Portal de Periódicos da CAPES

The Efficient Functioning of Photosynthesis and Respiration in Synechocystis sp. PCC 6803 Strictly Requires the Presence of either Cytochrome c6 or Plastocyanin

2004; Elsevier BV; Volume: 279; Issue: 8 Linguagem: Inglês

10.1074/jbc.m311565200

1083-351X

Raúl V. Durán, Manuel Hervás, Miguel Á. De la Rosa, José A. Navarro,

Microbial Community Ecology and Physiology

In cyanobacteria, cytochrome c6 and plastocyanin are able to replace each other as redox carriers in the photosynthetic and respiratory electron transport chains with the synthesis of one or another protein being regulated by the copper concentration in the culture medium. However, the presence of a third unidentified electron carrier has been suggested. To address this point, we have constructed two deletion mutants of the cyanobacterium Synechocystis sp. PCC 6803, each variant lacking either the petE or petJ gene, which respectively codes for the copper or heme protein. The photoautotrophic and heterotrophic growth rate of the two mutants in copper-free and copper-supplemented medium as well as their photosystem I reduction kinetics in vivo were compared with those of wild-type cells. The two mutant strains grow at equivalent rates and show similar in vivo photosystem I reduction kinetics as wild-type cells when cultured in media that allow the expression of just one of the two electron donor proteins, but their ability to grow and reduce photosystem I is much lower when neither cytochrome c6 nor plastocyanin is expressed. These findings indicate that the normal functioning of the cyanobacterial photosynthetic and respiratory chains obligatorily depends on the presence of either cytochrome c6 or plastocyanin. In cyanobacteria, cytochrome c6 and plastocyanin are able to replace each other as redox carriers in the photosynthetic and respiratory electron transport chains with the synthesis of one or another protein being regulated by the copper concentration in the culture medium. However, the presence of a third unidentified electron carrier has been suggested. To address this point, we have constructed two deletion mutants of the cyanobacterium Synechocystis sp. PCC 6803, each variant lacking either the petE or petJ gene, which respectively codes for the copper or heme protein. The photoautotrophic and heterotrophic growth rate of the two mutants in copper-free and copper-supplemented medium as well as their photosystem I reduction kinetics in vivo were compared with those of wild-type cells. The two mutant strains grow at equivalent rates and show similar in vivo photosystem I reduction kinetics as wild-type cells when cultured in media that allow the expression of just one of the two electron donor proteins, but their ability to grow and reduce photosystem I is much lower when neither cytochrome c6 nor plastocyanin is expressed. These findings indicate that the normal functioning of the cyanobacterial photosynthetic and respiratory chains obligatorily depends on the presence of either cytochrome c6 or plastocyanin. In eukaryotic organisms, the components of the photosynthetic and respiratory electron transfer chains are well identified and located in chloroplasts and mitochondria, respectively, but in cyanobacteria, the two redox pathways occur in the same membrane and share a number of components such as the plastoquinone pool and cytochrome b6f (1Schmetterer G. Bryant D.G. The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Norwell, MA1994: 409-435Crossref Google Scholar, 2Peschek G.A. Peschek G.A. Löffelhardt W. Schmetterer G. The Photosynthetic Prokaryotes. Kluwer Academic Publishers, Norwell, MA1999: 201-209Google Scholar). Because respiratory cytochrome c is lacking in cyanobacteria, it has been proposed that these organisms use the same c-type cytochrome, in particular cytochrome c6 (Cyt), 1The abbreviations used are: Cyt, cytochrome c6; kF and kS, observed rate constants for the fast and slower phases, respectively, of biphasic kinetics; kM, observed rate constant for monophasic kinetics; Pc, plastocyanin; PSI, photosystem I; PSII, photosystem II; WT, wild-type; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. 