Portal de Periódicos da CAPES

Predominant Identification of RNA-binding Proteins in Fas-induced Apoptosis by Proteome Analysis

2001; Elsevier BV; Volume: 276; Issue: 28 Linguagem: Inglês

10.1074/jbc.m101062200

1083-351X

Bernd Thiede, Christiane Dimmler, Frank Siejak, Thomas Rudel,

interferon and immune responses

Proteome analysis of Jurkat T cells was performed in order to identify proteins that are modified during apoptosis. Subtractive analysis of two-dimensional gel patterns of apoptotic and nonapoptotic cells revealed differences in 45 protein spots. 37 protein spots of 21 different proteins were identified by peptide mass fingerprinting using matrix-assisted laser desorption/ionization mass spectrometry. The hnRNPs A0, A2/B1, A3, K, and R; the splicing factors p54nrb, SRp30c, ASF-2, and KH-type splicing regulatory protein (FUSE-binding protein 2); and α NAC, NS1-associated protein 1, and poly(A)-binding protein 4 were hitherto unknown to be involved in apoptosis. The putative cleavage sites of the majority of the proteins could be calculated by the molecular masses and isoelectric points in the two-dimensional electrophoresis gel, the peptide mass fingerprints, and after translation by treatment with recombinant caspase-3. Remarkably, 15 of the 21 identified proteins contained the RNP or KH motif, the best characterized RNA-binding motifs. Proteome analysis of Jurkat T cells was performed in order to identify proteins that are modified during apoptosis. Subtractive analysis of two-dimensional gel patterns of apoptotic and nonapoptotic cells revealed differences in 45 protein spots. 37 protein spots of 21 different proteins were identified by peptide mass fingerprinting using matrix-assisted laser desorption/ionization mass spectrometry. The hnRNPs A0, A2/B1, A3, K, and R; the splicing factors p54nrb, SRp30c, ASF-2, and KH-type splicing regulatory protein (FUSE-binding protein 2); and α NAC, NS1-associated protein 1, and poly(A)-binding protein 4 were hitherto unknown to be involved in apoptosis. The putative cleavage sites of the majority of the proteins could be calculated by the molecular masses and isoelectric points in the two-dimensional electrophoresis gel, the peptide mass fingerprints, and after translation by treatment with recombinant caspase-3. Remarkably, 15 of the 21 identified proteins contained the RNP or KH motif, the best characterized RNA-binding motifs. matrix-assisted laser desorption/ionization mass spectrometry bovine serum albumin heterogeneous nuclear ribonucleoprotein Z-Val-Ala-dl-Asp-fluoromethylketone 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid guanine nucleotide dissociation inhibitor Apoptosis, a genetically determined form of cellular suicide, is an essential and complex process involved in the development and maintenance of cell homeostasis in multicellular organisms. Improper regulation of apoptosis has been connected with various diseases including cancer, autoimmune disorders, viral infections, AIDS, neurodegenerative disorders, and myocardial infarction (1Thompson C.B. Science. 1995; 267: 1456-1462Crossref PubMed Scopus (6191) Google Scholar). Because of its extraordinary importance in human diseases, the therapeutic regulation of apoptosis offers numerous challenges (2Nicholson D.W. Nat. Biotechnol. 