Detailed Architecture of the Barley ChloroplastpsbD-psbC Blue Light-responsive Promoter
1999; Elsevier BV; Volume: 274; Issue: 8 Linguagem: Inglês
10.1074/jbc.274.8.4684
ISSN1083-351X
AutoresMinkyun Kim, Karen E. Thum, Daryl T. Morishige, John E. Mullet,
Tópico(s)Photosynthetic Processes and Mechanisms
ResumoThe photosystem II reaction center chlorophyll protein D2, is encoded by the chloroplast gene psbD. PsbDis transcribed from at least three different promoters, one which is activated by high fluence blue light. Sequences within 130 base pairs (bp) of the psbD blue light-responsive promoter (BLRP) are highly conserved in higher plants. In this study, the structure of thepsbD BLRP was analyzed in detail using deletion and site-directed mutagenesis and in vitro transcription. Deletion analysis showed that a 53-bp DNA region of thepsbD BLRP, from −57 to −5, was sufficient for transcription in vitro. Mutation of a putative prokaryotic −10 element (TATTCT) located from −7 to −12 inhibited transcription from the psbD BLRP. In contrast, mutation of a putative prokaryotic −35 element, had no influence on transcription. Mutation of a TATATA sequence located between the barley psbA −10 and −35 elements significantly reduced transcription from this promoter. However, site-directed mutation of sequences located between −35 and −10 had no effect on transcription from the psbDBLRP. Transcription from the psbD BLRP was previously shown to require a 22-bp sequence, termed the AAG-box, located between −36 and −57. The AAG-box specifically binds the protein complex AGF. Site-directed mutagenesis identified two different sequence motifs in the AAG-box that are important for transcription in vitro. Based on these results, we propose that positive factors bind to the AAG-box and interact with the chloroplast-encoded RNA polymerase to promote transcription from the psbD BLRP. Transcription from the psbD BLRP is thus similar to type II bacterial promoters that use activating proteins to stimulate transcription. Transcription of the psbD BLRP was ∼6.5-fold greater in plastid extracts from illuminated versus dark-grown plants. This suggests that light-induced activation of this promoter in vivo involves factors interacting with the 53-bp psbDBLRP in vitro. The photosystem II reaction center chlorophyll protein D2, is encoded by the chloroplast gene psbD. PsbDis transcribed from at least three different promoters, one which is activated by high fluence blue light. Sequences within 130 base pairs (bp) of the psbD blue light-responsive promoter (BLRP) are highly conserved in higher plants. In this study, the structure of thepsbD BLRP was analyzed in detail using deletion and site-directed mutagenesis and in vitro transcription. Deletion analysis showed that a 53-bp DNA region of thepsbD BLRP, from −57 to −5, was sufficient for transcription in vitro. Mutation of a putative prokaryotic −10 element (TATTCT) located from −7 to −12 inhibited transcription from the psbD BLRP. In contrast, mutation of a putative prokaryotic −35 element, had no influence on transcription. Mutation of a TATATA sequence located between the barley psbA −10 and −35 elements significantly reduced transcription from this promoter. However, site-directed mutation of sequences located between −35 and −10 had no effect on transcription from the psbDBLRP. Transcription from the psbD BLRP was previously shown to require a 22-bp sequence, termed the AAG-box, located between −36 and −57. The AAG-box specifically binds the protein complex AGF. Site-directed mutagenesis identified two different sequence motifs in the AAG-box that are important for transcription in vitro. Based on these results, we propose that positive factors bind to the