1The abbreviations used are: Cyt, cytochrome c6; kF and kS, observed rate constants for the fast and slower phases, respectively, of biphasic kinetics; kM, observed rate constant for monophasic kinetics; Pc, plastocyanin; PSI, photosystem I; PSII, photosystem II; WT, wild-type; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. to serve both in photosynthesis and respiration (3Binder A. Hauser R. Krogmann D. Biochim. Biophys. Acta. 1984; 765: 241-246Crossref Scopus (16) Google Scholar). Cyt is a well known electron carrier between cytochrome b6f and photosystem I (PSI) in cyanobacteria and some algae, but it can be replaced by plastocyanin (Pc) when the cells are grown in the presence of copper (cf. Ref. 4Hervás M. Navarro J.A. De la Rosa M.A. Accounts Chem. Res. 2003; 36: 798-805Crossref PubMed Scopus (122) Google Scholar for a recent review). In those species that are able to synthesize either Cyt or Pc, the expression level of the corresponding genes is controlled by the copper concentration in the growth medium (5Zhang L. McSpadden B. Pakrasi H.B. Whitmarsh J. J. Biol. Chem. 1992; 267: 19054-19059Abstract Full Text PDF PubMed Google Scholar, 6Malakhov M.P. Malakhova O.A. Murata N. FEBS Lett. 1999; 444: 281-284Crossref PubMed Scopus (35) Google Scholar). Despite their intrinsic different conformations, Cyt and Pc share a number of similar physicochemical and structural features that allow them to interact with the same redox partners with equivalent kinetic efficiency and replace each other inside the cells (7Hervás M. Navarro J.A. Díaz A. Bottín H. De la Rosa M.A. Biochemistry. 1995; 34: 11321-11326Crossref PubMed Scopus (130) Google Scholar, 8Molina-Heredia F.P. Hervás M. Navarro J.A. De la Rosa M.A. J. Biol. Chem. 2001; 276: 601-605Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). The two metalloproteins are thus presented as an excellent case study of biological evolution, which is not only convergent (two structures playing the same role) but also parallel (two proteins varying in a concerted way from one organism to another) (9De la Rosa M.A. Navarro J.A. Díaz-Quintana A. De la Cerda B. Molina-Heredia F.P. Balme A. Murdoch P.S. Díaz-Moreno I. Durán R.V. Hervás M. Bioelectrochemistry. 2002; 55: 41-45Crossref PubMed Scopus (58) Google Scholar). Such a interchangeability between Cyt and Pc in photosynthesis has also been proposed for the respiratory chain in which the two metalloproteins could act as alternative donors of electrons to cytochrome c oxidase (1Schmetterer G. Bryant D.G. The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Norwell, MA1994: 409-435Crossref Google Scholar, 10Pils D. Gregor W. Schmetterer G. FEMS Microbiol. Lett. 1997; 152: 83-88Crossref Google Scholar). The observations by Zhang et al. (11Zhang L. Pakrasi H.B. Whitmarsh J. J. Biol. Chem. 1994; 269: 5036-5042Abstract Full Text PDF PubMed Google Scholar) with Cyt- or Pc-deficient mutant strains of the cyanobacterium Synechocystis sp. PCC 6803 led these authors to conclude that electrons can be transferred from the cytochrome b6f complex to PSI in the absence of both Cyt and Pc and that Cyt is not obligatorily required for respiratory electron transport. Metzger et al. (12Metzger S.U. Pakrasi H.B. Whitmarsh J. Mathis P. Photosynthesis: From Light to Biosphere. Kluwer Academic Publishers, Norwell, MA1995: 823-826Google Scholar) indeed proposed the presence of a third electron carrier as the mutant strains of Synechocystis were able to grow photoautotrophically and sustain normal rates of oxygen evolution and dark respiration in the absence of both Cyt and Pc. These authors also measured the kinetics of in vivo PSI reduction and found that the electron transfer rates only occurred 4-6 times slower in the mutants than in the wild-type (WT) cells. The challenge is thus to understand how photosynthetic and respiratory electron transport chains operate in cyanobacterial cells in the absence of both Cyt and Pc. To answer this question, we herein report the construction of mutant strains of Synechocystis cells that lack either Cyt or Pc to further analyze their photoautotrophic and heterotrophic growth along with their in vivo PSI reduction kinetics. In contrast to previous proposals, our findings allow us to conclude that the normal functioning of the cyanobacterial photosynthetic and respiratory chains obligatorily depends on the presence of one of these proteins, thus discarding the existence of any third efficient electron carrier. Strains and Culture Conditions—Synechocystis sp. PCC 6803 was grown photoautotrophically in liquid or solid mineral BG-11 medium (13Rippka R. Deruelles J. Waterbury J.B. Herman M. Stanier R.Y. J. Gen. Microbiol. 