1996; 14: 297-301Crossref PubMed Scopus (239) Google Scholar). The basis for therapeutic intervention, however, is the identification of the molecular players involved in apoptosis regulation. During the last few years, numerous factors constituting the machinery that initiates and regulates apoptosis have already been characterized. Specialized receptors, so-called death receptors, of the tumor necrosis factor superfamily induce apoptosis by ligand binding and receptor oligomerization, followed by the recruitment of adapter and effector proteins to the death domain of the receptor (3Ashkenazi A. Dixit V.M. Curr. Opin. Cell Biol. 1999; 11: 255-260Crossref PubMed Scopus (1155) Google Scholar). One of the best characterized death receptor is the so-called CD95 (Fas/Apo-1) receptor that plays a major role in controlling immune cells. CD95(Fas/Apo-1) is involved in the deletion of autoreactive cells and activation-induced T cell death, killing of virus-infected cells or cancer cells, and killing of inflammatory cells at immune privileged sites (4Griffith T.S. Ferguson T.A. Immunol. Today. 1997; 18: 240-244Abstract Full Text PDF PubMed Scopus (251) Google Scholar, 5Nagata S. Golstein P. Science. 1995; 267: 1449-1456Crossref PubMed Scopus (3979) Google Scholar, 6O'Connell J. Bennett M.W. O'Sullivan G.C. Collins J.K. Shanahan F. Immunol. Today. 1999; 20: 46-52Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar). The effector molecules activated by death receptors are the caspases (7Cohen G.M. Biochem. J. 1997; 326: 1-16Crossref PubMed Scopus (4132) Google Scholar, 8Thornberry N.A. Lazebnik Y. Science. 1998; 281: 1312-1316Crossref PubMed Scopus (6159) Google Scholar), a family of cysteinyl-aspartases that execute the apoptotic program by cleaving different cellular substrates (9Stroh C. Schulze-Osthoff K. Cell Death Differ. 1998; 5: 997-1000Crossref PubMed Scopus (255) Google Scholar). Cleavage of the substrate results in the destruction of cytoskeletal proteins (10Wang K.K. Posmantur R. Nath R. McGinnis K. Whitton M. Talanian R.V. Glantz S.B. Morrow J.S. J. Biol. Chem. 1998; 273: 22490-22497Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar, 11Stegh A.H. Herrmann H. Lampel S. Weisenberger D. Andra K. Seper M. Wiche G. Krammer P.H. Peter M.E. Mol. Cell. Biol. 2000; 20: 5665-5679Crossref PubMed Scopus (138) Google Scholar), activation or inactivation of signaling molecules (12Rudel T. Bokoch G.M. Science. 1997; 276: 1571-1574Crossref PubMed Scopus (604) Google Scholar, 13Gervais F.G. Thornberry N.A. Ruffolo S.C. Nicholson D.W. Roy S. J. Biol. Chem. 1998; 273: 17102-17108Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar), and conversion of inhibitors into activators of apoptosis (14Cheng E.H. Kirsch D.G. Clem R.J. Ravi R. Kastan M.B. Bedi A. Ueno K. Hardwick J.M. Science. 1997; 278: 1966-1968Crossref PubMed Scopus (1005) Google Scholar). The net effect of substrate processing is the ordered destruction of the cell body including fragmentation of DNA and formation of fragmented cell particles, apoptotic bodies, which are engulfed by neighboring cells (15Ren Y. Savill J. Cell Death Differ. 1998; 5: 563-568Crossref PubMed Scopus (307) Google Scholar). To understand the molecular details of the destruction process, the identification of caspase substrates involved in the elementary processes of apoptosis is essential. Proteome approaches have been successfully used to find new apoptosis-associated proteins (16Brockstedt E. Rickers A. Kostka S. Laubersheimer A. Dorken B. Wittmann-Liebold B. Bommert K. Otto A. J. Biol. Chem. 1998; 273: 28057-28064Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 17Gerner C. Fröhwein U. Gotzmann J. Bayer E. Gelbmann D. Bursch W. Schulte-Hermann R. J. Biol. Chem. 2000; 275: 39018-39026Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). The proteome was defined as the protein complement expressed by the genome of an organism, tissue, or differentiated cell (18Wilkins M.R. Pasquali C. Appel R.D. Ou K. Golaz O. Sanchez J.C. Yan J.X. Gooley A.A. Hughes G. Humphery-Smith I. Williams K.L. Hochstrasser D.F. Bio/Technology. 