length agrees with that estimated for Plebeia species, 18,500 bp (Francisco et al. 2001) and is greater than that found for Apis melliferaliguistica, 16,343 bp (Crozier and Crozier 1993). The estimated CO-I/CO-II fragment length was 630 bp in M. quinquefasciata, M. compressipes and M. marginata and 650 bp in the other species. The DNA fragments obtained are about 198 to 218 bp shorter than those found in A. mellifera liguistica, according to the mitochondrial genome map of this subspecies (Crozier and Crozier 1993). This result suggest that the non-coding region from 192 to 196 bp (motif Q) that lies between subunits I and II of the A. mellifera cytochrome oxidase genes (Cornuet et al. 1991; Garnery et al. 1993) is not present in the genus Melipona. Similar results have also been reported for other Hymenoptera (Cornuet et al. 1991; Taylor et al. 1997). No ITS-1 DNA fragment was detected when total DNA from M. eburnea, M. crinita, M. flavolineata, M. fuliginosa and M. asilvai was amplified by PCR. This was probably due to a failure to obtain sufficient DNA. Based on the estimated length of the amplified DNA fragments, four groups were distinguished: 1) M. quadrifasciata, M. mandacaia, M. favosa, M. bicolor, M. quinquefasciata and M. compressipes (1,430 bp), 2) M. scutellaris, M. capixaba and M. seminigra (1,540 bp), 3) M. marginata (1,640 bp) and 4) M. rufiventris (1,940 bp). The estimated ITS-1 lengths indicate that the Melipona ITS-1 region is longer than in most other eukaryotic species, since it has generally been found to be less than 1000 bp long. Complete ITS-1 sequences of M. quadrifasciata, M. mandacaia, M. scutellaris and partial sequences of M. rufiventris indicated that this variable length is related principally to insertion events, deletion and repeated sequences of one, two, three and four nucleotides (Fernandes-Salomão, unpubl.). Variable ITS-1 length among species of the same genus has been reported for several organisms, including insects and such variation has mainly been attributed to the presence of a variable number of repeated sequences in the ITS-1 elements (Paskewitz et al. 1993; Von Der Schulenburg et al. 2001). Table 2 gives the relation between obtained DNA fragments and lengths. The M. quinquefasciata RFLP profile diverges considerably from that of the rest of Melipona (CO-I/C0-II analysis) and is only similar to the profile found in M. compressipes (ITS-1 analysis). This is the only Melipona species that contains supernumerous chromosomes and 2n varies from 19 to 21 (Rocha 2002). It is also the only species that nests on the ground. M. quadrafasciata and M. mandacaia had identical band patterns in the two regions analyzed (ITS-1 and CO-I/CO-II). These two species shared the same electrophoretic profiles of diverse isoenzyme systems (Tavares, unpubl.) whereas most other Melipona have quite different profiles (Tavares, unpubl.; Falcão and Contel 1990). A phylogenetic proximity between M. quadrafasciata and M. mandacaia is supported by sequence data that show approximately 98.0 % similarity between their rDNA ITS-1 regions (Fernandes-Salomão, unpubl.). The RFLP profiles of M. scutellaris, M. capixaba and M. seminigra are also identical in the two regions analyzed. The genetic proximity of these species was also observed by Rocha and Pompolo (1998) and Rocha et al. (2002) based on karyotype analysis. Furthermore, M. scutellaris and M. capixaba are able to cross and produce fertile hybrids (Nascimento et al. 2000). The CO-I/CO-II restriction profiles of the species M. marginata, M. eburnea, M. crinita and M. flavolineata were very similar to those obtained for M. rufiventris, M. scutellaris, M. capixaba, and M. seminigra indicating a considerable genetic proximity between them. PCR-RFLP analysis ITS-1 (rDNA) and CO-I/CO-II (mtDNA) regions of the Melipona species placed in Group I (highly heterogeneous chromatin) by Rocha et al. (2002), had highly variable RFLP profiles, and, may not be closely related. With the exception of M. compressipes, the species in group II (homogeneous chromatin), have similar restriction profiles and may have a close phylogenetic relationship as proposed by Rocha et al. (2002). These RFLP data presented here are compatible with the phylogenetic information obtained through karyotype comparisons. This Research was supported by FAPEMIG, CNPq (Brazilian Research Council) and the Federal University of Viçosa (UFV), Brazil. T. M. Fernandes-Salomão received a scholarship from CAPES.