AAG-box and interact with the chloroplast-encoded RNA polymerase to promote transcription from the psbD BLRP. Transcription from the psbD BLRP is thus similar to type II bacterial promoters that use activating proteins to stimulate transcription. Transcription of the psbD BLRP was ∼6.5-fold greater in plastid extracts from illuminated versus dark-grown plants. This suggests that light-induced activation of this promoter in vivo involves factors interacting with the 53-bp psbDBLRP in vitro. Photosystem II contains at least four plastid-encoded chlorophyll apoproteins (D1, D2, CP47, CP43). Among these, D2 and D1 form a heterodimer, which houses the photosystem II reaction center chlorophyll P680. D1 and D2 are relatively unstable in illuminated plants (1Mattoo A.K. Hoffman-Falk H. Marder J.B. Edelman M. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 1380-1384Crossref PubMed Google Scholar, 2Ohad I. Kyle D.J. Hirschberg J. EMBO J. 1985; 4: 1655-1659Crossref PubMed Google Scholar, 3Schuster G. Timberg R. Ohad I. Eur. J. Biochem. 1988; 177: 403-410Crossref PubMed Scopus (181) Google Scholar, 4Mattoo A.K. Marder J.B. Edelman M. Cell. 1989; 56: 241-246Abstract Full Text PDF PubMed Scopus (254) Google Scholar, 5Christopher D.A. Mullet J.E. Plant Physiol. 1994; 104: 1119-1129Crossref PubMed Scopus (107) Google Scholar). Therefore, synthesis of D1 and D2 is selectively elevated in mature barley chloroplasts in order to maintain the levels of these subunits and PSII function (5Christopher D.A. Mullet J.E. Plant Physiol. 1994; 104: 1119-1129Crossref PubMed Scopus (107) Google Scholar, 6Gamble P.E. Sexton T.B. Mullet J.E. EMBO J. 1988; 7: 1289-1297Crossref PubMed Scopus (41) Google Scholar). Maintenance of high rates of D1 and D2 synthesis in mature barley chloroplasts is paralleled by the retention of elevated levels of psbA and psbDmRNAs, which encode these proteins (6Gamble P.E. Sexton T.B. Mullet J.E. EMBO J. 1988; 7: 1289-1297Crossref PubMed Scopus (41) Google Scholar, 7Mullet J.E. Klein R.R. EMBO J. 1987; 6: 1571-1579Crossref PubMed Scopus (185) Google Scholar, 8Baumgartner B.J. Rapp J.C. Mullet J.E. Plant Physiol. 1993; 101: 781-791Crossref PubMed Scopus (135) Google Scholar). D1 mRNA levels remain high in mature barley chloroplasts primarily due to the high stability of its mRNA, although transcription from psbAis also increased by light (9Klein R.R. Mullet J.E. J. Biol. Chem. 1987; 262: 4341-4348Abstract Full Text PDF PubMed Google Scholar, 10Klaff P. Gruissem W. Plant Cell. 1991; 3: 517-529Crossref PubMed Google Scholar, 11Rapp J.C. Baumgartner B.J. Mullet J. J. Biol. Chem. 1992; 267: 21404-21411Abstract Full Text PDF PubMed Google Scholar, 12Kim M. Christopher D.A. Mullet J.E. Plant Mol. Biol. 1993; 22: 447-463Crossref PubMed Scopus (116) Google Scholar). Maintenance of high levels ofpsbD mRNA results primarily from the activation ofpsbD transcription by blue light combined with a small increase in RNA stability (5Christopher D.A. Mullet J.E. Plant Physiol. 1994; 104: 1119-1129Crossref PubMed Scopus (107) Google Scholar, 13Sexton T.B. Jones J.T. Mullet J.E. Curr. Genet. 1990; 17: 445-454Crossref PubMed Scopus (51) Google Scholar). The chloroplast genome in most higher plants is circular and ranges in size from 120 to 217 kilobase pairs (reviewed in Refs. 14Palmer J.D. Trends Genet. 1990; 6: 115-120Abstract Full Text PDF PubMed Scopus (202) Google Scholar, 15Sugiura M. Plant Mol. Biol. 1992; 19: 149-168Crossref PubMed Scopus (494) Google Scholar, 16Gruissem W. Tonkyn J.C. Crit. Rev. Plant Sci. 1993; 12: 19-55Crossref Scopus (139) Google Scholar, 17Mullet J.E. Plant Physiol. 