1996; 14: 61-65Crossref PubMed Scopus (723) Google Scholar). The study of proteomes is one of the most important approaches to understand gene function (19Blackstock W.P. Weir M.P. Trends Biotechnol. 1999; 17: 121-127Abstract Full Text Full Text PDF PubMed Scopus (738) Google Scholar, 20Williams K.L. Electrophoresis. 1999; 20: 678-688Crossref PubMed Scopus (97) Google Scholar). Medical and clinical applications of proteomics to diseases promise to identify new diagnostic markers and aid in the development of drugs (21Anderson N.L. Anderson N.G. Electrophoresis. 1998; 19: 1853-1861Crossref PubMed Scopus (807) Google Scholar, 22Jungblut P.R. Zimny-Arndt U. Zeindl-Eberhart E. Stulik J. Koupilova K. Pleissner K.P. Otto A. Muller E.C. Sokolowska-Kohler W. Grabher G. Stoffler G. Electrophoresis. 1999; 20: 2100-2110Crossref PubMed Scopus (194) Google Scholar). The proteins are separated by two-dimensional gel electrophoresis for proteome analysis (23O'Farrell P.H. J. Biol. Chem. 1975; 250: 4007-4021Abstract Full Text PDF PubMed Google Scholar, 24Klose J. Humangenetik. 1975; 26: 231-243PubMed Google Scholar). The subtractive analysis of the two-dimensional gel electrophoresis pattern of a control with the process of interest; e.g. a specific disease can lead to different protein spots (25Aebersold R. Leavitt J. Electrophoresis. 1990; 11: 517-527Crossref PubMed Scopus (58) Google Scholar). These spots can be identified by various methods. Electrospray ionization mass spectrometry (26Fenn J.B. Mann M. Meng C.K. Wong S.F. Whitehouse C.M. Science. 1989; 246: 64-71Crossref PubMed Scopus (6343) Google Scholar) and matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS)1 (27Karas M. Hillenkamp F. Anal. Chem. 1988; 60: 2299-2301Crossref PubMed Scopus (4840) Google Scholar) are particularly suitable for this purpose due to their sensitivity, speed, and accuracy (28Yates J.R. J. Mass Spectrom. 1998; 33: 1-19Crossref PubMed Scopus (679) Google Scholar). Finally, the obtained proteome should be stored in a data base to handle the large amount of information (29Appel R.D. Bairoch A. Sanchez J.C. Vargas J.R. Golaz O. Pasquali C. Hochstrasser D.F. Electrophoresis. 1996; 17: 540-546Crossref PubMed Scopus (124) Google Scholar, 30Lemkin P.F. Electrophoresis. 1997; 18: 461-470Crossref PubMed Scopus (65) Google Scholar, 31Celis J.E. Ostergaard M. Jensen N.A. Gromova I. Rasmussen H.H. Gromov P. FEBS Lett. 1998; 430: 64-72Crossref PubMed Scopus (139) Google Scholar). We recently established an Internet-accessible two-dimensional gel electrophoresis data base (available on the World Wide Web) of the Jurkat T cells (32Thiede B. Siejak F. Dimmler C. Jungblut P. Rudel T. Electrophoresis. 2000; 21: 2713-2720Crossref PubMed Scopus (37) Google Scholar). In order to identify proteins that are modified during apoptosis, we used the two-dimensional gel electrophoresis data base as a reference to investigate the proteome of Jurkat T cells that had been induced to undergo apoptosis. 37 apoptosis-modified spots of 21 different proteins were identified. Interestingly, 15 of these proteins contain an RNA-binding motif (33Siomi H. Dreyfuss G. Curr. Opin. Genet. Dev. 1997; 7: 345-353Crossref PubMed Scopus (232) Google Scholar), and 12 are involved in the splicing process. The Jurkat T cell line E6 was maintained in RPMI tissue culture medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum (Life Technologies) and penicillin (100 units/ml)/streptomycin (100 µg/ml) (Life Technologies) at 37 °C in 5.0% CO2. Apoptosis was induced in 2 × 106 Jurkat T cells for 6 h at 37 °C in 5.0% CO2 by 250 ng/ml αCD95 (clone CH11) (Immunotech, Marseille, France). 