Portal de Periódicos da CAPES

Mutation E252C Increases Drastically the K Value for Na+ and Causes an Alkaline Shift of the pH Dependence of NhaA Na+/H+ Antiporter of Escherichia coli

2004; Elsevier BV; Volume: 279; Issue: 5 Linguagem: Inglês

10.1074/jbc.m309021200

1083-351X

Tzvi Tzubery, Abraham Rimon, Etana Padan,

Protein Structure and Dynamics

A single Cys replacement of Glu at position 252 (E252C) in loop VIII–IX of NhaA increases drastically the Km for Na+ (50-fold) of the Na+/H+ antiporter activity of NhaA and shifts the pH dependence of NhaA activity, by one pH unit, to the alkaline range. In parallel, E252C causes a similar alkaline pH shift to the pH-induced conformational change of loop VIII–IX. Thus, although both the Na+/H+ antiporter activity of wild type NhaA and its accessibility to trypsin at position Lys249 in loop VIII–IX increase with pH between pH 6.5 and 7.5, the response of E252C occurs above pH 8. Furthermore, probing accessibility of pure E252C protein in dodecyl maltoside solution to 2-(4′-maleimidylanilino)-naphthalene-6-sulfonic acid revealed that E252C itself undergoes a pH-dependent conformational change, similar to position Lys249, and the rate of the pH-induced conformational change is increased specifically by the presence of Na+ or Li+, the specific ligands of the antiporter. Chemical modification of E252C by N-ethylmaleimide, 2-(4′-maleimidylanilino)-naphthalene-6-sulfonic acid; [2-(trimethylammonium)ethyl]methane thiosulfonate, or (2-sulfonatoethyl)methanethiosulfonate reversed, to a great extent, the pH shift conferred by E252C but had no effect on the Km of the mutant antiporter. A single Cys replacement of Glu at position 252 (E252C) in loop VIII–IX of NhaA increases drastically the Km for Na+ (50-fold) of the Na+/H+ antiporter activity of NhaA and shifts the pH dependence of NhaA activity, by one pH unit, to the alkaline range. In parallel, E252C causes a similar alkaline pH shift to the pH-induced conformational change of loop VIII–IX. Thus, although both the Na+/H+ antiporter activity of wild type NhaA and its accessibility to trypsin at position Lys249 in loop VIII–IX increase with pH between pH 6.5 and 7.5, the response of E252C occurs above pH 8. Furthermore, probing accessibility of pure E252C protein in dodecyl maltoside solution to 2-(4′-maleimidylanilino)-naphthalene-6-sulfonic acid revealed that E252C itself undergoes a pH-dependent conformational change, similar to position Lys249, and the rate of the pH-induced conformational change is increased specifically by the presence of Na+ or Li+, the specific ligands of the antiporter. Chemical modification of E252C by N-ethylmaleimide, 2-(4′-maleimidylanilino)-naphthalene-6-sulfonic acid; [2-(trimethylammonium)ethyl]methane thiosulfonate, or (2-sulfonatoethyl)methanethiosulfonate reversed, to a great extent, the pH shift conferred by E252C but had no effect on the Km of the mutant antiporter. Sodium proton antiporters are ubiquitous membrane proteins found in the cytoplasmic and organelle membranes of cells of many different origins, including plants, animals, and microorganisms. They are involved in cell energetics and play primary roles in the regulation of intracellular pH, cellular Na+ content, and cell volume (reviews in Refs. 1Padan E. Schuldiner S. Konings W.N. Kaback H.R. Lolkema J. The Handbook of Biological Physics. Vol. II. Elsevier Science, The Netherlands1996: 501-531Google Scholar, 2Padan E. Krulwich T.A. Storz G. Hengge-Aronis R. Bacterial Stress Responses. ASM Press, Washington, D. C.2000: 117-130Google Scholar, 3Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophys. Acta. 2001; 1505: 144-157Google Scholar).Escherichia coli has two antiporters, NhaA (4Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Google Scholar) and NhaB (5Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Google Scholar), which specifically exchange Na+ or Li+ for H+. Only NhaA is indispensable for adaptation to high salinity, for challenging Li+ toxicity, and for growth at alkaline pH (in the presence of Na+ (1Padan E. Schuldiner S. Konings W.N. Kaback H.R. Lolkema J. The