1979; 111: 1-61Crossref Google Scholar) either in the presence or absence of copper under continuous white fluorescent illumination (50 microeinsteins m-2 s-1) at 30 °C. Liquid cultures were bubbled with air supplemented with 1% (v/v) CO2. When necessary, copper was added at 1 μm, whereas copper-depleted medium (BG-11-C) was supplemented with 300 μm bathocuproinedisulfonic acid as a chelating agent to eliminate any traces of copper (14Tottey S. Rich P.R. Rondet S.A.M. Robinson N.J. J. Biol. Chem. 2001; 276: 19999-20004Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). Cell cultures with or without copper were pre-adapted to the new conditions by repeated incubation cycles, and cell growth was monitored by spectrophotometrically measuring the chlorophyll content (15Arnon D.I. Plant Physiol. 1949; 24: 1-15Crossref PubMed Google Scholar). Total protein concentration was determined as described elsewhere (16Markwell M.A.K. Haas S.M. Bieber L.L. Tolbert N.E. Anal. Biochem. 1978; 87: 206-210Crossref PubMed Scopus (5326) Google Scholar). Light-activated heterotrophic growth experiments were carried out by adding 10 mm glucose to the standard BG-11 or BG-11-C solid medium. Cell cultures were incubated in darkness with 5-min pulses of white light (50 microeinsteins m-2 s-1) every 24 h (17Anderson S.L. McIntosh L. J. Bacteriol. 1991; 173: 2761-2767Crossref PubMed Google Scholar). Other conditions were as for the photoautotrophic growth. Escherichia coli DH5α was grown in Luria-Bertani liquid or solid medium (18Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) supplemented, when required, with kanamycin (50 μg ml-1), spectinomycin (100 μg ml-1), or ampicillin (100 μg ml-1). Cloning and Deletional Inactivation of petE and petJ Genes—To amplify the petE gene (coding for Pc) and its flanking regions by PCR, the following two oligonucleotides were designed from the genomic sequence of Synechocystis (19Kaneko T. Sato S. Kotani H. Tanaka A. Asamizu E. Nakamura Y. Miyajima N. Hirosawa M. Sugiura M. Sasamoto S. Kimura T. Hosouchi T. Matsuno A. Muraki A. Nakazaki N. Naruo K. Okumura S. Shimpo S. Takeuchi C. Wada T. Watanabe A. Yamada M. Yasuda M. Tabata S. DNA Res. 1996; 3: 109-136Crossref PubMed Scopus (2121) Google Scholar) (NCBI accession number NC_000911): RPC001A (attggcacggcccatcttcccta) as the direct primer and RPC001B (atcgcccctccgttggcggtgtct) as the reverse primer. Genomic DNA from Synechocystis was used as a template (Fig. 1) (20Cai Y. Wolk C.P. J. Bacteriol. 1990; 172: 3138-3145Crossref PubMed Scopus (406) Google Scholar). A 2.6-kb band resulting from PCR was purified by electrophoresis in 1% agarose gel and cloned into the pGEMT commercial vector (Promega) to obtain the pPlaF plasmid. The SmaI-CelII fragment from pPlaF was replaced by a C.K1 kanamycin resistance cassette from pRL161 plasmid (21Elhai J. Wolk C.P. Gene (Amst.). 1988; 68: 119-138Crossref PubMed Scopus (374) Google Scholar). A 5.2-kb band was obtained after pPlaF digestion with SmaI and CelII, and its ends were blunted with Klenow polymerase and ligated with a 1.3-kb fragment obtained after pRL161 digestion with HinCII. The resulting pPlaFΔCK1 plasmid was tested by restriction analysis. Synechocystis WT cells were transformed with this plasmid by standard procedures (22Williams J.G.K. Methods Enzymol. 1988; 167: 766-778Crossref Scopus (851) Google Scholar), and the transformants were selected and segregated in solid medium with increasing amounts of kanamycin from 50 to 500 μg ml-1. The correct integration and segregation of the deleted copies was tested by Southern blot as follows. Genomic DNA of isolated mutants were digested with XmnI and separated in 0.7% agarose electrophoretic gels. DNA was then transferred to Z-probe nylon membranes (Bio-Rad). As a probe, the NheI-SmaI fragment from pPlaF was radioactively labeled with 32P using the commercial kit Ready-to-Go (Amersham Biosciences). In a XmnI digestion of the genomic DNA, this probe hybridized with a 2,125-bp band in the case of WT and with a 3,073-bp band in the case of deletion mutant. Similarly, the RCYT001A (atggtgtggcggaaggtcgcaataa) and RCYT001B (tagccaatagctctggccctgccgat) oligonucleotides were designed as direct and reverse primers, respectively, for PCR amplification of the open reading frame corresponding to the petJ gene (coding for Cyt) and its