1 µg/ml cycloheximide was added to the control- and the Fas-induced cells. Approximately 1 × 108 Jurkat T cells were centrifuged for 10 min at 1300 units/min at room temperature in a Megafuge 1.0R (Heraeus Instruments GmbH, Hanau, Germany). The supernatant was discarded, and the pellet was washed twice with 10 ml of phosphate-buffered saline (Life Technologies) and once with MB buffer (400 mmsucrose, 50 mm Tris, 1 mm EGTA, 5 mm 2-mercaptoethanol, 10 mm potassium hydrogen phosphate, pH 7.6, and 0.2% BSA) and centrifuged as above. The pellet was suspended in MB buffer (4 ml/108 cells) and incubated on ice for 20 min. Subsequently, the cells were homogenized and centrifuged at 3500 units/min for 1 min at 4 °C (Rotor SS-34; Sorvall RC5B, Hanau, Germany). The supernatant contained the mitochondria/cytosol/membranes, and the pellet enclosed the nucleus. The mitochondrial fraction was pelleted by centrifugation at 8600 units/min for 10 min at 4 °C (Rotor SS-34; Sorvall RC5B). The supernatant contained the cytosol and membranes. The pellet was suspended in MSM buffer (10 mmpotassium hydrogen phosphate, pH 7.2, 0.3 mm mannitol, and 0.1% BSA) (0.4 ml/108 cells) and purified by sucrose gradient centrifugation in 10 ml of SA buffer (1.6 msucrose, 10 mm potassium hydrogen phosphate, pH 7.5, and 0.1% BSA) and 10 ml of SB buffer (1.2 m sucrose, 10 mm potassium hydrogen phosphate, pH 7.5, and 0.1% BSA) at 20,000 units/min for 1 h at 4 °C (Rotor SW-28; Beckman L8–70M Ultracentrifuge, München, Germany). The interphase that contained the mitochondria was collected, suspended in 4 volumes of MSM buffer, and centrifuged again at 15,500 units/min for 10 min at 4 °C (Rotor SS-34; Sorvall RC5B). The pellet was suspended in MSM buffer without BSA and could be stored at −70 °C. The supernatant with the cytosol and membrane was centrifuged at 100,000 units/min for 20 min at 4 °C (Rotor TLA120.2 rotor, Ultracentrifuge Optima TLX, Beckman, München, Germany). The pellet contained the membrane. The pellet with the nucleus was suspended in 5 ml of phosphate-buffered saline and centrifuged for 2 min at 3500 units/min at 4 °C (Rotor SS-34; Sorvall RC5B). The pellet was suspended in NB buffer (10 mm Hepes, pH 7.4, 10 mm KCl, 2 mmMgCl2, 1 mm dithiothreitol, and 1 mm pefabloc) (1 ml/108 cells) and incubated for 1 h on ice, subsequently homogenized, and applied to 10 ml of 30% sucrose in NB buffer. After the centrifugation with the Megafuge 1.0R (Heraeus Instruments) at 2000 units/min for 10 min at 4 °C, the pellet was washed twice with 6 ml of NB buffer, centrifuged as above, suspended in 1 ml of NB buffer, and centrifuged again at 10,000 units/min for 10 min at 4 °C (Rotor SS-34; Sorvall RC5B). The pellet could be stored at −70 °C. The proteins were separated by a large gel two-dimensional gel electrophoresis technique (gel size was 30 × 23 cm) and stained as previously described (32Thiede B. Siejak F. Dimmler C. Jungblut P. Rudel T. Electrophoresis. 2000; 21: 2713-2720Crossref PubMed Scopus (37) Google Scholar). Briefly, isoelectric focusing rod gels were used for the first dimension with a diameter of 0.9 mm for analytical gels and 2.5 mm for preparative gels. SDS-polyacrylamide gels with 15% (w/v) acrylamide and 0.2% bisacrylamide were used for the second dimension (34Klose J. Kobalz U. Electrophoresis. 1995; 16: 1034-1059Crossref PubMed Scopus (631) Google Scholar). Preparative gels were stained with Coomassie Brilliant Blue R-250 or G-250 (Serva, Heidelberg, Germany). Analytical gels were stained with silver nitrate (35Heukeshoven J. Dernick R. Electrophoresis. 1985; 6: 103-112Crossref Scopus (1242) Google Scholar;36Jungblut P.R. Seifert R. J. Biochem. Biophys. Methods. 