Handbook of Biological Physics. Vol. II. Elsevier Science, The Netherlands1996: 501-531Google Scholar, 2Padan E. Krulwich T.A. Storz G. Hengge-Aronis R. Bacterial Stress Responses. ASM Press, Washington, D. C.2000: 117-130Google Scholar, 3Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophys. Acta. 2001; 1505: 144-157Google Scholar)).NhaA is an electrogenic antiporter with a stoichiometry of 2H+/Na+ (6Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Google Scholar, 7Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 5382-5387Google Scholar, 8Venturi M. Padan E. Hunte C. Von Jagow G. Schagger H. A Practical Guide to Membrane Protein Purification. 2nd Ed. Academic Press, Amsterdam, The Netherlands2002: 179-190Google Scholar). Recently two-dimensional crystals of NhaA diffracting at 4 Å were obtained. Cryoelectron microscopy of these crystals showed that NhaA exists as a dimer of monomers composed each of 12 helices as predicted (9Rothman A. Padan E. Schuldiner S. J. Biol. Chem. 1996; 271: 32288-32292Google Scholar, 10Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Google Scholar, 11Williams K.A. Geldmacher-Kaufer U. Padan E. Schuldiner S. Kuhlbrandt W. EMBO J. 1999; 18: 3558-3563Google Scholar). In the native membrane NhaA forms oligomers within which the monomers physically and functionally interact (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar). Based on the two-dimensional crystals, a three-dimensional map of NhaA was obtained (13Williams K.A. Nature. 2000; 403: 112-115Google Scholar), the first insight into the architecture of the protein.One of the most interesting characteristics of NhaA is its dramatic dependence on pH; both in isolated membrane vesicles and when purified in proteoliposomes its rate of activity changes more than 3 orders of magnitude between pH 7 and 8 (3Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophys. Acta. 2001; 1505: 144-157Google Scholar, 6Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Google Scholar). Amino acid residues involved in the pH response of NhaA have been identified in both loops and TMSs. 1The abbreviations used are: TMStransmembrane segmentNEMN-ethylmaleimideMIANS2-(4′-maleimidylanilino)-naphthalene-6-sulfonic acidMTSET[2-(trimethylammonium)ethyl]methane thiosulfonateMTSES(2-sulfonatoethyl)methanethiosulfonateBTP1,3-bis-[tris(hydroxymethyl)methyl]amino]propaneNTAnitrilotriacetic acidMOPS3-(N-morpholino)propanesulfonic acidDMn-dodecyl-β-d-maltosideCLCys-less NhaA.1The abbreviations used are: TMStransmembrane segmentNEMN-ethylmaleimideMIANS2-(4′-maleimidylanilino)-naphthalene-6-sulfonic acidMTSET[2-(trimethylammonium)ethyl]methane thiosulfonateMTSES(2-sulfonatoethyl)methanethiosulfonateBTP1,3-bis-[tris(hydroxymethyl)methyl]amino]propaneNTAnitrilotriacetic acidMOPS3-(N-morpholino)propanesulfonic acidDMn-dodecyl-β-d-maltosideCLCys-less NhaA. For example, His225 in loop VII–VIII was found essential for the pH response of the antiporter (14Gerchman Y. Olami Y. Rimon A. Taglicht D. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1212-1216Google Scholar, 15Rimon A. Gerchman Y. Olami Y. Schuldiner S. Padan E. J. Biol. Chem. 1995; 270: 26813-26817Google Scholar). Gly338 of TMS XI also affects the pH response of NhaA; its replacement with serine (G338S) produced a transporter that, in contrast to the wild type protein, lacks pH control (16Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Google Scholar).NhaA undergoes a conformational change upon its activation by pH. Monoclonal antibody 1F6 raised against the NhaA antiporter (17Padan E. Venturi M. Michel H. Hunte C. FEBS Lett. 1998; 441: 53-58Google Scholar) identified that the N terminus of NhaA, its epitope, responds to pH (18Venturi M. Rimon A. Gerchman Y. Hunte C. Padan E. Michel H. J. Biol. Chem. 2000; 275: 4734-4742Google Scholar). The antibody binds NhaA at pH 8.5 but not at pH 4.5. Furthermore, H3C/H5C, a double mutation in this domain, changes the pH profile of NhaA (18Venturi M. Rimon A. Gerchman Y. Hunte C. Padan E. Michel H. J. Biol. Chem. 2000; 275: 4734-4742Google Scholar).Probing with trypsin digestion showed that Loop