1993; 103: 309-313Crossref PubMed Scopus (197) Google Scholar). The genome encodes approximately 135 genes including genes for rRNAs, tRNAs, subunits of the plastid 70 S ribosome, subunits of an RNA polymerase (rpoA, rpoB, rpoC1, andrpoC2), and proteins that comprise the photosynthetic apparatus. Transcription of the chloroplast genome is complex and highly regulated (reviewed in Refs. 17Mullet J.E. Plant Physiol. 1993; 103: 309-313Crossref PubMed Scopus (197) Google Scholar and 18Stern D.B. Higgs D. Yang J. Trends Plant Sci. 1997; 2: 308-315Abstract Full Text PDF Scopus (454) Google Scholar). Plastid genes are transcribed by at least two different RNA polymerases (RNAPs). 1The abbreviations RNAPRNA polymerasesPCRpolymerase chain reactionbpbase pair(s)BLRPblue light-responsive promoterAGFAAG-binding factor The catalytic subunits of one RNAP are encoded by the chloroplast genesrpoA, rpoB, and rpoC1/C2 (reviewed in Ref. 19Igloi G.L. Kössel H. Crit. Rev. Plant Sci. 1992; 10: 525-558Crossref Scopus (136) Google Scholar). This RNAP recognizes prokaryotic −10 and −35 promoter elements (reviewed in Ref. 18Stern D.B. Higgs D. Yang J. Trends Plant Sci. 1997; 2: 308-315Abstract Full Text PDF Scopus (454) Google Scholar). Other types of plastid promoters have been identified. For example, the promoter for the rps16gene contains only a −35 element (20Neuhaus H. Scholz A. Link G. Curr. Genet. 1989; 15: 63-70Crossref PubMed Scopus (46) Google Scholar). Other genes, such astrnS, trnR (21Gruissem W. Elsner-Menzel C. Latshaw S. Narita J.O. Schaffer M.A. Zurawski G. Nucleic Acids Res. 1986; 14: 7541-7556Crossref PubMed Scopus (56) Google Scholar), rpoB (22Hess W.R. Prombona A. Fieder A. Subramanian A.R. Börner T. EMBO J. 1993; 12: 563-571Crossref PubMed Scopus (177) Google Scholar),rpl32 (23Vera A. Hirose T. Sugiura M. Mol. Gen. Genet. 1996; 251: 518-525PubMed Google Scholar), and rpl23 (24Hübschmann T. Börner T. Plant Mol. Biol. 1998; 36: 493-496Crossref PubMed Scopus (55) Google Scholar) are not preceded by typical prokaryotic promoter consensus elements. Many of these genes are transcribed by a nucleus-encoded RNAP (Refs. 22Hess W.R. Prombona A. Fieder A. Subramanian A.R. Börner T. EMBO J. 1993; 12: 563-571Crossref PubMed Scopus (177) Google Scholar, 25dePamphilis C.W. Palmer J.D. Nature. 1990; 348: 337-339Crossref PubMed Scopus (244) Google Scholar, and 26Lerbs-Mache S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 5509-5513Crossref PubMed Scopus (142) Google Scholar; reviewed in Ref. 17Mullet J.E. Plant Physiol. 1993; 103: 309-313Crossref PubMed Scopus (197) Google Scholar). This polymerase is likely to be encoded by the nuclear gene rpoZ, which shows sequence similarity to the bacteriophage T7 and SP6 RNA polymerases (27Hedtke B. Börner T. Weihe A. Science. 1997; 277: 809-811Crossref PubMed Scopus (309) Google Scholar). Plastid transcription is also regulated via multiple ς-factors (28Tiller K. Link G. Plant Mol. Biol. 1993; 21: 503-513Crossref PubMed Scopus (51) Google Scholar, 29Isono K. Shimizu M. Yoshimoto K. Niwa Y. Satoh K. Yokota A. Kobayashi H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14948-14953Crossref PubMed Scopus (116) Google Scholar, 30Tanaka K. Tozawa Y. Mochizuchi N. Shinozaki K. Nagatani A. Wakasa K. Takahashi H. FEBS Lett. 1997; 413: 309-313Crossref PubMed Scopus (107) Google Scholar), which may be phosphorylated (31Tiller K. Link G. EMBO J. 1993; 12: 1745-1753Crossref PubMed Scopus (111) Google Scholar, 32Baginsky S. Tiller K. Link G. Plant Mol. Biol. 1997; 34: 181-189Crossref PubMed Scopus (76) Google Scholar). Other DNA binding complexes, such as CDF2 and AGF, have been identified, which modulate transcription ofrrn (33Iratni R. Baeza L. Andreeva A. Mache R. Lerbs-Mache S. Genes Dev. 1994; 8: 29228Crossref Scopus (53) Google Scholar), and psbD-psbC (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar), respectively. RNA polymerases polymerase chain reaction base pair(s) blue light-responsive promoter AAG-binding factor In barley, psbD is located in a complex operon that also contains psbC, psbK, psbI,orf62, and trnG (35Sexton T.B. Christopher D.A. Mullet J.E. EMBO J. 1990; 9: 4485-4494Crossref PubMed Scopus (103) Google Scholar). The psbD operon is transcribed from at least three different promoters (13Sexton T.B. Jones J.T. Mullet J.E. Curr. Genet. 