1990; 21: 47-58Crossref PubMed Scopus (130) Google Scholar). The Coomassie Blue-stained single gel spots from Jurkat T cells were excised with a scalpel for in-gel digestion with 0.1 µg of trypsin (Promega, Madison, WI) in 20 µl of 50 mm ammonium bicarbonate, pH 7.8. The samples were dissolved in 1 µl of 0.5% aqueous trifluoroacetic acid/acetonitrile (2:1) for the mass spectrometric analysis. The mass spectra were recorded by using a time-of-flight delayed extraction MALDI mass spectrometer (Voyager-Elite, Perseptive Biosystems, Framingham, MA). 20 mg/ml α-cyano-4-hydroxycinnamic acid in 0.3% aqueous trifluoroacetic acid/acetonitrile (1:1) or 50 mg/ml 2,5-dihydroxybenzoic acid in 0.3% aqueous trifluoroacetic acid/acetonitrile (2:1) was used as matrix. The samples were applied to a gold-plated sample holder and introduced into the mass spectrometer after drying. The spectra were obtained in the reflectron mode by summing 70–200 laser shots. The proteins were identified by using the peptide mass fingerprinting analysis software MS-Fit (available on the World Wide Web). The NCBI and SwissProt data bases with the species human and mouse were used for the searches by considering at maximum one missed cleavage site, pyro-Glu formation at the N-terminal Gln, oxidation of methionine, acetylation of the N terminus, and modification of cysteines by acrylamide. The molecular masses and isoelectric points were calculated by employing the software Compute pI/Mw (available on the World Wide Web). The protein sequences were analyzed by searching the Pfam HMM data base (available on the World Wide Web) to identify sequence motifs. The cDNAs were cloned by a combination of reverse transcription and polymerase chain reaction techniques. Reverse transcription was performed on poly(A)+ RNA from the human Jurkat T cell line using oligo(dT) primer. The reverse transcription products were then used as templates for PCR using specific primers according to the di-/trinucleotide sticky end cloning method (Roche Molecular Biochemicals). Primer sequences were as follows: hnRNP A2/B1, 5′-primer TCGAGAGAGAAAAGGAACAGTTC, 3′-primer CTGGTATCGGCTCCTCCCACCATAA; hnRNP R, 5′-primer TCGCTAATCAGGTGAATGGTAATG, 3′-primer CTGCTTCCACTGTTGCCCATAAGTA; p54nrb, 5′-primer TCGAGAGTAATAAAACTTTTAAC, 3′-primer CTGGTATCGGCGACGTTTGTTTGGG; splicing factor ASF-2, 5′-primer TCGGAGGTGGTGTGATTCGTGGC, 3′-primer CTGACACTTTAGCCCATTCTGAAC; splicing factor SRp30c, 5′-primer TCGCGGGCTGGGCGGACGAGCGC, 3′-primer CTGGTAGGGCCTGAAAGGAGAGAAG; transcription factor BTF, 5′-primer TCGGACGGACAGGCGCACCCGCT, 3′-primer CTGTCAGTTTGCCTCATTCTTGGAAGC. The PCR products were treated according to the di-/trinucleotide sticky end cloning method as described by the manufacturer (Roche Molecular Biochemicals) and then introduced into the pET28c vector (Calbiochem-Novabiochem). The cloned cDNAs were sequenced using T3 and T7 sequencing primers. The cDNAs were translated in vitro using 35S-labeled methionine with the TNT® coupled reticulocyte lysate system according to the manufacturer's instructions (Promega, Mannheim, Germany). 1 µl of the translation product was cleaved with 3 µl of active lysate or 20 units of caspase-3 (BIOMOL, Hamburg, Germany) in 20 µl of cleavage buffer (25 mm Hepes, pH 7.5, 1 mmdithiothreitol, 1 mm EDTA, and the protease inhibitors pefabloc, pepstatin, leupeptin, and aprotinin) for 1 h at 37 °C. For inhibition experiments, 1 µl of 5 mmZ-Val-Ala-dl-Asp-fluoromethylketone (zVAD-fmk) was added. The cleavage mixture was supplemented with 5 µl of loading buffer (1 µl of glycerol, 1 µl of 10% SDS, 0.25 µl of 2-mercaptoethanol, 0.075 mg of Tris-base, and 0.125 mg of bromphenol blue) and applied to a 10% SDS-polyacrylamide gel. After electrophoresis, the gel was washed, dried, and covered with a BioMaxTM MR film (Eastman Kodak Co.) overnight and then developed. Active lysate was generated