VIII–IX is another domain that changes its conformation with pH (19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar). Both in everted membrane vesicles as well as in DM micelles, NhaA is completely resistant to trypsin below pH 6.5 and with increasing pH is progressively cleaved at Lys249, reaching a maximum at pH 8.5. Furthermore, two NhaA mutants (H225R (19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar) and G338S (16Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Google Scholar)) with a modified pH profile are susceptible to trypsin, in isolated membrane vesicles, at Lys249, only at the pH range where they are active and reflecting the level of activity.Two pieces of evidence suggest that Loop VIII–IX not only responds to pH but is also required for pH regulation: (a) Loop VIII–IX is located in the interface between monomers of NhaA dimer (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar). Cross-linking between these loops of the NhaA dimer with a rigid and short cross-linking agent caused a dramatic change in the pH response as opposed to no effect of a long and flexible cross-linking reagent (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar). (b) Insertion mutation Lys249-IEG-His250 and Cys replacement mutations E241C and V254C in loop VIII–IX cause an acidic shift in the pH profile of NhaA (19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar).In addition to Glu241, loop VIII–IX contains only one other Glu (at position 252). In this paper, we therefore, replaced Glu252 with Cys and explored the properties of the E252C mutant both in the membrane and after solubilization and purification of the protein in DM. We found that in contrast to E241C and the other two mutations in loop VIII–IX that induce an acidic shift in the pH profile of activity of NhaA, the single amino acid change, E252C, causes a dramatic alkaline shift in the pH dependence of the Na+/H+ antiporter activity of NhaA and increases drastically the Km of the antiporter to both Na+ and Li+. In parallel, the E252C mutation causes a similar alkaline shift in the pH dependence of the conformational change in loop VIII–IX. Remarkably, this conformational change at position E252C was found sensitive specifically to both Na+ and Li+, the specific ligands of the NhaA antiporter.EXPERIMENTAL PROCEDURESBacterial Strains and Culture Conditions—EP432 is an E. coli K12 derivative, which is melBLid, Δ nhaA1::kan, Δ nhaB1::cat, Δ lacZY, thr1 (5Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Google Scholar). TA16 is nhaA+nhaB+lacIQ and otherwise isogenic to EP432 (6Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Google Scholar). The cells were grown in modified L broth (LBK) in which NaCl was replaced by KCl (67 mm, pH 7.5). When indicated, the media was buffered by 60 mm BTP, and pH was titrated with HCl. The cells were also grown in minimal medium A without sodium citrate (20Davies B. Mingioli E. J. Bacteriol. 1950; 60: 17-28Google Scholar) with glycerol (0.5%) as a carbon source. Thiamine (2.5 μg/ml) was added to all minimal media. For EP432, threonine (0.1 mg/ml) was also added (4Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Google Scholar). For plates, 1.5% agar was used. The antibiotics and their concentrations were 100 μg/ml ampicillin and 50 μg/ml kanamycin. Resistance to Li+ and Na+ was tested as described previously (4Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Google Scholar).Plasmids—The plasmids encoding wild type NhaA used in this study were as follows. pECO2, a derivative of pECO (21Galili L. Rothman A. Kozachkov L. Rimon A. Padan E. Biochemistry. 2002; 41: 609-617Google Scholar), was constructed by purification of the BstXI-BstXI fragment (5188 bp) obtained from pECO (21Galili L. Rothman A. Kozachkov L. Rimon A. Padan E. Biochemistry. 