Portal de Periódicos da CAPES

Activation of the 9E3/cCAF Chemokine by Phorbol Esters Occurs via Multiple Signal Transduction Pathways That Converge to MEK1/ERK2 and Activate the Elk1 Transcription Factor

1999; Elsevier BV; Volume: 274; Issue: 22 Linguagem: Inglês

10.1074/jbc.274.22.15454

1083-351X

QiJing Li, Sucheta M. Vaingankar, Harry M. Green, Manuela Martins‐Green,

Estrogen and related hormone effects

Using primary fibroblasts in culture, we have investigated the signal transduction mechanisms by which phorbol esters, a class of tumor promoters, activate the 9E3 gene and its chemokine product the chicken chemotactic and angiogenic factor. This gene is highly stimulated by phorbol 12,13-dibutyrate (PDBu) via three pathways: (i) a small contribution through protein kinase C (the commonly recognized pathway for these tumor promoters), (ii) a contribution involving tyrosine kinases, and (iii) a larger contribution via pathways that can be interrupted by dexamethasone. All three of these pathways converge into the mitogen-activated protein kinases, MEK1/ERK2. Using a luciferase reporter system, we show that although both the AP-1 and PDRIIkB (a NFκB-like factor in chickens) response elements are capable of activation in these normal cells, regions of the 9E3 promoter containing them are unresponsive to PDBu stimulation. In contrast, we show for the first time that activation by PDBu occurs through a segment of the promoter containing Elk1 response elements; deletion and mutation of these elements abrogates 9E3/chicken chemotactic and angiogenic factor expression. Electrophoretic mobility shift assays and functional studies using PathDetect systems show that stimulation of the cells by phorbol esters leads to activation of the Elk1 transcription factor, which binds to its element in the 9E3 promoter. Using primary fibroblasts in culture, we have investigated the signal transduction mechanisms by which phorbol esters, a class of tumor promoters, activate the 9E3 gene and its chemokine product the chicken chemotactic and angiogenic factor. This gene is highly stimulated by phorbol 12,13-dibutyrate (PDBu) via three pathways: (i) a small contribution through protein kinase C (the commonly recognized pathway for these tumor promoters), (ii) a contribution involving tyrosine kinases, and (iii) a larger contribution via pathways that can be interrupted by dexamethasone. All three of these pathways converge into the mitogen-activated protein kinases, MEK1/ERK2. Using a luciferase reporter system, we show that although both the AP-1 and PDRIIkB (a NFκB-like factor in chickens) response elements are capable of activation in these normal cells, regions of the 9E3 promoter containing them are unresponsive to PDBu stimulation. In contrast, we show for the first time that activation by PDBu occurs through a segment of the promoter containing Elk1 response elements; deletion and mutation of these elements abrogates 9E3/chicken chemotactic and angiogenic factor expression. Electrophoretic mobility shift assays and functional studies using PathDetect systems show that stimulation of the cells by phorbol esters leads to activation of the Elk1 transcription factor, which binds to its element in the 9E3 promoter. It has been known for some time that chemokines play important roles in leukocyte chemoattraction and inflammation (1Horuk R. Horuk R. Chemoattractant Ligands and Their Receptors. CRC Press, New York1996Google Scholar). More recently, however, it has become increasingly clear that these small cytokines are also involved in wound healing (2Martins-Green M. Hanafusa H. Cytokine Growth Factor Rev. 1997; 8: 221-232Crossref PubMed Scopus (30) Google Scholar), deterrence of retroviral infections (3Feng Y. Broder C.C. Kennedy P.E. Berger E.A. Science. 