from Jurkat T cells after a 6-h induction of apoptosis with 250 ng/ml αCD95 (clone CH11) (Immunotech, Marseille, France) and 1 µg/ml cycloheximide. Subsequently, the cells were washed with phosphate-buffered saline and incubated for 20 min on ice with lysis buffer (25 mm Hepes, 0.1% Chaps, 1 mm dithiothreitol, and the protease inhibitors pefabloc, pepstatin, leupeptin, and aprotinin). Afterward, the cells were homogenized and centrifuged for 5 min at 13,000 units/min (Biofuge fresco; Heraeus Instruments). The supernatant was aliquoted and stored at −70 °C. Apoptosis was induced in Jurkat T cells by treatment with an anti-Fas antibody for 6 h. Since apoptosis is induced in the absence of protein synthesis, cycloheximide was added to the cultures in order to block protein synthesis. Prevention of protein synthesis was a prerequisite to circumvent the induction of stress proteins that are not involved in the primary apoptotic process (17Gerner C. Fröhwein U. Gotzmann J. Bayer E. Gelbmann D. Bursch W. Schulte-Hermann R. J. Biol. Chem. 2000; 275: 39018-39026Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Two-dimensional gel electrophoresis gels were produced after lysis of the cells and separation of the proteins. A representative two-dimensional gel electrophoresis gel of anti-Fas-treated Jurkat T cells is shown in Fig.1. Approximately 2000 spots were resolved and detected by silver staining. 10 two-dimensional gel electrophoresis gels of apoptotic cells were compared with 10 two-dimensional gel electrophoresis gels of control cells (Fig.2). 24 spots were detected in patterns of apoptotic Jurkat T cells that were not present in patterns on nonapoptotic cells. 21 additional spots were observed in the pattern of control cells. Coomassie-stained two-dimensional gel electrophoresis gels were produced for the identification by mass spectrometry because the identification of proteins is not possible by the highly sensitive silver staining technique used. Only 27 of the 45 spots identified in silver-stained gels were detected in Coomassie-stained gels by comparing untreated and Fas-treated Jurkat T cells. Therefore, cytosol, mitochondria, nuclei, and membranes were purified from treated and untreated Jurkat T cells in order to enrich for the proteins that were not detected by Coomassie staining.Figure 2Two-dimensional gel electrophoresis gel of Jurkat T cells. Protein spots that were identified in patterns of untreated Jurkat T cells by mass spectrometry are indicated. The proteins were detected by silver staining.View Large Image Figure ViewerDownload Hi-res image Download (PPT) 21 proteins (TableI) were identified in 37 spots by peptide mass fingerprinting after in-gel digestion with trypsin, elution of the generated peptides, and analysis by MALDI-MS. Of the identified proteins, 60 S ribosomal protein P0, hnRNP A2/B1, hnRNP C1/C2, KH-type splicing regulatory protein, p54nrb, and Rho GDI 2 were found at different spot positions in treated and control cells, whereas the other proteins were identified either in treated or in control cells.Table IIdentified apoptosis-modified proteins in Jurkat T cellsProteinNCBIFasM rfoundM r theor.pI foundpI theor.RNA-binding motif60 S ribosomal protein P04506667−33,50034,2735.85.72+33,3006.1α NAC5031931+25,00023,3835.04.52+25,0005.2FUSE-binding protein4503801−65,20067,5347.77.214 KHhnRNP A08134660−35,60030,8419.99.342 RNPhnRNP A1133254+32,10038,8468.59.262 RNP32,1008.1hnRNP A2/B14504447/−36,40036,006/9.08.67/2 RNP133257+29,90037,4299.38.97hnRNP A31710627−39,40039,6869.58.742 RNPhnRNP C1/C21-aThis protein was identified in seven neighboring spots, and the average found M rand pI are displayed.4758544−36,30031,966/5.05.10/1 RNP+35,30033,2985.45.11hnRNP