Portal de Periódicos da CAPES

Oncostatin M Stimulates Transcription of the Human α2(I) Collagen Gene via the Sp1/Sp3-binding Site

1997; Elsevier BV; Volume: 272; Issue: 39 Linguagem: Inglês

10.1074/jbc.272.39.24666

1083-351X

Hironobu Ihn, E. Carwile LeRoy, Maria Trojanowska,

Cell Adhesion Molecules Research

Oncostatin M (OSM), a member of the hematopoietic cytokine family, has been implicated in excessive bone growth and in the process of fibrosis. As part of an ongoing study of the molecular mechanisms of fibrosis, we have investigated the transcriptional regulation of the α2(I) collagen gene by OSM in human fibroblasts. An OSM response element was mapped by deletional analysis between base pairs (bp) −148 and −108 in the α2(I) collagen promoter. Further functional analysis of the α2(I) collagen promoter containing various substitution mutations revealed that both the basal activity and OSM stimulation of this promoter are mediated by a TCCTCC motif located between bp −128 and −123. Furthermore, three copies of the 12-bp synthetic α2(I) collagen promoter fragment containing the “TCC” motif conferred OSM inducibility to the otherwise unresponsive thymidine kinase promoter. Electrophoretic mobility shift assays demonstrated that the TCCTCC motif constitutes a novel binding site for the transcription factors Sp1 and Sp3. No differences have been observed in in vitro gel shift binding assays between unstimulated and OSM-stimulated fibroblasts. However, subtle conformational changes were detected in the region of the promoter surrounding TCC repeats after OSM stimulation using in vivofootprint analysis. In conclusion, this study characterized a dual-function response element that mediates the basal activity and OSM stimulation of the human α2(I) collagen promoter. Oncostatin M (OSM), a member of the hematopoietic cytokine family, has been implicated in excessive bone growth and in the process of fibrosis. As part of an ongoing study of the molecular mechanisms of fibrosis, we have investigated the transcriptional regulation of the α2(I) collagen gene by OSM in human fibroblasts. An OSM response element was mapped by deletional analysis between base pairs (bp) −148 and −108 in the α2(I) collagen promoter. Further functional analysis of the α2(I) collagen promoter containing various substitution mutations revealed that both the basal activity and OSM stimulation of this promoter are mediated by a TCCTCC motif located between bp −128 and −123. Furthermore, three copies of the 12-bp synthetic α2(I) collagen promoter fragment containing the “TCC” motif conferred OSM inducibility to the otherwise unresponsive thymidine kinase promoter. Electrophoretic mobility shift assays demonstrated that the TCCTCC motif constitutes a novel binding site for the transcription factors Sp1 and Sp3. No differences have been observed in in vitro gel shift binding assays between unstimulated and OSM-stimulated fibroblasts. However, subtle conformational changes were detected in the region of the promoter surrounding TCC repeats after OSM stimulation using in vivofootprint analysis. In conclusion, this study characterized a dual-function response element that mediates the basal activity and OSM stimulation of the human α2(I) collagen promoter. Type I collagen, the most abundant mammalian collagen, consists of two α1(I) chains and one α2(I) chain that are coordinately expressed (1Ramirez F. Di Liberto M. FASEB J. 1990; 4: 1616-1623Crossref PubMed Scopus (84) Google Scholar, 2Slack J.L. Liska D.J. Bornstein P. Am. J. Med. Genet. 1993; 45: 140-151Crossref PubMed Scopus (110) Google Scholar, 3Vuorio E. de Crombrugghe B. Annu. Rev. Biochem. 1990; 59: 837-872Crossref PubMed Scopus (381) Google Scholar). Excessive deposition of type I collagen, characteristic of many fibrotic disorders (4Prockop D.J. Kivirikko K.I. Annu. Rev. Biochem. 