1996; 272: 872-877Crossref PubMed Scopus (3643) Google Scholar), and tumorigenesis (4Richmond A. Shattuck R.L. Horuk R. Chemoattractant Ligands and Their Receptors. CRC Press, New York1996: 87-124Google Scholar, 5Howard O.M.Z. Ben-Baruch A. Oppenheim J.J. Trends Biotechnol. 1996; 14: 46-51Abstract Full Text PDF PubMed Scopus (126) Google Scholar). In the latter case, chemokines can potentially act at several steps in the development of tumors, and their action is dependent not only on the stimulant but also on the environment. Tumors develop as a result of multiple insults and chemokines could play important roles in these events because a number of them are stimulated by phorbol esters, injury, and oncogenes (2Martins-Green M. Hanafusa H. Cytokine Growth Factor Rev. 1997; 8: 221-232Crossref PubMed Scopus (30) Google Scholar), all of which have been shown to be involved in tumor promotion. Agents that promote tumor development are called tumor promoters; they are not themselves carcinogenic but they promote the development of tumors in areas of the body that have been exposed to a carcinogen (6Kligman A.M. Kligman L.H. Cancer Lett. 1994; 87: 171-178Crossref PubMed Scopus (8) Google Scholar, 7Jenkins T.D. Nakagawa H. Rustgi A.K. J. Biol. Chem. 1997; 272: 24433-24442Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar). There is extensive literature that demonstrates that phorbol esters are very effective tumor promoters (8Iversen O.H. Crit. Rev. Oncog. 1995; 6: 357-405Crossref PubMed Scopus (17) Google Scholar, 9Xian W. Kiguchi K. Imamoto A. Rupp T. Zilberstein A. DiGiovanni J. Cell Growth Differ. 1995; 6: 1447-1455PubMed Google Scholar). Wounding is also a tumor promoter because it can cause cancer to develop at the edges of wounds inflicted in areas that have been exposed previously to a carcinogen (10Lacey M. Alpert S. Hanahan D. Nature. 1986; 322: 609-612Crossref PubMed Scopus (92) Google Scholar, 11Sieweke M.H. Stoker A.W. Bissell M.J. Cancer Res. 1989; 49: 6419-6424PubMed Google Scholar, 12DiGiovanni J. Bhatt T.S. Walker S.E. Carcinogenesis. 1993; 14: 319-321Crossref PubMed Scopus (17) Google Scholar, 13Martins-Green M. Boudreau N.M. Bissell J. Cancer Res. 1994; 54: 4334-4341PubMed Google Scholar, 14Sieweke M.H. Bissell M.J. Crit. Rev. Oncog. 1994; 5: 297-311Crossref PubMed Scopus (96) Google Scholar, 15Cannon R.E. Spalding J.W. Trempus C.S. Szczesniak C.J. Virgil K.M. Humble M.C. Tennant R.W. Mol. Carcinogen. 1997; 20: 108-114Crossref PubMed Scopus (47) Google Scholar). The v-src oncogene, which is the transforming protein of the Rous sarcoma virus (a retrovirus that causes tumors in chickens), also has been shown to be a tumor promoter (16Bissell M.J. Hatie C. Calvin M. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 348-352Crossref PubMed Scopus (31) Google Scholar). The 9E3 gene and its product, the chicken chemotactic and angiogenic factor (cCAF), 1The abbreviations used are: cCAF, chicken chemotactic and angiogenic factor; PKC, protein kinase C; PDBu, phorbol 12,13-dibutyrate; MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; CEF, chicken embryo fibroblasts; qc, quiescent confluent; PCR, polymerase chain reaction; bp, base pairs; EMSA, electrophoretic mobility shift assay; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; dbd, DNA binding domain; AD, activation domain; LPS, lipopolysaccharide, Luc, luciferase; AP1, activating protein 1 are stimulated to high levels by the v-src oncogene and also by phorbol esters and wounding/inflammation (17Sugano S. Stoeckle M.Y. Hanafusa H. Cell. 1987; 49: 321-328Abstract Full Text PDF PubMed Scopus (124) Google Scholar, 18Bedard P.-A. Alcorta D. Simmons D.L. Luk K.