K631471−65,10051,0725.45.143 KHhnRNP R2697103+49,10070,9437.38.232 RNPKH-type splicing regulatory protein4504865−78,90073,1616.56.844 KH+72,0006.9Lamin B2547822−62,80059,0015.35.87−62,8005.4NS1-associated protein 15453806+54,10062,6566.16.863 RNPNucleolin4885511+18,10076,3445.24.594 RNPNucleophosmin114762−35,30032,5754.84.64p54nrb1895081−55,90054,2318.59.012 RNP+52,3008.1Poly(A)-binding protein 41229875−70,60070,7829.29.534 RNPRho GDI 21707893−23,10022,9885.15.10+22,3006.2+22,1006.2Splicing factor ASF-2105294−31,40031,9995.25.612 RNPSplicing factor SRp30c4506903+27,30025,5428.68.742 RNPTranscription factor BTF329507−19,00017,6997.76.85Indicated are the NCBI accession numbers; protein spots of apoptotic cells (+) and control cells (−), the M r found in the two-dimensional gel electrophoresis gel, and the theoretical (theor.) mass as well as the observed pI and the theoretical pI. Also specified are the numbers of RNA-binding motifs.1-a This protein was identified in seven neighboring spots, and the average found M rand pI are displayed. Open table in a new tab Indicated are the NCBI accession numbers; protein spots of apoptotic cells (+) and control cells (−), the M r found in the two-dimensional gel electrophoresis gel, and the theoretical (theor.) mass as well as the observed pI and the theoretical pI. Also specified are the numbers of RNA-binding motifs. The molecular mass of protein spots in two-dimensional gel electrophoresis gels can usually be determined with an accuracy of about 10%. As expected, the proteins identified in gels of control cells displayed the theoretical mass of the corresponding protein with the exception of hnRNP K. In contrast, five of the 12 proteins identified in gels of apoptotic cells, hnRNP A1, hnRNP A2/B1, hnRNP R, NS1-associated protein 1, and nucleolin, showed a significantly decreased mass of more than 10% compared with the theoretical values. The masses of the remaining seven proteins, 60 S ribosomal protein P0, α NAC, hnRNP C1/C2, KH-type splicing regulatory protein, p54nrb, Rho GDI 2, and SRp30c, corresponded approximately with the theoretical masses. Fortunately, five of these proteins, 60 S ribosomal protein P0, hnRNP C1/C2, KH-type splicing regulatory protein, p54nrb, and Rho GDI 2 were found in patterns of control cells and thus allowed the direct comparison of the masses under both conditions. Using this readout, these proteins were found to exhibit lower masses in the apoptotic pattern, suggesting a modification of these proteins. We then screened the identified proteins for functional motifs. Surprisingly, 12 proteins contained the RNP motif, and three contained the KH motif (Table I), which are involved in RNA binding and processing (37Burd C.G. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1731) Google Scholar). In order to either verify or determine the cleavage by caspases, the cDNAs of hnRNP A2/B1, hnRNP R, p54nrb, the splicing factor SRp30c, the splicing factor ASF-2, and the transcription factor BTF3 were cloned and expressed in vitro. The proteins were treated with either a lysate of apoptotic Jurkat T cells (not shown), which contained a mixture of active caspases, or with the recombinant purified caspase-3 in the presence or absence of the broad range caspase inhibitor zVAD-fmk (Fig.3). In most cases, the same cleavage pattern was observed for the proteins treated with the active lysate and caspase-3; however, the cleavage by caspase-3 was more efficient. Several bands were observed upon cleavage of p54nrb with caspase-3 (Fig. 3). This was unexpected, since we found only the 52-kDa fragment in apoptotic cells. Inhibition of caspase-3 with zVAD-fmk prevented the generation of all p54nrb fragments, indicating