1995; 64: 403-434Crossref PubMed Scopus (1355) Google Scholar), most likely results from transcriptional activation of collagen genes in response to cytokines and other factors present in prefibrotic/inflammatory lesions. The most widely studied cytokine involved in collagen deposition is TGF-β 1The abbreviations used are: TGF-β, transforming growth factor-β; IL, interleukin; OSM, oncostatin M; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; BSA, bovine serum albumin; DMS, dimethyl sulfate; bp, base pair(s); TNF-α, tumor necrosis factor-α.1The abbreviations used are: TGF-β, transforming growth factor-β; IL, interleukin; OSM, oncostatin M; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; BSA, bovine serum albumin; DMS, dimethyl sulfate; bp, base pair(s); TNF-α, tumor necrosis factor-α.; nonetheless, other cytokines such as IL-4, IL-1, or OSM share many biological effects of TGF-β including stimulation of collagen synthesis and may play important roles in extracellular matrix accumulation during fibrotic process, especially immune-mediated fibrosis (5Postlethwaite A.E. Holness M.A. Katai H. Raghow R. J. Clin. Invest. 1992; 90: 1479-1485Crossref PubMed Scopus (421) Google Scholar, 6Goldring M.B. Krane S.M. J. Biol. Chem. 1987; 262: 16724-16729Abstract Full Text PDF PubMed Google Scholar, 7Duncan M.R. Hasan A. Berman B. J. Invest. Dermatol. 1995; 104: 128-133Abstract Full Text PDF PubMed Scopus (53) Google Scholar). OSM is produced by activated T cells (8Brown T.J. Lioubin M.N. Marquardt H. J. Immunol. 1987; 139: 2977-2983PubMed Google Scholar) and monocytes (9Bruce A.G. Linsley P.S. Rose T.M. Prog. Growth Factor Res. 1992; 4: 157-170Abstract Full Text PDF PubMed Scopus (77) Google Scholar) and belongs to a subfamily of hematopoietic cytokines that also includes IL-6, IL-11, LIF (leukemia inhibitoryfactor), and CNTF (ciliaryneurotrophic factor). Members of this family bind receptor complexes containing a signal-transducing subunit termed gp130 (10Hirano T. Matsuda T. Nakajima K. Stem Cells. 1994; 12: 262-277Crossref PubMed Scopus (164) Google Scholar, 11Rose T.M. Bruce A.G. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 8641-8645Crossref PubMed Scopus (339) Google Scholar, 12Zhang X.-G. Gu J.-J. Lu Z.-Y. Yasukawa K. Yancopoulous G.D. Turner K. Shoyab M. Taga T. Kishimoto T. Bataille R. Klein B. J. Exp. Med. 1994; 179: 1337-1342Crossref PubMed Scopus (222) Google Scholar). Interestingly, OSM utilizes a dual-receptor system (13Mosley B. De Imus C. Friend D. Boiani N. Thoma B. Park L.S. Cosman D. J. Biol. Chem. 1996; 271: 32635-32643Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar). First, a heterodimeric receptor complex consisting of gp130 and LIF receptor-β can be used by both OSM and LIF. A second heterodimeric receptor complex consisting of gp130 and OSM receptor-β is activated by OSM only. As a result, some of the biological effects are shared by OSM and LIF, whereas others are OSM-specific. In fibroblasts, OSM stimulates both collagen and glycosaminoglycan production (7Duncan M.R. Hasan A. Berman B. J. Invest. Dermatol. 1995; 104: 128-133Abstract Full Text PDF PubMed Scopus (53) Google Scholar). Moreover, OSM has been reported to stimulate the synthesis of TIMP-1 (tissue inhibitor ofmetalloproteinases) and plasminogen activator (14Richards C.D. Shoyab M. Brown T.J. Gauldie J. J. Immunol. 1993; 150: 5596-5603PubMed Google Scholar, 15Hamilton J.A. Leizer T. Piccoli D.S. Royston K.M. Butler D.M. Croatto M. Biochem. Biophys. Res. Commun. 1991; 180: 652-659Crossref PubMed Scopus (48) Google Scholar). OSM is a mitogen for murine NIH 3T3 cells and human foreskin and synovial fibroblasts (9Bruce A.G. Linsley P.S. Rose T.M. Prog. Growth Factor Res. 1992; 4: 157-170Abstract Full Text PDF PubMed Scopus (77) Google Scholar). Recent studies with transgenic mice overexpressing OSM in a tissue-specific manner demonstrated its pleiotropic nature in vivo and its association with visceral fibrosis (16Malik N. Haugen H.S. Modrell B. Shoyab M. Clegg C.H. Mol. Cell. Biol. 1995; 15: 2349-2358Crossref PubMed Scopus (103) Google Scholar). Our laboratory is involved in studies of the molecular mechanisms underlying the regulation of expression of the human α2(I) collagen gene in healthy and fibrotic human fibroblasts (17Tamaki T. Ohnishi K. Hartl C. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1995; 270: 4299-4304Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 19Kikuchi K. Hartl C.W. Smith E.A. LeRoy E.C. Trojanowska M. Biochem. Biophys. Res. Commun. 