-C. Erikson R.L. Proc. Natl. Acad. Sci., U. S. A. 1987; 84: 6715-6719Crossref PubMed Scopus (87) Google Scholar, 19Martins-Green M. Bissell M.J. J. Cell Biol. 1990; 110: 581-595Crossref PubMed Scopus (33) Google Scholar, 20Barker K. Hanafusa H. Mol. Cell. Biol. 1990; 10: 3813-3817Crossref PubMed Scopus (12) Google Scholar, 21Martins-Green M. Aotaki-Keen A. Hjelmeland L. Bissell M.J. J. Cell Sci. 1992; 101: 701-707PubMed Google Scholar). Therefore, this chemokine can potentially be a mediator of the tumor-promoting action of these agents. In the case of v-src, during the development of Rous sarcoma virus-induced tumors the expression of the 9E3/cCAF occurs only in the cells of the tissues surrounding the tumor (19Martins-Green M. Bissell M.J. J. Cell Biol. 1990; 110: 581-595Crossref PubMed Scopus (33) Google Scholar, 21Martins-Green M. Aotaki-Keen A. Hjelmeland L. Bissell M.J. J. Cell Sci. 1992; 101: 701-707PubMed Google Scholar). At later stages of tumor growth, when 9E3/cCAF are expressed abundantly, numerous new blood vessels develop in the area (2Martins-Green M. Hanafusa H. Cytokine Growth Factor Rev. 1997; 8: 221-232Crossref PubMed Scopus (30) Google Scholar, 19Martins-Green M. Bissell M.J. J. Cell Biol. 1990; 110: 581-595Crossref PubMed Scopus (33) Google Scholar, 21Martins-Green M. Aotaki-Keen A. Hjelmeland L. Bissell M.J. J. Cell Sci. 1992; 101: 701-707PubMed Google Scholar). Because cCAF is angiogenic (22Martins-Green M. Feugate J.E. Cytokine. 1998; 8: 522-535Crossref Scopus (56) Google Scholar, 23Martins-Green M. Kelly T. Cytokine. 1998; 8: 819-829Crossref Scopus (22) Google Scholar) and angiogenesis is very important for tumor growth, it is possible that this chemokine is a mediator of the tumor-promoting actions of the v-src oncogene. In the case of wounding, we have shown that after injury the 9E3gene is highly expressed shortly after injury and in the granulation (repair) tissue during wound healing (19Martins-Green M. Bissell M.J. J. Cell Biol. 1990; 110: 581-595Crossref PubMed Scopus (33) Google Scholar, 21Martins-Green M. Aotaki-Keen A. Hjelmeland L. Bissell M.J. J. Cell Sci. 1992; 101: 701-707PubMed Google Scholar). The persistent expression of 9E3/cCAF during the healing process coupled with its angiogenic properties in tissues that have been exposed to a carcinogen could mediate the tumor promotion stimulated by wounding. The stimulation of 9E3/cCAF to high levels by phorbol esters, again coupled to its angiogenic properties, can potentially mediate the tumor-promoting actions of these molecules. Until recently, it was believed that gene activation by phorbol esters always involves PKCs (24Nishizuka Y. FASEB J. 1995; 9: 484-496Crossref PubMed Scopus (2368) Google Scholar). PKCs are a family of serine and threonine kinases that contain structural motifs with a high degree of sequence homology. Most PKC isoenzymes have a conserved cysteine-rich (C1) domain at the N terminus of the regulatory domain (25Newton A.C. Current Biol. 1995; 5: 973-976Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). The C1 domain is involved in binding to diacylglycerol or its potent functional analogues, the phorbol esters, resulting in the translocation of the enzyme to the plasma membrane. The binding also causes a conformational change in PKC that removes the pseudo substrate domain from the active site, allowing substrate binding and catalysis (26Jaken S. Curr. Opin. Cell Biol. 1995; 8: 168-173Crossref Scopus (407) Google Scholar). However, several receptors of phorbol esters that are not PKCs now have been identified (25Newton A.C. Current Biol. 1995; 5: 973-976Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). Examples are n-chimaerin (27Hall C. Monfries C. Smith P. Lim H.H. Kozma R. Ahmed S. Vanniasingham V. Leung T. Lim L. J. Mol. Biol. 1990; 211: 11-16Crossref PubMed Scopus (123) Google Scholar), Unc-13 (28Maruyama I.N. Brenner S. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 5729-5733Crossref PubMed Scopus (195) Google Scholar), Vav (29Gulbins E. Coggeshall K.M. Baier G. Telford D. Langlet C. Baier-Bitterlich G. Bonnefoy-Berard N. Burn P. Wittinghofer A. Altman A. Mol. Cell. Biol. 1994; 14: 4749-4758Crossref PubMed Scopus (124) Google Scholar), cathepsin-L (30Atkins K.B. Troen B.R. Cell Growth Differ. 1995; 6: 713-718PubMed Google Scholar), and protein kinase D (31Van Lint J.V. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 1995; 270: 1455-1461Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). Thus it is clear that not all of the cellular effects of phorbol esters are mediated via PKC. As a consequence, it is important to delineate the signal transduction pathways by which chemokines are turned on by these agents so that crucial steps in the activation process can be identified and potentially used as targets for regulation of these genes. We have investigated the pathway of activation of 9E3/cCAF by phorbol esters such as phorbol 12-myristate 13-acetate and phorbol 12,13-dibutyrate (PDBu) in primary fibroblasts, the cells that most highly express 9E3/cCAF in vivo. The work presented here shows that activation of this chemokine by phorbol esters involves multiple signaling pathways that culminate in phosphorylation and activation of the MAP kinase ERK2 followed by activation of the transcription factor Elk1, leading to9E3/cCAF expression. The dosages used for particular experiments are indicated in the text or in the figure captions. Bovine thrombin (Sigma) was reconstituted in water and used at 9 units/ml. Calphostin C (100–200 nm), genistein (15–25 μm), H-7 di-HCL (100–200 nm), tyrphostin AG1478 (5–500 nm), and PD98059 (10 μm) were all purchased from Calbiochem and reconstituted in Me2SO. Phorbol-12,13-dibutyrate and 4α-phorbol-12,13-dibutyrate (Biomol) were dissolved in Me2SO and used at 5–100 nm. Anti-phosphotyrosine PY20 (Transduction Laboratories) and 4G10 (Upstate Biotechnology Inc.) were used for the phosphotyrosine immunoblots. ECL reagents and secondary antibodies were conjugated to horseradish peroxidase (Amersham Pharmacia Biotech). For each inhibitor or activator, a range of doses was tested to determine the optimal dose for the study in question. The Bradford assay was performed using the DC protein assay kit (Bio-Rad). Primary cultures of chicken embryo fibroblasts (CEFs) were prepared from 10-day-old chicken embryos as described previously (32Bissell M.J. Farson D. Tung A.S-C. J. Supramol. Struct. 1977; 6: 1-12Crossref PubMed Scopus (44) Google Scholar). On the fourth day, secondary cultures were prepared by trypsinizing and plating the primary cells in 199 medium containing 0.3% tryptose phosphate broth and 2% donor calf serum at a density of 1.2 × 106/60-mm dish. To study the effects of phorbol esters, 12-O-tetradecanoylphorbol-13-acetate, PMA, or PDBu on 9E3 expression and cCAF production, we used quiescent confluent CEF (qcCEF) cultures and incubated them in serum-free 199 medium containing the specific treatment for varying times (see “Results” for specifics). In general, prior to the addition of the specific activator cells were incubated in serum-free 199 medium containing the appropriate inhibitor for 30 min; incubation at 37 °C was continued for 1 h more before removing the medium and replacing it with fresh serum-free medium containing again the specific inhibitor under study. At the end of the incubation period the supernatant was collected and processed as described earlier (33Vaingankar S.M. Martins-Green M. J. Biol. Chem. 1998; 