2002; 41: 609-617Google Scholar), teaming with T4 DNA polymerase and blunt end self-ligation and destroying the two BstXI sites of the plasmid. pBSTX is a derivative of pECO2 that contains a silent mutation introducing a BstXI site at codon 250 of nhaA. For construction of pBSTX, two fragments of nhaA were PCR-amplified using pGMAR100 (16Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Google Scholar) as a template and the end and mutagenic primers shown in Table I. The two fragments were annealed and used as a template for PCR amplification with the same end primers. The BglII-MluI fragment (682 bp) of the amplicon was ligated with BglII-MluI fragment (4502 bp) of pECO2.Table IPrimers used for constructing of NhaA mutantsMutationDNA sequence of mutagenic oligonucleotideCodon change observedNew restriction siteE252CGCGACTGTGTCACGTGTTGCACCCGAG → TGTEco72IA248GTTCTCCAGCCAAGCGACTGGAGCATGTGGCG → GCCBstXI5′ end primer aCTGATGCAAGGATCGCTAGCCAGC5′ end primer bGAAGGGTGGGCGATCCCGGCGGCTAC3′ end primerGCTCATTTCTCTCCCTGATAAC Open table in a new tab The plasmid used encoding Cys-less (CL) NhaA was pCL-BSTX that was constructed in a fashion similar to pBSTX but using pCL-GMAR100 (21Galili L. Rothman A. Kozachkov L. Rimon A. Padan E. Biochemistry. 2002; 41: 609-617Google Scholar) as a template. The plasmid used for overexpression of His6-tagged NhaA was pAXH2 (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar), whereas the plasmid expressing His6-tagged CL-NhaA was pCL-AXH2 (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar). All plasmids carrying a mutation were designated by the name of the plasmid followed by the mutation. Plasmids pCL-AXH2-H225C, pCL-AXH2-K221C, pCL-AXH2-A118C, and pCL-AXH2-N177C were described previously (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar, 22Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Google Scholar).Site-directed Mutagenesis—Site-directed mutagenesis was conducted following a polymerase chain reaction-based protocol (23Ho S. Hunt H. Horton R. Pullen J. Pease L. Gene (Amst.). 1989; 77: 51-59Google Scholar). pBSTX-E252C and pCL-BSTX-E252C were constructed using plasmids pBSTX and pCL-BSTX as a template and the mutagenic primers described in Table I. In each case the entire fragment originated by PCR and cloned in a plasmid was sequenced through the ligation junction to verify the accuracy of mutagenesis.pAXH2-E252C and pCL-XH2-E252C were obtained by replacing the MluI-BglII fragments of plasmids pAXH2 and pCL-XH2 with MluI-BglII fragments excised either from pBSTX-E252C or pCL-BSTX-E252C to obtain the mutation in either wild type or CL genetic background respectively. The plasmids carrying the Cys mutations in loops were previously described (22Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Google Scholar).DNA Sequence—Sequencing of DNA was conducted by an automated DNA sequencer (ABI PRISM™ 377; PerkinElmer Life Sciences).Isolation of Membrane Vesicles and Assay of Na+/H+Antiporter Activity—Assays of Na+/H+ antiport activity were conducted on everted membrane vesicles of EP432 cells (24Rosen B. Methods Enzymol. 1986; 125: 328-336Google Scholar, 25Goldberg E.B. Arbel T. Chen J. Karpel R. Mackie G.A. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2615-2619Google Scholar) transformed with the respective plasmids. A fluorescence assay of antiport activity was performed as described (25Goldberg E.B. Arbel T. Chen J. Karpel R. Mackie G.A. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2615-2619Google Scholar) using acridine orange to measure generation of ΔpH (the pH difference across the membrane). Energization was achieved with either Tris-d-lactate or ATP (1.6 mm each).Protein Determination—The protein was determined according to Ref. 26Bradford M. Anal. Biochem. 1976; 72: 248-254Google Scholar.Detection and Quantitation of NhaA and Its Mutated Proteins in the Membrane—Detection and quantitation of NhaA and its mutated derivatives in membranes of EP432 were conducted by Western analysis as described previously (14Gerchman Y. Olami Y. Rimon A. Taglicht D. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1212-1216Google Scholar) using the NhaA-specific monoclonal antibody 1F6 (17Padan E. Venturi M. Michel H. Hunte C. FEBS Lett. 1998; 441: 53-58Google Scholar). The amount of affinity-purified NhaA and its mutants was determined by Coomassie staining of the gel after SDS-PAGE as described previously (12Gerchman Y. Rimon A. Venturi M. Padan E. Biochemistry. 