flanking regions (Fig. 1). A 2.4-kb band was purified and cloned into pGEMT to generate the pCytF plasmid. The fragment NheI-EcoRV from pCytF was replaced by the Ω fragment from the pRL-SPE plasmid, which contains the aadA gene that confers spectinomycin resistance as follows. pCytF was digested with NheI and EcoRV, and the resulting 5.0-kb band was isolated by 1% agarose gel electrophoresis. The ends of this band were blunted with Klenow polymerase. The PvuII fragment from pRL-SPE corresponding to the Ω cassette was ligated to the 5.0-kb NheI-EcoRV fragment from pCytF, and the resulting pCytFΔSPE plasmid was tested by restriction analysis. The transformants were segregated and tested as for petE inactivation but using spectinomycin and streptomycin as selective antibiotics at concentrations ranging from 2.5 to 20 μg ml-1. For the Southern blot analysis, genomic DNA was digested with BstEII using the ClaI-EcoRV fragment from pCytF as probe. In a BstEII digestion of the genomic DNA, this probe hybridized with a 2,904-bp band in the case of WT and with a 1,680-bp band in the case of deletion mutant. SDS-PAGE and Immunoblotting—Proteins from Synechocystis WT cells and from the mutant strains were isolated and separated by 15% polyacrylamide gel electrophoresis using standard protocols (23Schägger H. von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10475) Google Scholar). 100 μg of total protein were charged in each case. After separation, proteins were transferred to polyvinylidene difluoride Immobilon-PSQ membranes (Millipore) and immunodetected with polyclonal antibodies raised against Synechocystis Pc or Cyt. Antibodies were obtained by inoculating purified proteins (24Hervás M. Navarro F. Navarro J.A. Chávez S. Díaz A. Florencio F.J. De la Rosa M.A. FEBS Lett. 1993; 319: 257-260Crossref PubMed Scopus (36) Google Scholar, 25De la Cerda B. Díaz-Quintana A. Navarro J.A. Hervás M. De la Rosa M.A. J. Biol. Chem. 1999; 274: 13292-13297Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar) into rabbits followed by extraction of serum blood at the Centro de Producción y Experimentación Animal (Seville, Spain). Binding of antibodies was visualized with peroxidase-conjugated antibodies and the commercial ECL-Plus kit (Amersham Biosciences). Kinetics Analysis of in Vivo PSI Reduction—WT and mutant cells of Synechocystis were harvested by centrifugation at different growing phases and suspended in 20 mm Tricine-KOH buffer, pH 7.0, supplemented with 10% (w/v) Ficoll to avoid cell aggregation. The in vivo kinetics for electron transfer from either Pc (in copper-supplemented cultures) or Cyt (in copper-depleted cultures) to PSI were followed by laser flash absorption spectroscopy as previously described (26Hervás M. Myshkin E. Vintonenko N. De la Rosa M.A. Bullerjahn G.S. Navarro J.A. J. Biol. Chem. 2003; 278: 8179-8183Abstract Full Text Full Text PDF PubMed Scopus (7) Google Scholar). The reaction cell (optical path length, 1 mm) contained whole Synechocystis cells at 150-300 μg ml-1 chlorophyll concentration and 1 mm ascorbate. The kinetics were recorded after excitation by laser flash both in the absence and presence of 20 μm phenazine methasulfate, which is a well known efficient donor of electrons to PSI. Interferences arising from photosystem II (PSII) were avoided by pre-illumination of the samples with white light in the presence of 10 μm DCMU (3-(3′,4′-dichlorophenyl)-1,1-dimethylurea) and 10 mm hydroxylamine (27Soriano G.M. Ponomarev M.V. Tae G.S. Cramer W.A. Biochemistry. 1996; 35: 14590-14598Crossref PubMed Scopus (72) Google Scholar). Deletion of the petE and petJ Genes in Synechocystis Cells—The cyanobacterial cells were transformed with the pPlaFΔCK1 or pCytFΔSPE plasmids, and the resulting ΔpetE and ΔpetJ strains were selected as transformants corresponding to petE and petJ null mutants, respectively. ΔpetE was selected in BG-11-C medium with 300 μm bathocuproinedisulfonic acid to ensure the complete removal of copper and kanamycin (500 μg ml-1). ΔpetJ was selected in BG-11 medium supplemented with 1 μm copper in the presence of both spectinomycin and streptomycin (20 μg ml-1 each). The correct integration and segregation of both mutants were checked by Southern blot (Fig. 2) with the length of resulting bands and the absence of other bands being as expected for completely segregated mutants (see "Experimental Procedures"). Several