1990; 17: 445-454Crossref PubMed Scopus (51) Google Scholar). One of thepsbD promoters is activated when plants are illuminated by high fluence blue light but not by red or far-red illumination (5Christopher D.A. Mullet J.E. Plant Physiol. 1994; 104: 1119-1129Crossref PubMed Scopus (107) Google Scholar, 36Gamble P.E. Mullet J.E. EMBO J. 1989; 8: 2785-2794Crossref PubMed Scopus (62) Google Scholar). Transcripts arising from the blue light-responsive promoter (BLRP) become the most abundant psbD transcripts in chloroplasts of mature barley leaves (13Sexton T.B. Jones J.T. Mullet J.E. Curr. Genet. 1990; 17: 445-454Crossref PubMed Scopus (51) Google Scholar, 37Christopher D.A. Kim M. Mullet J.E. Plant Cell. 1992; 4: 785-798Crossref PubMed Scopus (74) Google Scholar). Light-induced accumulation ofpsbD transcripts has been observed in a wide variety of plants (37Christopher D.A. Kim M. Mullet J.E. Plant Cell. 1992; 4: 785-798Crossref PubMed Scopus (74) Google Scholar, 38Wada T. Tunoyama Y. Shiina T. Toyoshima Y. Plant Physiol. 1994; 104: 1259-1267Crossref PubMed Scopus (36) Google Scholar, 39Chen S.C.G. Wu S.-P. Lo P.-K. Mon D.-P. Chen L.F.O. Physiol. Plant. 1995; 93: 617-623Crossref Scopus (16) Google Scholar). A ∼130-bp region surrounding the psbDBLRP is conserved among cereals, dicots, and black pine (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar, 37Christopher D.A. Kim M. Mullet J.E. Plant Cell. 1992; 4: 785-798Crossref PubMed Scopus (74) Google Scholar) despite DNA rearrangements upstream of the psbD BLRP in some plants (37Christopher D.A. Kim M. Mullet J.E. Plant Cell. 1992; 4: 785-798Crossref PubMed Scopus (74) Google Scholar). The conserved psbD BLRP contains sequences with significant similarity to typical prokaryotic −10 and −35 promoter regions (13Sexton T.B. Jones J.T. Mullet J.E. Curr. Genet. 1990; 17: 445-454Crossref PubMed Scopus (51) Google Scholar). In addition, two conserved regions, termed the AAG-box and PGT-box, are located upstream of the putative −35 element (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). Previously, we showed that the AAG-box and its cognate DNA-binding protein complex, AGF, are required for transcription from the barleypsbD BLRP in vitro (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). Furthermore, the DNA region containing the PGT and AAG-boxes was shown to be important for transcription from the tobacco psbD BLRP in vivo(40Allison L.A. Maliga P. EMBO J. 1995; 14: 3721-3730Crossref PubMed Scopus (86) Google Scholar). In the present study, we define a minimal DNA region required for transcription of the barley psbD BLRP and further dissect the architecture of the promoter using deletion, insertion, and point mutation analyses. Barley (Hordeum vulgare var. Morex) seedlings were grown in controlled environmental chambers at 23 °C as described by Kim et al. (12Kim M. Christopher D.A. Mullet J.E. Plant Mol. Biol. 1993; 22: 447-463Crossref PubMed Scopus (116) Google Scholar). Seedlings were germinated and grown in complete darkness. After 7.5 days, the dark-grown seedlings were either harvested or transferred to a continuously illuminated chamber (fluorescent plus incandescent light, light intensity 250 microeinsteins