2001; 40: 3403-3412Google Scholar).Overexpression and Affinity Purification of His-tagged Antiporters by Ni2+-NTA Chromatography—To overexpress the plasmids encoding the His-tagged antiporters, TA16 cells transformed with the respective plasmids were used as described (6Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Google Scholar), and high pressure membranes were prepared as described (6Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Google Scholar). His-tagged NhaA was affinity-purified on Ni2+-NTA-agarose resin (Qiagen) by miniscale purification and eluted either with imidazole (10Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Google Scholar, 22Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Google Scholar) for probing digestion with trypsin or acid (8Venturi M. Padan E. Hunte C. Von Jagow G. Schagger H. A Practical Guide to Membrane Protein Purification. 2nd Ed. Academic Press, Amsterdam, The Netherlands2002: 179-190Google Scholar) for labeling with MIANS.Probing Digestion with Trypsin—For trypsin treatment (19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar), 15 μgof affinity-purified protein was resuspended in 0.5 ml containing 0.1 m KCl, 0.7 mm EDTA, 1 mm CaCl2, 0.1% DM, and 50 mm Tris-HEPES at the indicated pH values. After the addition of 0.3 μg of trypsin (Sigma, type III), the suspension was incubated at 37 °C for 1 h. The reaction was terminated by adding 0.9 μg of trypsin inhibitor type II (Sigma) dissolved in 1 mm HCl (200 μg/ml). Then the protein was precipitated in 10% trichloroacetic acid for 0.5 h at 4 °C, centrifuged (Eppendorf, 14.000 rpm, 30 min, 4 °C), resuspended in sampling buffer, titrated to neutrality with Tris base, and loaded on the gel for SDS-PAGE as described (27Laemmli U. Nature. 1970; 227: 680-685Google Scholar).Treatment with SH Reagents—Everted membrane vesicles or high pressure membranes were isolated from EP432 cells transformed with the indicated plasmids. The membranes (0.5 mg of membrane protein) were resuspended in a reaction mixture (0.5 ml) containing 5 mm MgSO4, 100 mm potassium phosphate (pH 7.5), 1 mm NEM (Sigma), and MTSES or MTSET (10 mm each) and incubated for 20 min at 25 °C with gentle shaking. The reaction was stopped by the addition of 20 mm dithiothreitol and 3 ml of TSC solution containing 10 mm Tris/Cl (pH 7.5), 250 mm sucrose, and 140 mm choline chloride. The membranes were centrifuged (Beckman, TLA 100.4, 75000 rpm, 20 min, 4 °C) and resuspended in the same buffer (5–10 mg of membrane protein/ml). For measurement of Na+/H+ antiporter activity of the treated membranes, ATP was used to energize the membranes because NEM inactivates the lactate-dependent respiration.To determine accessibility to NEM or other SH reagents, the membranes (0.5 mg of membrane protein) were resuspended in 1.15 ml of TSC supplemented with 14% glycerol, 1% DM, and 0.06 m MOPS (pH 7). The suspension was incubated for 20 min at 4 °C and centrifuged (Beckman, TLA 100.2, 75000 rpm, 20 min, 4 °C). The supernatant was added to 100 μl of Ni2+-NTA-agarose (Qiagen) and incubated with agitation for 1 h at 4 °C. The beads were then washed twice in binding buffer (10Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Google Scholar) at pH 7.4 and resuspended in 100 μl of binding buffer containing 0.2 mm fluorescein 5-maleimide (Molecular Probes) with gentle tilting for 30 min at 25 °C and washed in washing buffer (10Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Google Scholar) at pH 7.4. The protein was eluted in 20 μl of SDS-PAGE sampling buffer supplemented with 300 mm imidazole, agitated for 20 min at 4 °C, and collected in the supernatant after centrifugation (Eppendorf, 14.000 rpm, 2 min, 4 °C). The affinity-purified protein was separated on SDS-PAGE. For evaluation of the fluorescence labeling, SDS-PAGE gels were photographed under UV light (260 nm) as described (22Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Google Scholar).Labeling of NhaA Mutants with MIANS and Fluorescence Measurement—For treatment with MIANS (Molecular Probes) the protein was