1992; 187: 45-50Crossref PubMed Scopus (87) Google Scholar). The mechanism of modulation of type I collagen by OSM is of special interest because of a previous report that indicated a differential response of systemic sclerosis scleroderma and healthy skin fibroblasts to OSM. Unlike healthy skin fibroblasts, fibroblasts isolated from scleroderma lesions fail to respond to the stimulatory effect of OSM with regard to collagen and glycosaminoglycan synthesis (7Duncan M.R. Hasan A. Berman B. J. Invest. Dermatol. 1995; 104: 128-133Abstract Full Text PDF PubMed Scopus (53) Google Scholar). In this study, we have investigated the mechanism of the α2(I) collagen stimulation by OSM in healthy dermal fibroblasts. We show that OSM stimulates α2(I) collagen gene transcription through a constitutive positivecis-response element in the collagen promoter. We also characterize transcription factors interacting with this promoter element: two members of the Sp family of transcription factors, Sp1 and Sp3. Human dermal fibroblasts derived from a 2-month-old child (GMO5756A) were obtained from Coriell Cell Repositories (Camden, NJ) and propagated in DMEM supplemented with 10% FCS. Human foreskin fibroblasts were obtained from foreskins of healthy newborns (following institutional approval and informed consent). Primary explant cultures were established in 25-cm2 culture flasks in DMEM supplemented with 10% FCS, 2 mml-glutamine, and 50 μg/ml amphotericin. Fibroblast cultures independently isolated from different individuals were maintained as monolayers at 37 °C in 10% CO2 in air and studied between the third and sixth subpassages. Both fibroblast types produced similar results in all assays. Fibroblasts were grown to confluence in DMEM supplemented with 10% FCS and then incubated for 24 h in serum-free medium (DMEM plus 0.1% BSA) before addition of cytokines and/or actinomycin D. Total RNA was extracted and analyzed by Northern blotting as described previously (20Yamakage A. Kikuchi K. Smith E.A. LeRoy E.C. Trojanowska M. J. Exp. Med. 1992; 175: 1227-1234Crossref PubMed Scopus (163) Google Scholar). Filters were sequentially hybridized with radioactive probes for α2(I) procollagen and glyceraldehyde-3-phosphate dehydrogenase. The filters were scanned with a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA). The deletion and substitution mutant plasmids (with the exception of the −148 end point deletion construct) have been previously described (17Tamaki T. Ohnishi K. Hartl C. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1995; 270: 4299-4304Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). The −148 α2(I) collagen promoter deletion construct was generated using polymerase chain reaction technology. Plasmids used in transient transfection assays were twice purified on CsCl gradients. At least two different plasmid preparations were used for each experiment. Human fibroblasts were grown to 90% confluence in 100-mm dishes in DMEM with 10% FCS. Monolayers were washed, and cells were transfected by the calcium phosphate technique (17Tamaki T. Ohnishi K. Hartl C. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1995; 270: 4299-4304Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar) with 20 μg of various deletion or mutant promoter-chloramphenicol acetyltransferase constructs. pSV-β-galactosidase control vector (Promega) was cotransfected to normalize for transfection efficiency. After incubation overnight, the medium was replaced with DMEM and 0.1% BSA containing 5 ng/ml OSM, and incubation was continued for 48 h. Cells were harvested in 0.25 m Tris-HCl (pH 8) and fractured by freeze-thawing. Extracts, normalized for protein content as measured by Bio-Rad reagents, were incubated with butyryl-CoA. [14C]Chloramphenicol was extracted using an organic solvent (2:1 mixture of tetramethylpentadecane and xylene) and quantified by scintillation counting. Each experiment was performed in duplicate. The Mann-Whitney U test was used to determine statistical significance. For the preparation of nuclear extracts from untreated and OSM-treated