m−2 s−1) for an additional 16 h before harvesting. Plastids were isolated from the top 5–7 cm of primary leaves of barley seedlings by Percoll gradient (35–75%) centrifugation (41Klein R.R. Mullet J.E. J. Biol. Chem. 1986; 261: 11138-11145Abstract Full Text PDF PubMed Google Scholar). The concentration of plastids was quantitated (plastids per microliter) by phase contrast microscopy using a hemacytometer. The plastid high salt extracts used for in vitro transcription experiments in this study were prepared according to Kim and Mullet (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). Protein extract from 5.2 × 108 plastids obtained from approximately 7.5-day-grown barley plants was used in each in vitro transcription assay. Transcription of exogenous DNA templates in vitro and primer extension analyses of in vitrotranscribed DNA were performed as described by Kim and Mullet (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). The minus 40 primer was used to analyze transcripts originating from the plasmid pLRP140 and its derivative recombinant plasmids; the T3 primer was used for ppsbA138, prbcL216, and their derivative recombinant plasmids. Recombinant plasmids pLRP97, pLRP80, pLRP69, and pLRP121 were constructed based on PCR cloning, using pLRP185 (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar) as a DNA template. The 3′-end primers used for amplification of LRP97, LRP80, and LRP69 were designed based on cDNA-like sequences as follows: LRP97, 5′-TTCGCggATcCAATTTCATCTAC (+33 to +11 region of thepsbD BLRP); LRP80, 5′-TTCATCTggATCcAATTTATATA (+19 to −4 region of the psbD BLRP); LRP69, 5′-GAATTggatccTCAGAATAGCGGA (+7 to +17 region of thepsbD BLRP). Engineered BamHI sites are underscored, and nucleotide changes from native chloroplast sequences are designated by lowercase letters. The 5′-end primer used for PCR amplification of the three DNA fragments mentioned above was based on mRNA-like sequences as follows: 5′-TCAAATCtAgaATAAAATTGGAAA (−81 to −62 region of thepsbD BLRP, engineered XbaI site underscored with nucleotide changes from native chloroplast sequences designated by lowercase letters). The 5′- and 3′-end primers used for PCR amplification of LRP121 are as follows: 5′-end primer, 5′-ATTGGtctAgaCATAAAGTAAGTA (mRNA-like sequences, −68 to −45 region of the psbDBLRP); 3′-end primer, 5′-TTCGCggATcCAATTTCATCTAC (cDNA-like sequences, +33 to +11 region of the psbDBLRP). Both of the engineered BamHI and XbaI sites are underscored, and nucleotide changes from native chloroplast sequences are shown with lowercase letters. All of the PCR products mentioned above were digested by BamHI and XbaI, gel-purified, and ligated into BamHI and XbaI sites of pBluescript SK+. The resulting plasmids were named pLRP97, pLRP80, pLRP69, and pLRP121, respectively. Recombinant plasmids such as pLRP140/bmt, pLRP140/bb′mt, pLRP140/ntSwitch, pLRP140/(−)5nt DL, pLRP140/(−)10nt DL, pLRP140/(+)3nt IN, pLRP140/(+)7nt IN, and pLRP140/(+)10nt IN were constructed based on PCR cloning, using pLRP140 (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar) as a DNA template. The 5′-end primer used for amplification of each DNA fragment to be cloned was designed based on mRNA-like sequences as follows: pLRP140/bmt, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGtagTGA (−76 to −38 region of the psbD BLRP); pLRP140/bb′mt, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGtagTGtgaCC (−76 to −34 region of thepsbD BLRP); pLRP140/ntSwitch, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGACCTGACTCgTTGAATctTGCCTgaAT (−76 to −17 region of the psbD BLRP); pLRP140/(−)5nt DL, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGACCTGACTCC … TGATGCCTC (−76 to −20 region of the psbD