affinity-purified on Ni+2-NTA with acid elution. The reaction mixture (2.5 ml) contained 0.03% DM, 50 mm BTP/Cl at the indicated pH values and MIANS (4 μm). The reaction was initiated by the addition of the affinity-purified protein (20 μg of protein). Fluorescence was monitored continuously at 22 °C with a spectrofluorometer (PerkinElmer Life Sciences) using an excitation wavelength of 330 nm (8-nm slit) and an emission wavelength of 415 nm (4-nm slit).RESULTSCys Replacements Mutants of Loop VIII–IX—The Cys-less-NhaA (CL-NhaA) is expressed similar to the wild type protein and is as active (Fig. 1D and Refs. 10Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Google Scholar and 22Rimon A. Tzubery T. Galili L. Padan E. Biochemistry. 2002; 41: 14897-14905Google Scholar). We constructed the Cys replacement mutation E252C in loop VIII–IX of both wild type and CL-NhaA. The mutated NhaA proteins were designated E252C and CL-E252C, respectively. To characterize the phenotypic properties conferred by the NhaA mutations, the mutant plasmids were transformed into EP432, a ΔnhaA-nhaB strain. This strain can grow in high Na+-selective media (0.6 m NaCl at pH 7 or 8.3) only when it expresses a functional NhaA. Hence, when transformed with plasmids bearing NhaA mutations, this host allows characterization of the effect of the mutations on cell and membrane phenotype.Fig. 1D shows that both mutants of NhaA, E252C and CL-E252C, were expressed in EP432 cells, even better than the wild type and the CL-NhaA, their respective controls. As compared with E252C mutant, CL-E252C mutant showed somewhat lower expression (Fig. 1D).When Na+ was not added to the growth medium, the growth at both pH 7 and 8.3 of EP432 expressing either E252C or CL-E252C was similar to that expressing the wild type antiporter or its CL derivative (data not shown). In the selective medium, the growth of EP432 expressing E252C was very similar to that expressing the wild type protein with respect to both number and size of the colonies (Table II). The colony size of both strains was slightly smaller at alkaline pH than at neutral pH (Table II). On the other hand, the mutant CL-E252C conferred preferential growth at alkaline pH; although at both pH 7 and pH 8.3, the number of colonies of all strains was similar, the colony size of cells expressing CL-E252C was very small at pH 7, but at alkaline pH, it was even larger than that of wild type, CL-E252C, and E252C (Table II). It is not clear why CL-E252C but not E252C exhibits a pH-shifted growth phenotype.Table IICell and membrane phenotype of E252C and CL-E252C mutationsEncoded NhaA* variantPlasmidGrowth (0.6 M NaCl)Km (pH 8)pH 7pH 8.3NaClLiClpBR322--NhaApBSTX+++++0.20.02CL-NhaApCL-BSTX+++++0.2NDE252CpBSTX-E252C+++++9.9NDCL-E252CpCL-BSTX-E252C++++11.34 Open table in a new tab E252C Shifts the pH Dependence of the Na+/H+Antiporter Activity of NhaA to the Alkaline Range—To determine the Na+/H+ antiporter activity, everted membrane vesicles were isolated from EP432 expressing either E252C or CL-E252C. The Na+/H+ antiporter activity was measured at various pH values. The assay was based on the measurement of the ΔpH maintained across the membrane by respiration or H+/ATPase as determined from fluorescence quenching of acridine orange. The Na+/H+ antiporter activity was assessed from the dequenching caused by the addition of Na+. Membranes derived from EP432 cells transformed with the vector plasmid have no Na+/H+ antiporter activity (data not shown and (5Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Google Scholar)). Transformation with a plasmid expressing wild type NhaA restores Na+/H+ antiporter activity (5Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Google Scholar) that as shown previously changes dramatically as a function of pH (Refs. 3Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophys. Acta. 2001; 1505: 144-157Google Scholar and 6Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Google Scholar and Figs. 1, A–C, and 2). The results show that both NhaA mutants, E252C and CL-E252C, behave differently; at pH 7 where wild type NhaA shows