fibroblasts, cells were placed in DMEM and 0.1% BSA for 24 h prior to OSM treatment. After incubation with 5 ng/ml OSM for the indicated length of time, cells were harvested. Nuclear extracts were prepared according to Andrews and Faller (21Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2207) Google Scholar) with minor modifications. Briefly, confluent cells from five 150-mm dishes were washed with phosphate-buffered saline and scraped into 1 ml of cold buffer containing 10 mm HEPES-KOH (pH 7.9) at 4 °C, 1.5 mmMgCl2, 10 mm KCl, 1 mmdithiothreitol, and 0.2 mm phenylmethylsulfonyl fluoride. The cells were allowed to swell on ice for 10 min and then vortexed for 10 s. The tube was centrifuged for 2 min, and the supernatant was discarded. The pellet was resuspended in 80 μl of cold buffer containing 20 mm HEPES-KOH (pH 7.9), 25% glycerol, 420 mm NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 1 mm dithiothreitol, and 0.7 mm phenylmethylsulfonyl fluoride and incubated on ice for 20 min for high-salt extraction. Cellular debris was removed by centrifugation for 2 min at 4 °C, and the supernatant fraction was stored at −80 °C until use. The protein concentration of the extracts was determined using the Bio-Rad reagent. In some experiments (e.g. OSM stimulation; see Fig. 5), nuclear extracts contained 1 mm sodium orthovanadate to ensure the phosphorylated status of STAT proteins. Addition of sodium orthovanadate had no noticeable effect on protein binding to the α2(I) collagen promoter probe used in this study. Oligonucleotides used as probes, competitors, or polymerase chain reaction primers were synthesized using the Applied Biosystems nucleic acid synthesizer and were purchased from the Medical University of South Carolina Core Facility, except for the Oct-1 and NF1 consensus oligonucleotides, which were purchased from Promega. Radioactive probes for electrophoretic mobility shift assay were generated by [γ-32P]ATP end labeling. DNA mobility shift assay was performed as described previously (17Tamaki T. Ohnishi K. Hartl C. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1995; 270: 4299-4304Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Briefly, the binding reaction was performed on ice for 30 min in binding buffer (10 mm HEPES (pH 7.9), 50 mmNaCl, 1 mm dithiothreitol, 1 mmMgCl2, 4% glycerol, 0.5 mm EDTA, 0.7 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 2 μg/ml leupeptin, and 2 μg/ml pepstatin) containing 50,000 cpm labeled probe, 2 μg of poly(dI-dC)·poly(dI-dC), and nuclear extracts containing 5 μg of protein. In some assays, double-stranded competitors (200-fold molar excess) or antibodies (2 μg) (purchased from Santa Cruz Biotechnology) were added. Separation of free radiolabeled DNA from DNA-protein complexes was carried out on a 5% nondenaturing polyacrylamide gel. Electrophoresis was carried out in 0.5 × Tris borate electrophoresis buffer at 200 V at 4 °C. Human fibroblasts were grown to confluence in DMEM and 10% FCS and then incubated in DMEM and 0.1% BSA for 24 h. OSM (5 ng/ml) was added, and the culture was incubated for periods ranging from 30 min to 4 h. The medium was then replaced with DMEM and 0.1% BSA containing 0.1% dimethyl sulfate (DMS) and incubated for 2 min. Cells were rinsed three times with phosphate-buffered saline at 37 °C, lysed on the plates using 1.5 ml of lysis buffer (300 mm NaCl, 50 mm Tris-Cl (pH 8.0), 25 mm EDTA (pH 8.0), 200 μg/ml proteinase K, and 0.2% SDS), and after scraping, incubated for 4 h at 37 °C. DNA was extracted twice with phenol, twice with phenol/chloroform/isoamyl alcohol (25:24:1), once with a mixture of chloroform/isoamyl alcohol (24:1), and once with ether. DNA was precipitated once each with isopropyl alcohol and ethanol and resuspended in TE buffer (10 mm Tris-Cl (pH 7.5) and 1 mm EDTA). DNA for thein vitro DMS treatment (naked) was prepared identically, with the omission of DMS treatment. For the in vitro DMS treatment, 25 μl of 1% DMS was added to 175 μl of DNA (100 μg), and the mixture was incubated at room temperature for 2 min, followed by addition of 50 μl of ice-cold DMS stop buffer (1.5 msodium acetate (pH 7.0), 