attempts to segregate the double mutant were unsuccessful. In agreement with the copper-dependent regulation of Pc and Cyt expression levels (see Introduction), WT Synechocystis cells synthesize either Pc or Cyt when cultured in the presence or absence of copper, respectively (Fig. 3). Accordingly, the ΔpetE strain produces Cyt when growing in copper-depleted medium but is completely unable to synthesize even traces of Cyt and/or Pc when the medium is supplemented with this metal. In a similar way, the ΔpetJ strain forms Pc in copper-supplemented medium but no detectable levels of Cyt and/or Pc were yielded in cells cultured in the absence of copper (Fig. 3). Photoautotrophic Growth of WT and Mutant Strains—The ability of the ΔpetE and ΔpetJ mutants to grow under photoautotrophic conditions was determined in cultures with and without copper. As previous studies in the absence of a copper-chelating agent had led to controversial results (28Ardelean I. Matthijs H.C.P. Havaux M. Joset F. Jeanjean R. FEMS Microbiol. Lett. 2002; 213: 113-119Crossref PubMed Google Scholar) and we had observed by Western blot analysis that residual copper levels (nanomolar range) in the culture medium were enough to induce Pc expression (data not shown), the copper-chelating agent bathocuproinedisulfonic acid was added to the cell cultures to completely remove metal traces and abolish residual Pc expression. Growth curves show not only that the WT strain similarly grows either with or without added copper but also that the two deletion mutants grow at rates equivalent to that of WT when cultured in media that allow them to express one of the two electron donor proteins (Fig. 4). In fact, ΔpetE is only able to grow at a standard rate in the absence of copper, i.e. when Cyt is produced, whereas ΔpetJ grows normally when Pc is synthesized because of copper induction. When the ΔpetE and ΔpetJ strains are under conditions at which the expression levels of both Pc and Cyt are not detectable, their respective growth rate is much lower than that of WT cells. In contrast to such a drastic decrease in the growth rates of the two mutant strains, Zhang et al. (11Zhang L. Pakrasi H.B. Whitmarsh J. J. Biol. Chem. 1994; 269: 5036-5042Abstract Full Text PDF PubMed Google Scholar) reported a slightly diminished growth rate and a normal steady-state photosynthetic electron transport for their Pc- and Cyt-deficient mutants under similar photoautotrophic conditions. In view of these discrepancies, the kinetics for PSI reduction in whole cells of ΔpetE and ΔpetJ were analyzed by laser flash absorption spectroscopy. In Vivo Reduction of PSI in WT, ΔpetE, and ΔpetJ Cells—In vitro PSI reduction by Cyt and Pc has been extensively investigated in a wide variety of photosynthetic organisms such as cyanobacteria (including Synechocystis), green algae, and plants (7Hervás M. Navarro J.A. Díaz A. Bottín H. De la Rosa M.A. Biochemistry. 1995; 34: 11321-11326Crossref PubMed Scopus (130) Google Scholar, 25De la Cerda B. Díaz-Quintana A. Navarro J.A. Hervás M. De la Rosa M.A. J. Biol. Chem. 1999; 274: 13292-13297Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 29Hervás M. Ortega J.M. Navarro J.A. Díaz A. De la Rosa M.A. Bottin H. Biochim. Biophys. Acta. 1994; 1184: 235-241Crossref Scopus (64) Google Scholar). However, little is known on the kinetic behavior of the two metalloproteins serving as electron donors to PSI in vivo (30Baymann F. Rappaport F. Joliot P. Kallas T. Biochemistry. 2001; 40: 10570-10577Crossref PubMed Scopus (12) Google Scholar). In this work, the kinetics of in vivo PSI reduction by Cyt or Pc in Synechocystis were analyzed in whole cells by following the absorbance changes at 820 nm after flash-induced P700 photoxidation. From the resulting kinetics, the values for the observed rate constants of PSI reduction by either Pc or Cyt were estimated. In WT Synechocystis cells growing in culture media supplemented with copper, PSI reduction was only ascribed to Pc because Cyt synthesis was repressed and the kinetics were well fitted to monoexponential curves (Fig. 5). The value for the observed rate constant of such a monophasic kinetic (kM) was ∼2,700 s-1 (t1/2, 250 μs) (Table I). In WT Synechocystis cells growing in copper-depleted cultures in which Pc synthesis was repressed, Cyt-dependent PSI reduction followed a biphasic kinetic (Fig. 5): the first, fast phase yielded a rate