273: 5226-5234Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Pretreatment with phorbol esters to down-regulate PKC activity in the cells was performed for 18–24 h and then removed and replaced with medium containing the appropriate treatment for 18 h when evaluating cCAF levels. In the cases where the cell extracts were analyzed for activation of the ERKs, the cells were pretreated with the PDBu for 24 h, the inhibitor of MEK1/ERK (PD98059) for 1 h, and then the activator, PDBu, at 5 mm for 5 min. Because qcCEFs are primary cells rather than a cell line, there are small variations in the basal levels of 9E3/cCAF expression from batch to batch of cells. Therefore, for each experiment and/or treatment of a different batch of cells, we used positive (treated cells) and negative (untreated cells) controls. Volumes of the cell culture supernatant corresponding to equal amounts of protein in the cell extracts were loaded on 20% polyacrylamide-glycerol gels and electrophoresed at 16–32 mA for about 3 h. The concentration of the protein was determined using the Bio-Rad DC protein kit. Transfer was performed using a semi-dry transfer apparatus (Millipore). The efficiency and consistency of the transfer was monitored by silver-staining the gel after the transfer. The 9E3 protein was detected using polyclonal antibodies raised in rabbit (34Martins-Green M. Stoeckle M. Hampe A. Wimberly S. Hanafusa H. Cytokine. 1996; 8: 448-459Crossref PubMed Scopus (17) Google Scholar) and enhanced chemiluminescence (ECL) reagents (Amersham Pharmacia Biotech). CEFs were homogenized and total RNA was prepared using triZOL reagent (Life Technologies, Inc.). RNA samples (10 μg/ml) were denatured in a formamide-formaldehyde buffer containing ethidium bromide and separated on formaldehyde-agarose gel. After electrophoresis, the RNA was transferred to MagnaGraph nylon membranes (MSI Inc.), which were photographed to visualize the quality of the rRNA and confirm equal loading and even transfer. The RNA was UV-cross-linked to the membrane for 2 min and baked at 80 °C for 2 h. Prehybridization was performed for 6–9 h, and hybridization with a cDNA probe was carried out for 24 h (33Vaingankar S.M. Martins-Green M. J. Biol. Chem. 1998; 273: 5226-5234Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Cell extracts were prepared by lysing the cells in boiling 2× Laemmli buffer (containing 100 μm sodium orthovanadate) and shearing by passing through a 26-gauge needle 10 times followed by boiling in a water bath for 5 min. The samples were electrophoresed on a 7.5% SDS-polyacrylamide gel and transferred to the nitrocellulose membrane (Schleicher & Schuell) using a wet-transfer system (Bio-Rad) and Towbin's buffer (25 mm Tris, pH 8.3, 192 mmglycine, 0.05% SDS, 2% methanol) for 13 h at 30 V or 5 h at 60 V at 4 °C. The blots were blocked for 2 h at 37 °C in TBS (25 mm Tris, pH 7.5, 2.7 mm KCl, 137 mm NaCl) containing 0.1% Tween 20, 2% bovine serum albumin, and 0.02% thimerosal (TBST-BSA) and then incubated with the anti-phosphotyrosine antibodies (PY20 at 1:2500, 4G10 at 1:1000 dilutions) in TBST containing 2% bovine serum albumin for 2 h at 37 °C. The excess antibodies were washed three times for 5 min each plus a longer 20 min wash with TBST. A second blocking step was done for 1 h with TBST containing 5% nonfat milk. This was followed by incubation with the appropriate secondary antibodies conjugated to horseradish peroxidase (1:5000) for 1 h at room temperature. The washings were performed as described for the primary antibodies. The antibody detection was done using ECL reagents (Amersham Pharmacia Biotech). For reprobing of the blots, the membranes were stripped by incubation in stripping buffer (100 mm 2-mercaptoethanol, 