that these fragments were generated by caspase 3. Cleavage of the splicing factor ASF-2 and the transcription factor BTF3 generated two fragments, which probably corresponded to cleavage at one site (Fig.3). Since the latter factors were identified in control patterns only, cleavage by caspase-3 in vitro suggested that they were also processed in apoptotic cells. As expected from the two-dimensional gel electrophoresis results, cleavage of the splicing factor SRp30c by caspase-3 was not observed (Fig. 3). This indicated either a modification of SRp30c other than cleavage or that cleavage occurred very close to the N terminus of the protein, because the C-terminal end was identified by the mass spectrometrical analysis. The 49-kDa fragment detected in caspase-3 cleavage assays with hnRNP R (Fig. 3) confirmed the two-dimensional gel electrophoresis data. Only hnRNP A2/B1, which was fragmented in apoptotic cells, could neither be cleaved by the active lysate (not shown) nor by caspase-3 (Fig. 3). Therefore, cleavage of hnRNP A2/B1 by caspase-3 can be excluded due to the high efficiency of the enzyme. hnRNP A2/B1 might be cleaved by another protease in vivo, which is not active under the conditions used in the in vitro cleavage assay. The sites at which caspases cleaved the substrates can be calculated by taking into consideration that these enzymes cleave target proteins specifically after aspartic acids. Further parameters necessary for the prediction of cleavage sites were the sequence coverage of the peptide mass fingerprints, the difference of the theoretical and the detected molecular masses, and the pI values of the proteins that were identified in patterns of apoptotic cells. For the splicing factor ASF-2 and the transcription factor BTF, which were not found in patterns of apoptotic cells, the cleavage site could be predicted by means of the in vitro cleavage assay (Fig. 4, TableII).Table IIPrediction of cleavage sitesProteinSequence coverageStart-end amino acidsMasspIMass foundpI foundPutative cleavage sitekDakDa60 S ribosomal protein P011–2641–31033.36.5N33.5N5.8SDED1–30833.55.9P33.3P6.1EESD6–31733.65.9PREDhnRNP A115–1781–28830.58.4P32.1P8.5GSYD1–31432.98.4SYNDhnRNP A2/B1102–338/35037/49–341/35331.59.1/8.9N36.4N9.0KLTD44/56–341/35330.89.2P29.9P9.3VMRD64/76–341/35328.59.0/8.8AEVDhnRNP C1/C218–138/1511–285/29831.6/32.95.1N36.3N5.0DDRD1–283/29631.3/32.65.1P35.3P5.4GEDD1–282/29531.2/32.55.1/5.2EGED11–290/30330.9/32.25.1NKTDhnRNP R134–44167–47245.97.2P49.1P7.3RAID + DYYD88–48144.77.2KESD + DYHDKH-type splicing regulatory protein122–64673–71167.36.9N78.9N6.5IRKD77–71166.97.3P72.0P6.9AFAD92–71165.46.7IGGD103–71164.36.9STPD115–71162.96.9QLED117–71162.87.3EDGD129–71161.57.1SQGDNS1-associated protein 139–3811–46852.85.7P54.1P6.1DYYD1–46552.35.7GYED1–45951.55.9YPPDNucleolin458–624454–62819.45.0P18.1P5.2TEID + AMED454–63219.84.9TEID + GEIDp54nrb76–3361–42249.28.4N55.9N8.5MMPDP52.3P8.1Rho GDI 222–19622–19620.96.2N23.1P6.2DELDP22.1SF ASF-21–17619.3C19.4RKLD150–29217.0C17.3DLKD1–15616.9VYRD1–15216.4CYADSF SRp30c9–2217–22124.98.9P27.3P8.6GWADTF BTF31–17518.9C18.3QSVDThe putative cleavage sites for caspases were calculated by the theoretical masses of fragments generated by cleavage after aspartic acids. The difference between the theoretical mass and the observed mass was <10% and 0.5 for the pI. In addition, the sequences covered by the peptide mass fingerprinting were considered. P indicates the values of fragments derived from patterns of apoptotic cells, N from control patterns. C indicates that the found mass was determined by the cleavage assay with a mass accuracy of ±1 kDa. Splicing factor and transcription factor are abbreviated by SF and TF, respectively. Open table in a ne