BLRP); pLRP140/(−)10nt DL, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGACCTGACTCC … CCTCTATCCGC (−76 to −13 region of the psbD BLRP); pLRP140/(+)3nt IN, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGACCTGACTCCTACTTGAA (−76 to −29 region of the psbD BLRP); pLRP140/(+)7nt IN, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGACCTGACTCCTACTTTGAATCTAGATGCC (−76 to −22 region of the psbD BLRP); pLRP140/(+)10nt IN, CCATAAAATTGGAAAGAAGCATAAAGTAAGTAGACCTGACTCCTACTTTTGAATCTAACGATGCC (−76 to −22 region of the psbD BLRP). Nucleotide changes from native chloroplast sequences are designated by lowercase letters, and deleted or inserted sequences are shown by dots or underlines. The 3′-end primer used for amplification of all of the DNA fragments mentioned above was T7 primer, which hybridizes to the region originating from the vector sequences of pBluescript SK+ in pLRP140. All of the PCR products mentioned above were digested byApaI, gel-purified, and ligated into SmaI andApaI sites of pBluescript SK+. The nucleotide sequences of the cloned DNA fragments were confirmed by dideoxy sequencing reactions. Site-specific base substitution in −10, −35, and TATA elements in pLRP140, prbcL216, and ppsbA138 (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar) was introduced based on a PCR-based "overlap extension technique" described by Higuchi et al. (42Higuchi R. Krummel B. Saiki R.K. Nucleic Acids Res. 1988; 16: 7351-7367Crossref PubMed Scopus (2168) Google Scholar) and Hoet al. (43Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6986) Google Scholar). Previously, prbcL216 was constructed by inserting a PCR-amplified DNA fragment, extending from −156 to +60, flanking the transcription initiation site of the barleyrbcL (44Zurawski G. Clegg M.T. Brown A.H.D. Genetics. 1984; 106: 735-749Crossref PubMed Google Scholar), into BamHI and EcoRI sites of pBluescript SK+. The inside primers, coupled with the outside primers, to generate two overlapping primary PCR fragments, which bear the same mutations in the region of overlap, are as follows: pLRP140/−35mt, 5′-TGACTCCaTcAATGATGCCT for upper strand primer, 3′-ACTGAGGtAgTTACTACGGA for lower strand primer (−40 to −21 region of the psbD BLRP, respectively); pLRP140/−10mt, 5′-TATCCGCaATTCaGATATAT for upper strand primer, 3′-ATAGGCGtTAAGtCTATATA for lower strand primer (−19 to +1 region of the psbD BLRP, respectively); pLRP140/−35&−10mt, 5′-TCCaTcAATGATGCCTCTATCCGCaATTCaGAT for upper strand primer, 3′-AGGtAgTTACTACGGAGAATAGGCGtTAAGtCTA for lower strand primer (−36 to −4 region of the psbD BLRP, respectively); prbcL216/−35mt, 5′-ATTTGGGaTcCGCTATACCT for upper strand primer, 3′-TAAACCCtAgGCGATATGGA for lower strand primer (−41 to −22 region of the barley rbcL, respectively); prbcL216/−10mt, 5′-CAAGAGTAaACAAaAATGATGG for upper strand primer, 3′-GTTCTCATtTGTTtTTACTACC for lower strand primer (−19 to +4 region of the barley rbcL, respectively); ppsbA138/−35mt, 5′-TGACTTGGaTcACATTGGTATA for upper strand, 3′-ACTGAACCtAgTGTAACCATAT for lower strand primer (−45 to −19 region of the barleypsbA, respectively); ppsbA138/−10mt, 5′-GTCTATGTaATACaGTTAAATA for upper strand primer, 3′-CAGATACAtTATGtCAATTTAT for lower strand primer (−21 to +1 region of the barley psbA, respectively (45Boyer S.K. Mullet J.E. Nucleic Acids Res. 1988; 16: 8184Crossref PubMed Scopus (33) Google Scholar)); ppsbA138/TATAmt, 5′-GACATTGGaAgAaAGTCTATGT for upper strand primer, 3′-CTGTAACCtTcTtTCAGATACA for lower strand primer (−35 to −14 region of the barley psbA, respectively); ppsbA138/−35&TATAmt, 5′-TGACTTGGaTcACATTGGaAgAaAGTCTAT for upper strand primer, 3′-ACTGAACCtAgTGTAACCtTcTtTCAGATA for lower strand primer (−45 to −16 region of the barley psbA, respectively). The