2% SDS, and 62.5 mm Tris-HCl, pH 6.7) at 50 °C for 30 min with gentle shaking and then washed (2× for 10 min each) with TBST, following which they were tested by ECL to ensure complete stripping of antibodies. Finally, the membranes were washed again with TBST (three times for 10 min) before proceeding with the reprobing. Microdensitometry analysis was performed by laser densitometric scanning in an LKB microdensitometer. Using PCR, we isolated a 1.5-kilobase pair DNA fragment from the immediate 5′-upstream region of the 9E3 gene (−1506 to +32). We used chicken genomic DNA as a template and two oligonucleotides (5′-primer, GGATGAATGGCATTTCAGTGCAC; 3′-primer, TCGACACTAGAGAGGACAGTCTCCT) for the PCR reactions that were performed under the following conditions: denaturing of the DNA at 94 °C for 5 min, 55 °C for ∼20 min to add, and then 94 °C for 40 s to ensure that the DNA was denatured before starting the annealing for 2 min at 55 °C and extension for 1.5 min at 72 °C. The 1.5-kilobase pair PCR product was then cloned using the AT cloning system pCR2.1 (Invitrogen) and sequenced with the UBI Sequenase kit using vector primers and internal primers. The sequence was confirmed to be correct by comparison with the published sequence (35Blobel G.A. Hanafusa H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1162-1166Crossref PubMed Scopus (20) Google Scholar). The 1.5-kilobase pair9E3 promoter region was subcloned into pSL1180 (Amersham Pharmacia Biotech) using the SacI and EcoRV and then subcloned into the pGL3 basic vector (Promega) usingXhoI and BglII. Using this vector we obtained constructs with −66 to +32 bp, −218 to +32 bp, −470 to +32bp, and −683 to +32 bp fragments upstream from the initiation site with restriction enzyme digests and religations. We created the −493 Elk1 binding element mutant (pmElk1) by PCR-based methods. 5′-primer ATacGcgTGCTTTTAATACTGCACCCT was used to substitute the Elk1-conserved binding element (underlined; original sequence, CAGGAT). The controls for this mutated promoter, −542 to +32 bp and −495 to +32 bp, were also obtained using PCR and the appropriate oligonucleotides. The PCR products were cloned into the PCR2.1 vector and sequenced to verify accuracy.KpnI/EcoRV (on pCR2.1) andKpnI/SmaI (on pGL3 basic) were used for further reporter construction. The reporter vector with the mutated AP-1 binding site (−114 to −107) was prepared directly from the p683 construct with the Quickchange site-directed mutagenesis kit (Stratagene). TGACTCAT was changed into gGcCTtAT, and the mutation was verified by endonuclease digestion (additional HaeIII site introduced by mutagenesis) and confirmed by sequencing. All the pGL3/9E3 promoter subclones were transformed into DH5αEscherichia coli (Life Technologies, Inc.) and prepared using the endotoxin-free Maxiprep kit (Qiagen). qcCEFs were transiently transfected with 6 μg of DNA (4 μg of pGL3/9E3P subclone DNA cotransfected with 2 μg of PCH110 vector (Amersham Pharmacia Biotech) containing Lac-Z as internal transfection control) for each 35-mm dish using Ca2PO4-mediated methods without glycerol shock. All the reporter constructs were transfected and assayed in the same batch of cells. The transfected qcCEFs were incubated in modified 199 medium for 36 h at 37 °C, 5% CO2 (24Nishizuka Y. FASEB J. 1995; 9: 484-496Crossref PubMed Scopus (2368) Google Scholar). Then cells were stimulated with PDBu or LPS for 3 h prior to lysis. For the inhibitor experiments, the qcCEFs were incubated with inhibitors for 30 min before PDBu stimulation. Cell extracts were prepared with reporter lysis buffer according to the protocol provided by the manufacturer (Promega) and stored in a −70 °C freezer. Cell extracts were assayed using a Luminometer with