1 m β-mercaptoethanol, and 100 μg/ml yeast tRNA). Stop buffer was also added to 200 μl of DNA from the in vivo DMS treatment, and both DNA samples were precipitated with ethanol. The pellets were dissolved in 200 μl of 1m piperidine and incubated at 90 °C for 30 min. Piperidine was removed by lyophilization, and DNA samples were resuspended in TE buffer, precipitated with isopropyl alcohol and ethanol, and washed with 75% ethanol. The DNA was dissolved, and the concentration was adjusted to 0.4 μg/μl. Ligation-mediated polymerase chain reaction was then used to detect DNA-protein interactions according to Mueller and Wold (22Mueller P.R. Wold B. Science. 1989; 246: 780-786Crossref PubMed Scopus (787) Google Scholar). All oligonucleotides were purified using denaturing polyacrylamide electrophoresis. Two oligonucleotides for staggered linker have been described (22Mueller P.R. Wold B. Science. 1989; 246: 780-786Crossref PubMed Scopus (787) Google Scholar). The following oligonucleotides were used to detect DNA-protein interactions on the coding strand of the human α2(I) collagen promoter: primer 1, GACTCCTTGTGTCGCAGAGC; primer 2, ACCTCCAACTTAGCCGAAACCT; and primer 3, ACCTCCAACTTAGCCGAAACCTCCTGC. Ligation-mediated polymerase chain reaction annealing temperatures were 59 °C for primer 1, 58 °C for primer 2, and 60 °C for primer 3. To detect DNA-protein interactions on the noncoding strand, the oligonucleotides used were as follows: primer 4, CATGTCGGGGCTGCAGAGCACTCC; primer 5, TGCAGAGCACTCCGACGTGT; and primer 6, TGCAGAGCACTCCGACGTGTCCCA. Ligation-mediated polymerase chain reaction annealing temperatures were 60 °C for primer 4, 63 °C for primer 5, and 66 °C for primer 6. The effect of OSM on α2(I) procollagen mRNA levels was investigated in confluent cultures of dermal fibroblasts. OSM induced dose-dependent (1–25 ng/ml) increases in α2(I) procollagen mRNA levels, with maximum stimulation observed at 5 ng/ml (Fig. 1,A and B). The potency of OSM was comparable to that of TGF-β under similar culture conditions (Fig. 1, Aand B). We next examined the time course of OSM effects on α2(I) procollagen mRNA expression levels. Stimulation by OSM could be detected after 6 h, and maximum induction occurred after 12 h (Fig. 1 C). Similar to the effect of TGF-β (23Ishikawa O. Yamakage A. LeRoy E.C. Trojanowska M. Biochem. Biophys. Res. Commun. 1990; 169: 232-238Crossref PubMed Scopus (38) Google Scholar), OSM stimulation of collagen mRNA persisted for at least 48 h. To establish whether the increase in α2(I) mRNA levels after OSM treatment involves transcriptional activation, we tested the magnitude of OSM induction in fibroblasts treated with OSM for 12 h in the presence or absence of actinomycin D, which completely blocked the OSM-mediated increase in α2(I) procollagen mRNA levels (Fig.1 D), indicating that OSM stimulation of collagen mRNA is not mediated via increased transcript stability, but rather involves direct activation of transcription of the α2(I) procollagen gene and/or other genes involved in collagen gene regulation. To further analyze the transcriptional regulation of the collagen gene by OSM, we tested a series of 5′-deletions of the human α2(I) collagen promoter linked to the the chloramphenicol acetyltransferase reporter gene in transient transfection assays (Fig. 2). OSM stimulation resulted in an ∼3-fold induction of promoter activity. Deletions to bp −148 did not significantly alter the level of inducibility, but further deletion to bp −108 abolished OSM stimulation. In agreement with previous data, deletion of the Sp1-binding sites (three GC boxes) between bp −353 and −264 significantly decreased basal promoter activity (17Tamaki T. Ohnishi K. Hartl C. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1995; 270: 4299-4304Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Subsequent deletion to bp −186 had no additional effect on basal promoter activity, whereas deletion to bp −148 increased basal promoter activity ∼2-fold compared with the deletion to −186. These data further corroborate the location of the previously mapped repressor site between bp −164 and −159 (18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Subsequent deletion to bp −108 caused a decrease in promoter activity to ∼10% of the activity of the wild-type promoter. This dramatic effect on basal promoter activity most likely results from the removal of the previously identified positive constitutive cis-element containing a TCCTCC motif located between bp −128 and −123 in this promoter region (18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Since deleting the −148 to −108 promoter fragment also abolished the OSM response, we tested whether the same response element mediates the basal activity and OSM stimulation of collagen promoter activity using previously generated substitution mutants in the TCCTCC motif. As shown in Fig. 3, collagen promoter constructs carrying substitution mutations in this cis-regulatory element were unresponsive to OSM stimulation. On the other hand, stimulation of collagen promoter activity by TGF-β was not affected by the mutations in the TCCTCC motif, consistent with previous observations that other response elements in the collagen promoter mediate TGF-β stimulation (25Truter S. Di Liberto M. Inagaki Y. Ramirez F. J. Biol. Chem. 1992; 267: 25389-25395Abstract Full Text PDF PubMed Google Scholar, 32Chung K.-Y. Agarwal A. Uitto J. Mauviel A. J. Biol. Chem. 1996; 271: 3272-3278Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar). Furthermore, none of the substitution mutations in other response elements previously identified in this promoter affected OSM stimulation (Fig. 3).Figure 3TCCTCC motif mediates OSM stimulation of the human α2(I) collagen promoter. Plasmids carrying substitution mutations (18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar) were used in transient transfections of cells stimulated with OSM or TGF-β as described under “Experimental Procedures.” Sequences with the mutated nucleotides indicated in boldfaceare shown on the left. The stimulation index for OSM and TGF-β is shown on the right. The means ± S.E. for separate experiments are shown. The number of experiments used to calculate the mean is shown inparentheses. Comparisons were made between untreated and cytokine (OSM or TGF-β)-treated cells. Asterisks indicate statistically significant results (p < 0.001).N/T, not tested.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To further elucidate whether the regulatory sequences from the collagen promoter can mediate OSM stimulation of a heterologous promoter, three copies of the 12-bp oligonucleotide (from bp −131 to −120) containing the TCCTCC motif were cloned in both orientations into the pBL-CAT5 vector carrying thymidine kinase gene promoter elements. Thetk promoter alone was not stimulated by OSM, whereas insertion of the “TCC” oligonucleotides consistently resulted in modest (2-fold) stimulation of the chimeric constructs independent of orientation (Table I). Interestingly, insertion of the TCC-containing oligonucleotide in the correct orientation did not affect tk promoter activity, but insertion in the opposite orientation decreased significantly the basal promoter activity of the construct. It is possible that, in reverse orientation, binding of the nuclear proteins to the TCC motif causes unfavorable conformational changes that negatively affect the activity of the tk promoter. A similar phenomenon has been observed with other heterologous promoter systems (24Rossi P. Karsenty G. Roberts A.B. Roche N.S. Sporn M.B. de Crombrugghe B. Cell. 1988; 52: 405-414Abstract Full Text PDF PubMed Scopus (440) Google Scholar, 25Truter S. Di Liberto M. Inagaki Y. Ramirez F. J. Biol. Chem. 1992; 267: 25389-25395Abstract Full Text PDF PubMed Google Scholar).Table ITCC motif confers OSM responsiveness to the heterologous (thymidine kinase) promoterBasal level+OSMRatiopBL-CAT100100 ± 24.51.0 ± 0.2 (8)5′ to 3′86 ± 29168 ± 56.52.0 ± 0.6 (8)1-aStatistically significant results (p< 0.001).3′ to 5′36 ± 6.580 ± 19.42.2 ± 0.5 (8)1-aStatistically significant results (p< 0.001).Values are expressed as percentage (mean ± S.E.) of the activity of pBL-CAT, which was arbitrarily set at 100%. The number of experiments is shown in parentheses.1-a Statistically significant