specific base substitutions introduced in each primer, which create mismatch between a primer and the individual template target sequence, are designated by lowercase letters. T3 and T7 primers, which hybridize to the regions originating from the vector sequences of pBluescript SK+ in pLRP140, prbcL216, and ppsbA138, respectively, were used together with the primers described above to generate the overlapping primary PCR fragments. Each set of overlapping primary PCR products was gel-separated, mixed together, denatured, and allowed to reanneal. Each resulting extended segment was then used for the secondary amplification of the combined sequences, using the outside T3 and T7 primers, which were employed to produce the primary fragments. After the secondary PCR amplification, XbaI and XhoI restriction enzyme sites were used to insert the individual DNA fragments into pBluescript SK+. The structure of the barley chloroplast psbD BLRP is shown in Fig. 1 A. Comparisons of the psbD BLRP region among numerous plants showed several stretches of sequence conservation from approximately +30 to −100. In particular, sequences surrounding the AAG-box (−36 to −64) and PGT-box (−71 to −100) are highly conserved (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar, 37Christopher D.A. Kim M. Mullet J.E. Plant Cell. 1992; 4: 785-798Crossref PubMed Scopus (74) Google Scholar). Previous analysis of the psbD BLRP demonstrated that the region from +64 to −76 was sufficient to activate transcriptionin vitro (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). In this study, sequences important for transcription in vitro were further delineated using a series of deletions of pLRP140 (Fig. 1 A). Recombinant plasmids pLRP97, pLRP80, and pLRP69 contain a series of 3′-end deletions of the psbD BLRP (Fig. 1 A). Each of the recombinant plasmids was added to chloroplast in vitro transcription extracts obtained from 8-day-old barley plants that had been illuminated for 16 h. The psbDtranscripts produced from the plasmids were assayed using primer extension analysis. No psbD transcript 5′ termini were observed when mock transcription reactions were analyzed (data not shown). However, as shown in Fig. 1 B (lanes 1–4), all of the 3′ deletion recombinant plasmids and pLRP140 were equally good templates. Similar results were observed with plastid extracts from 7.5-day-old, dark-grown barley plants (data not shown). Previous analyses demonstrated that the sequence AAAGTAAG (−54 to −47) in the AAG-box (see Fig. 1 A) was required for transcription from the BLRP (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). To examine the influence of sequences upstream of this sequence, pLRP121 was constructed, which contains a 5′ deletion to −57 (Fig. 1 A). This deletion caused no loss of transcription activity from the psbD BLRP (Fig.1 B, lane 5). These results indicate that the ∼53-bp DNA region from −57 to −5 is sufficient for transcription from the psbD BLRP in vitro. The sites of transcription initiation from the 3′ deletion constructs of pLRP140 were fine mapped using primer extension analysis (Fig.2). The 5′ termini of the psbDtranscripts produced from pLRP97 and pLRP80 mapped seven nucleotides downstream from a potential −10 promoter element (TATTCT) at the same site as the 5′ terminus of the transcript produced from pLRP140 (34Kim M. Mullet J.E. Plant Cell. 1995; 7: 1445-1457Crossref PubMed Scopus (72) Google Scholar). Similarly, transcripts produced from pLRP69, which contained a 3′ deletion to −5, mapped seven nucleotides downstream from the TATTCT −10 sequence although native nucleotides from +1 to −4 (TATAT) had been deleted and replaced by CTAGG. This indicates that the sequences immediately