an automated injection device (Monolight 2010, Analytical Luminescence Laboratory). The reaction substrate and buffer are parts of the luciferase assay system (Promega). Aliquoted samples were used for the β-galactosidase assay according to the procedure for the β-galactosidase enzyme assay system (Promega). A minimum of triplicates for each experiment was performed, and the data were expressed as mean light units of luminescence/unit of β-galactosidase activity. We used a cis-PathDetect system for AP-1 and a trans-PathDetect system for the Elk1. These systems were purchased from Promega, and we followed the protocols described by the company with the exception that we used our modified Ca2PO4 precipitation method for cell transfections that we have optimized in our system for lower stress-induced background, rather than transfections with Lipofectin as recommended in the procedure. Cells were treated as described earlier and nuclear extracts were prepared as described previously (36Jiang G. Nepomuceno L. Hopkins K. Sladek F.M. Mol. Cell. Biol. 1995; 15: 5131-5143Crossref PubMed Scopus (174) Google Scholar). Protein concentration was determined with the DC protein assay kit (Bio-Rad). 10 μg of extracted nuclear protein was used for each binding reaction with 2 ng of [γ-32P]ATP-labeled probe containing the conserved Elk-1 binding element (wild type, ATCAGGATGCTTTTAATACTGCACC CT (bold indicates the binding site for the Elk1 transcription factor)) in EMSA buffer (188 mm NaCl, 50 mmHEPES, pH 7.9, 2.5 mm EDTA, pH 8.0, 2.5 mmdithiothreitol, and 20% glycerol). 30 ng of unlabeled probe was used for the competition assay, and 1 μl of anti-Phorpho Elk1(Ser-383) antibody (NE Biolab) was added for the supershift assay. Samples were assayed in 6% nondenaturing polyacrylamide gel electrophoresis. qcCEFs do not express the 9E3/cCAF or they express it at very low levels. However, upon stimulation with PDBu, the levels of the 9E3mRNA increase dramatically. The rise in mRNA is first seen at 7 min, and it peaks at 3–6 h and declines thereafter (Fig.1 A). cCAF production after stimulation by PDBu shows that the protein accumulates in the culture supernatant (Fig. 1 B). Accumulation is dose-dependent (Fig. 1 C) and is specific; the Me2SO used as solvent for PDBu did not significantly stimulate 9E3/cCAF (Fig. 1, D andE). It has been considered for a long time that phorbol esters exert their effects on cells primarily through the activation of PKC isoforms that contain the cysteine-rich (C1) domain to which phorbol esters bind (37Puceat M. Vassort G. Mol. Cell. Biochem. 1996; 157: 65-72Crossref PubMed Google Scholar). Therefore, we investigated the possibility that stimulation of9E3/cCAF by phorbol esters occurs via activation of these classical PKCs. We treated cells with PDBu for 24 h to down-regulate total PKC activity by causing proteolytic degradation of these kinases (38Fournier A. Hardy S.J. Clark K.J. Murray A.W. Biochem. Biophys. Res. Commun. 1989; 161: 556-561Crossref PubMed Scopus (21) Google Scholar, 39Sanders J.L. Stern P.H. J. Bone Miner. Res. 1996; 11: 1862-1872Crossref PubMed Scopus (56) Google Scholar, 40Gatti A. Robinson P.J. Eur. J. Biochem. 