results (p< 0.001). Open table in a new tab Values are expressed as percentage (mean ± S.E.) of the activity of pBL-CAT, which was arbitrarily set at 100%. The number of experiments is shown in parentheses. Our previous analyses of the α2(I) collagen promoter indicated the presence of three specific DNA-protein complexes formed with the promoter fragment from bp −135 to −116 and nuclear extract from human dermal fibroblasts (18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). To further characterize the nature of the nuclear proteins interacting with this promoter region, we performed gel shift analyses with a series of competitor oligonucleotides. As shown in Fig.4 A (lane 2), six DNA-protein complexes were formed. Complexes 1–4 and 6 were competed off with an excess of either unlabeled probe (lane 3) or the Sp1 oligonucleotide (lane 4). This suggests that complexes 1–4 and 6 are specific and that proteins with binding specificities similar to that of Sp1 are involved in formation of these DNA-protein complexes. However, complex 4 was also competed off with an excess of NF1, Oct1, and SIE (a s is-inducibleelement present in the c-fos promoter known to bind STAT1 and STAT3 (26Ruff-Jamison S. Zhong Z. Wen Z. Chen K. Darnell Jr., J.E. Cohen S. J. Biol. Chem. 1994; 269: 21933-21935Abstract Full Text PDF PubMed Google Scholar, 27Korzus E. Nagase H. Rydell R. Travis J. J. Biol. Chem. 1997; 272: 1188-1196Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar)) oligonucleotides (lanes 5–7). Moreover, this complex appeared variably with the nuclear extract preparations (e.g. compare Fig. 5 in Ref. 18), suggesting that this complex may represent nonspecific binding of the proteins to this promoter region. The nature of the protein(s) involved in formation of complex 6 is presently unknown. We have previously shown that DNA sequences involved in binding of the nuclear factors to this promoter region correspond to the TCCTCC motif located between bp −128 and −123 (see Fig. 5 in Ref. 18). To test directly whether the TCCTCC motif is involved in formation of the observed DNA-protein complexes, we performed gel shift analysis with an oligonucleotide probe containing a substitution mutation in the TCCTCC motif (18Ihn H. Ohnishi K. Tamaki T. LeRoy E.C. Trojanowska M. J. Biol. Chem. 1996; 271: 26717-26723Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Complexes 1–3 were not formed with this mutant probe (lane 8). This result provides additional evidence that the TCCTCC motif is responsible for binding of the nuclear proteins to this promoter region. To further characterize the nature of the nuclear proteins interacting with this motif, we employed antibodies against four members of the Sp family (Sp1, Sp2, Sp3, and Sp4). As shown in Fig. 4 B, addition of the anti-Sp1 antibody caused a supershift of complex 1 (lane 3), whereas addition of the anti-Sp3 antibody abolished formation of complex 3, with the appearance of a weak supershifted band (lane 5). Simultaneous addition of the anti-Sp1 and anti-Sp3 antibodies abolished formation of complexes 1–3 (lane 7). Addition of the anti-Sp2 and anti-Sp4 antibodies did not affect formation of the DNA-protein complexes (lanes 4and 6), suggesting that Sp2 and Sp4 do not bind to this promoter region. Addition of the anti-STAT1 and anti-STAT3 antibodies did not affect formation of the DNA-protein complexes (lanes 8and 9). In conclusion, the data obtained by gel shift analyses are consistent with the notion that two members of the Sp family of proteins, Sp1 and Sp3, interact with the TCCTCC motif in the α2(I) collagen promoter. Thus, the TCCTCC motif represents a novel binding site for Sp1 and Sp3. To determine whether DNA-protein interactions in this region are regulated by OSM, we performed DNA mobility shift assays using the promoter fragment from bp −135 to −116 and nuclear extracts from human fibroblasts treated with OSM for different intervals (15 min to 8 h). As shown in Fig.5, no changes in the DNA-protein complexes were observed. Furthermore, OSM stimulation did not affect protein binding to the other regions of the collagen promoter: a −235 to −34 collagen