between 15 and 20% of its maximal activity, both E252C mutants do not show any activity (Figs. 1A and 2). Furthermore, at pH 8 (in the presence of 10 mm Na+) when the wild type exhibits 100% activity (Figs. 1B and 2), E252C and CL-E252C mutants show about 30% of their maximal activity as observed at pH 9 (Figs. 1, B and C, and 2). The results suggest that whether in a wild type or CL genetic background, the E252C mutation causes a drastic alkaline shift, of 1 pH unit, in the pH dependence of NhaA.Fig. 2The E252C mutation drastically shifts the pH dependence of NhaA to the alkaline range. Plasmid transformed cells, growth conditions, isolation of membrane vesicles, and measurement of Na+/H+ antiporter activity at various pH values were as described in Fig. 1. The percentages of dequenching observed following the addition of 10 mm (open symbols) or 100 mm NaCl (filled symbols) are shown versus the pH of the assay. Each experiment was repeated at least three times, and the results were essentially identical. WT, wild type.View Large Image Figure ViewerDownload (PPT)The Effect of E252C on the Km of NhaA—The Km values for Na+ of the Na+/H+ antiporter activity of E252C and CL-E252C mutants as compared with those of the wild type were measured at both pH 8 (Table II) and pH 8.5 (data not shown). At both pH values, the apparent Km for the Na+ ion (10 mm) of both mutants was drastically increased as compared with the wild type (0.2 mm). The Km for Li+ was also increased by the mutations, but the effect was less drastic than that for Na+ (Table II). The results summarized in Fig. 2 show that the drastic shift in the pH profile of the Na+/H+ antiporter activity of both E252C and CL-E252C mutants is maintained even at saturating Na+ concentrations. Hence, the mutation E252C has an effect on the pH dependence of NhaA that is independent of its effect on the Km of the antiporter.E252C Causes an Alkaline Shift to the pH-dependent Conformational Change of NhaA as Probed by Trypsin—Although NhaA has many trypsin-cleavable sites, trypsin digests NhaA, either in the native membrane or when purified in DM micells, only at Lys249 in loop VIII–IX (19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar, 28Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14572-14576Google Scholar). Furthermore, the pH dependence of the digestion was identical in both NhaA preparations and reflected the pH dependence of the Na+/H+ activity of the antiporter (19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar, 28Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14572-14576Google Scholar). To explore the pH dependence of the digestion by trypsin of E252C mutant, E252C protein was affinity-purified in DM and subjected to trypsin at various pH values (Fig. 3B). The results show that in contrast to the wild type protein that is progressively digested between pH 6.5 to pH 8.5 (Fig. 3A), the mutant is resistant to trypsin up to pH 8.5 and only between pH 8.5 and 9 is digested (Fig. 3B). It is also apparent that the two proteolytic fragments (Fig. 3B, HF and LF) obtained from the mutant protein are identical in size to those obtained from the wild type protein (Fig. 3A and Ref. 19Gerchman Y. Rimon A. Padan E. J. Biol. Chem. 1999; 274: 24617-24624Google Scholar). Identical behavior was obtained with mutant CL-E252C (data not shown). Hence, the alkaline shift caused to the pH profile of the antiporter activity by mutation E252C is reflected in a similar shift in the pH dependence of the conformational change of NhaA at position 249, as probed by trypsin.Fig. 3The E252C mutation drastically shifts the pH dependence of digestion of NhaA by trypsin to the alkaline range. TA16 cells transformed with plasmids pAXH2 (A) or pAXH2-E252C (B and C), encoding His-tagged wild type NhaA ((His)6-WT) or His-tagged E252C ((His)6-E252C), respectively, were grown in medium A and overexpressed with isopropyl-β-d-thiogalactopyranoside (0.5 mm), and high pressure membranes were isolated. The His-tagged proteins were affinity-purified in 0.1% DM on Ni+2-NTA from the membranes with no further treatment (A and B) or after treatme