1997; 249: 92-97Crossref PubMed Scopus (14) Google Scholar) followed by restimulation with PDBu. The result was only moderately reduced expression compared with that stimulated by PDBu without pretreatment (Fig.2 A). These observations suggest that activation of PKC represents only part of the stimulation of the 9E3/cCAF by phorbol esters. These results were confirmed by treatment of cells with calphostin C, a specific inhibitor of PKC that competes with phorbol esters for the binding of the C1 domain in the regulatory region of PKC, and we found that9E3 expression and production of cCAF were minimally blocked by this inhibitor (Fig. 2, B and C). Similar results were obtained when the cells were treated with H7 dihydrochloride, a broad spectrum inhibitor of Ser/Thr kinases that also inhibits PKC (Fig. 2, B and C). None of these inhibitors by themselves cause stimulation of 9E3/cCAF (33Vaingankar S.M. Martins-Green M. J. Biol. Chem. 1998; 273: 5226-5234Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). In addition, we also found that the 4α-isomer of PDBu (4α-PDBu), which does not activate PKC (41Blumberg P.M. CRC Crit. Rev. Toxicol. 1980; 8: 153-197Crossref Scopus (385) Google Scholar), stimulates9E3 expression and cCAF production almost as efficiently as PDBu (Fig. 3, A andB). This stimulation, much like that by PDBu, is time- (Fig.3 C) and dose- (not shown) dependent, albeit not as efficient as the stimulation by PDBu. These results taken together strongly suggest that 9E3/cCAF stimulation by phorbol esters occurs primarily via PKC-independent pathway(s).Figure 3Effects of the biologically inert isomer of PDBu , 4α-PDBu, on cCAF production. A, Northern blot analysis using a full-length cDNA probe for 9E3 and immunoblot with a polyclonal antibody to cCAF (B) show that 4α-PDBu (PdiBt) (100 nm) stimulated the expression of 9E3/cCAF, although at lower levels than PDBu. C, the effect is time-dependent. DMSO, Me2SO.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To investigate the possibility that the pathway of activation of9E3/cCAF by phorbol esters involves tyrosine kinase activation, as it does for stimulation by thrombin (33Vaingankar S.M. Martins-Green M. J. Biol. Chem. 1998; 273: 5226-5234Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar), we used inhibitors of tyrosine kinases. Herbymicin, an inhibitor of the c-src family of tyrosine kinases, had no inhibitory effect on the PDBu stimulation of 9E3/cCAF (not shown). Similarly, tyrphostin, a selective inhibitor for the epidermal growth factor receptor tyrosine kinase, had essentially no effect on PDBu stimulation of this gene (Fig. 4 A), whereas the broad spectrum tyrosine kinase inhibitor genistein produced a distinct decrease in the stimulation of 9E3/cCAF. The same results were observed for cCAF protein levels (not shown). The inhibition of cCAF production when the cells were treated with calphostin C (inhibitor of PKC) and genistein (inhibitor of tyrosine kinases) was additive, but significant cCAF stimulation by PDBu remained (Fig. 4, B and C), suggesting yet other pathways of stimulation for this gene by PDBu. It has been known for some time that expression of chemokine genes triggered by a variety of stimuli is inhibited by glucocorticoids (42Oppenheim J.J. Zachariae C.O.C. Mukaida N. Matsushima K. Annu. Rev. Immunol. 1991; 9: 617-648Crossref PubMed Scopus (1831) Google Scholar, 43Mukaida N. Matsushima K. Cytokine. 1992; 4: 41-53Google Scholar, 44Mukaida N. Morita M. Ishikawa Y. Rice N. Okamoto S. Kasahara T. Matsushima K. J. Biol. Chem. 1994; 269: 13289-13295Abstract Full Text PDF PubMed Google Scholar, 45Ohtsuka T. Kubota A. Hirano T. Watanabe K. Yoshida H. Tsurufuji M. Iizuka Y. Konishi K. Tsurufuji S. J. Biol. Chem. 1996; 271: 1651-1659Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). In most cases tested, these anti-inflammatory agents activate the glucocorticoid receptor that, in turn, interacts with and inactivates transcription factors that are important in chemokine gene expression (46Baldwin Jr., A.S. Annu. Rev. Immunol. 1996; 14: 649-683Crossref PubMed Scopus (5592) Google Scholar). Dexamethasone is an example of an anti-inflammatory glucocorticoid that inhibits chemokine gene activation (44Mukaida N. Morita M. Ishikawa Y. Rice N. Okamoto S. Kasahara T.