constant (kF) of ∼45,000 s-1 (t1/2, 16 μs), and the second, slower phase exhibited a rate constant (kS) of ∼2,000 s-1 (t1/2, 350 μs) (Table I). The fast and slow phases accounted for 37 and 63%, respectively, of the total signal amplitude. These values for kM, kF, and kS remained constant at the different culture stages but significantly increase when phenazine methasulfate, a well known artificial electron donor to PSI, was added to the reaction cell (not shown).Table IObserved rate constants for in vivo PSI reduction of WT, ΔpetE, and ΔpetJ Synechocystis cells+Cu−CukM × 10−3kF × 10−4kS × 10−3s-1WT2.7 ± 0.24.5 ± 0.62.0 ± 0.2ΔpetE<0.014.0 ± 0.33.1 ± 0.2ΔpetJ3.6 ± 0.2ND<0.01 Open table in a new tab In vivo PSI reduction in both ΔpetE and ΔpetJ cells growing under conditions that allow the expression of one of the two electron donor proteins follows kinetics similar to those observed in the WT strain (Fig. 5). In fact, the kinetics with the ΔpetE mutant in the absence of copper and with the ΔpetJ mutant in the presence of copper were, respectively, biphasic and monophasic and their observed rate constants were equivalent to those attained with the WT cells (Table I), but no PSI reduction was detected in mutant cells in which neither Pc nor Cyt was expressed (Fig. 5). These data not only explain our experimental observations on the photoautotrophic growth of WT and mutant Synechocystis strains (see above) but also suggest that either Cyt or Pc is obligatorily required for the efficient reduction of PSI. In contrast, Metzger et al. (12Metzger S.U. Pakrasi H.B. Whitmarsh J. Mathis P. Photosynthesis: From Light to Biosphere. Kluwer Academic Publishers, Norwell, MA1995: 823-826Google Scholar) observed in vivo PSI reduction even in the absence of Pc or Cyt, a finding that can be ascribed to one (or both) of the following facts: (i) optical interferences derived from PSII excitation, or (ii) Pc expression because of residual copper levels. To avoid these difficulties and assure that the observed kinetic signals can only be assigned to changes in the oxidation state of PSI, we have used a 694-nm laser flash to specifically favor the excitation of PSI over PSII, have added DCMU-hydroxylamine to the reaction cell to block electron transfer from PSII, have confirmed that the kinetic signals are ascribed to PSI by adding phenazine methasulfate, and have completely removed copper from copper-free culture media by adding an efficient chelating agent. Light-activated Heterotrophic Growth of WT and Mutant Cells—Taking into account that the cyanobacterial respiratory and photosynthetic electron transfer chains share a number of redox components like Cyt and Pc (1Schmetterer G. Bryant D.G. The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Norwell, MA1994: 409-435Crossref Google Scholar, 10Pils D. Gregor W. Schmetterer G. FEMS Microbiol. Lett. 1997; 152: 83-88Crossref Google Scholar), the ability of the WT, ΔpetE, and ΔpetJ strains to grow in glucose-supplemented culture media was investigated. Under such heterotrophic conditions, glucose was used as an organic carbon source (17Anderson S.L. McIntosh L. J. Bacteriol. 1991; 173: 2761-2767Crossref PubMed Google Scholar) and the electrons were transported from the sugar molecule to dioxygen throughout the respiratory pathway. Fig. 6 shows that none of the cell strains (including the WT) can grow in copper-free medium. This is as expected from the specific requirement for copper of cytochrome c oxidase to be correctly assembled and able to function (10Pils D. Gregor W. Schmetterer G. FEMS Microbiol. Lett. 1997; 152: 83-88Crossref Google Scholar). However, in copper-containing media, the WT and ΔpetJ strains synthesized Pc and showed a normal growth level but the ΔpetE strain produced neither Cyt nor Pc and was thus unable to grow because of the absence of a donor of electrons to cytochrome c oxidase. Taken together, all of these data indicate that there is no any other alternative redox mediator as efficient as Cyt and Pc in the photosynthetic and respiratory electron transport chains and therefore Synechocystis cells strictly depend on the synthesis of either Cyt or Pc to grow not only photoautotrophically but also heterotrophically. The pRL-SPE plasmid was kindly provided by Luis López-Maury (Instituto de Bioquímica Vegetal y Fotosíntesis, Seville, Spain). We thank Dr. Maria Feio for critically reading the paper.