surrounding the site of transcription initiation can be modified with minimal influence on transcription initiation. The psbD BLRP contains potential prokaryotic −35 (TTGAAT) and −10 (TATTCT) promoter elements, located at positions −28 to −33 and −7 to −12, respectively (see Fig. 1 A). These sequences are separated by 15 bp. Similar prokaryotic promoter elements, which are separated by 18 bp, have previously been identified upstream of the sites of transcription initiation in therbcL and psbA promoters (reviewed in Ref. 16Gruissem W. Tonkyn J.C. Crit. Rev. Plant Sci. 1993; 12: 19-55Crossref Scopus (139) Google Scholar). In addition, a TATATA sequence located between the psbA −10 and −35 promoter elements contributes to promoter activity in mustard (46Eisermann A. Tiller K. Link G. EMBO J. 1990; 9: 3981-3987Crossref PubMed Scopus (63) Google Scholar). The function of the putative −10 and −35 prokaryotic promoter elements present in the psbD BLRP was analyzed by site-directed mutagenesis. As a control, the influence of modifying the −10 and −35 elements in the rbcL and psbApromoters was examined to ensure the in vitro transcription extract was faithfully replicating previous results. Our general approach was to introduce point mutations in potential −35 and −10 sequences at sites that show the highest conservation in both plastid and bacterial promoters (−35, TTGaca; −10, TAtaaT) (Ref. 47Hawley D.K. McClure W.R. Nucleic Acids Res. 1983; 11: 2237-2255Crossref PubMed Scopus (1520) Google Scholar; reviewed in Refs. 16Gruissem W. Tonkyn J.C. Crit. Rev. Plant Sci. 1993; 12: 19-55Crossref Scopus (139) Google Scholar and 48Siebenlist U. Simpson R.B. Gilbert W. Cell. 1980; 20: 269-281Abstract Full Text PDF PubMed Scopus (581) Google Scholar, 49Hanley-Bowdoin L. Chua N.-H. Trends Biochem. Sci. 1987; 12: 67-70Abstract Full Text PDF Scopus (68) Google Scholar, 50Zurawski G. Clegg M.T. Annu. Rev. Plant Physiol. 1987; 38: 391-418Crossref Google Scholar, 51Link G. Nover L. Plant Promoters and Transcription Factors. Springer-Verlag, Heidelberg1994: 63-83Google Scholar). The first and the third nucleotides (T and G) in the potential −35 promoter element of each promoter were switched to A and C, respectively (Figs.3 A and4 A). In the case of potential −10 promoter elements, the first and the sixth nucleotides, T and T, were both switched to A (Figs. 3 A and 4 A). The point mutations described above did not create any other potential −35 or −10 promoter elements. Each of the recombinant plasmids containing the point mutations was added to plastid transcription extracts, which were obtained from either 7.5-day-old, dark-grown barley plants, or similar plants that had been further illuminated for 16 h.Figure 4In vitro transcription from wild type and modified psbD BLRPs in plastid extracts from dark- and light-grown barley plants. A, schematic representation of the recombinant plasmids used for in vitrotranscription experiments shown in B. Wild-type AAG-box, −35, and −10 putative promoter elements in pLRP140 areunderlined. Sequence modifications in pLRP140/−35mt (−35mt), pLRP140/−10mt (−10mt), pLRP140/−35 &−10mt (−35&−10mt), and pLRP140 (nt Switch) are shown in boldface type. Deleted nucleotides in the (−)5nt DL and (−)10nt DL constructs are indicated by lines. The location of sequences inserted into several constructs are shown below constructs labeled (+)3nt IN, (+)7nt IN, and (+)10nt IN. B,in vitro transcription of the recombinant plasmids using plastid extracts obtained from dark-grown (DK) and light-grown (LT) barley plants. Transcripts were analyzed using primer extension analysis. The arrow indicates the primary transcript produced from the recombinant plasmids. Theasterisk identif
Referência(s)