A Calmodulin-binding/CGCG Box DNA-binding Protein Family Involved in Multiple Signaling Pathways in Plants
2002; Elsevier BV; Volume: 277; Issue: 47 Linguagem: Inglês
10.1074/jbc.m207941200
ISSN1083-351X
Autores Tópico(s)Postharvest Quality and Shelf Life Management
ResumoWe reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467–38473). Here we demonstrate that there is oneNtER1 homolog as well as five related genes inArabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H2O2, and salicylic acid. Hence, they were designated as AtSR1–6 (A rabidopsisthaliana signal-responsive genes). Ca2+/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic α-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants. We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467–38473). Here we demonstrate that there is oneNtER1 homolog as well as five related genes inArabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H2O2, and salicylic acid. Hence, they were designated as AtSR1–6 (A rabidopsisthaliana signal-responsive genes). Ca2+/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic α-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants. Plants are constantly exposed to a variety of adverse environmental conditions such as temperature extremes, UV light, salt, and pathogen attacks. Thus, plants have to endure these stresses by modulating the expression of specific genes. Regulated gene expression is one of the most complex activities in cells. It involves many transcription factors that contribute to the basal transcription machinery or mediate gene regulation in response to developmental, environmental, or metabolic cues. Based on data from theArabidopsis genome project, it was predicted that there would be more than 1709 transcription factor genes (about 6.7% of total 25,498 genes) that encode proteins with significant similarity to known classes of plant transcription factors classified by conserved DNA-binding domains. However, less than 10% of these factors have been genetically characterized (1Arabidopsis Nature. 2000; 408: 823-826Google Scholar). Accumulating evidence indicates that Ca2+-mediated signaling is involved in the transduction of physical signals such as temperature, wind, touch, light, and gravity; oxidative signals such as those arising from pathogen attacks; and hormone signals such as ethylene, abscisic acid (ABA), 1The abbreviations used are: ABA, abscisic acid; CaM, calmodulin; MCP, 1-methylcyclopropene; SA, salicylic acid; GFP, green fluorescent protein; RT, reverse transcriptase; oligo, oligonucleotide; SF, subfamilies; MJ, methyl jasmonate. gibberellins, and auxin (2Bush D.S. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1995; 46: 95-122Google Scholar, 3Trewavas A.J. Malho R. Plant Cell. 1997; 9: 1181-1195Google Scholar, 4Bowler C. Fluhr R. Trends Plant Sci. 2000; 5: 241-246Google Scholar, 5Zhu J.K. Curr. Opin. Plant Biol. 2001; 4: 401-406Google Scholar, 6Evans N.H. McAinsh M.R. Hetherington A.M. Curr. Opin. Plant Biol. 2001; 4: 415-420Google Scholar, 7Poovaiah B.W. Yang T. Reddy A.S.N. Waisel Y. Kafkafi U. Eshel A. Plant Roots: The Hidden Half. 3rd Ed. Marcel Dekker Inc., New York2002: 505-520Google Scholar). All these signals have been shown to trigger changes in amplitude or oscillation in cytosolic free Ca2+ level. Recently, the signal-induced nuclear free calcium changes were also observed (8Pauly N. Knight M.R. Thuleau P. van der Luit A.H. Moreau M. Trewavas A.J. Ranjeva R. Mazars C. Nature. 2000; 405: 754-755Google Scholar). Free Ca2+ changes are sensed by a number of Ca2+-binding proteins that usually contain a common structural motif, the “EF-hand,” a helix-loop-helix structure (9Natalie C. Strynadaka J. Jams M.N.G. Annu. Rev. Biochem. 1989; 58: 951-958Google Scholar). One of the best characterized Ca2+-binding proteins is calmodulin (CaM), a highly conserved and multifunctional regulatory protein in eukaryotes. Its regulatory activities are triggered by its ability to modulate the activity of a certain set of CaM-binding proteins after binding to Ca2+, and thereby generating physiological responses to various stimuli (10Poovaiah B.W. Reddy A.S.N. CRC Crit. Rev. Plant Sci. 1987; 6: 47-103Google Scholar, 11Roberts D.M. Harmon A.C. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1992; 43: 375-414Google Scholar, 12Poovaiah B.W. Reddy A.S.N. CRC Crit. Rev. Plant Sci. 1993; 12: 185-211Google Scholar, 13Zielinski R.E. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998; 49: 697-725Google Scholar, 14Reddy A.S. Plant Sci. 2001; 160: 381-404Google Scholar, 15Snedden W.A. Fromm H. New Phytol. 2001; 151: 35-66Google Scholar). The CaM-regulated basic helix-loop-helix family of transcription factors was reported in mammals, where CaM inhibits the protein-DNA interaction by competing with the DNA-binding domain in certain proteins (16Corneliussen B. Holm M. Waltersson Y. Onions J. Hallberg B. Thornell A. Grundstrom T. Nature. 1994; 368: 760-764Google Scholar). In plants, TGA3, a member of a family of basic leucine zipper transcription factors, showed the Ca2+/CaM enhanced-binding activities to C/G box (17Szymanski D.B. Liao B. Zielinski R.E. Plant Cell. 1996; 8: 1069-1077Google Scholar). However, the CaM-binding property of TGA3 was not defined. We cloned and characterized an early ethylene-responsive gene (NtER1) in tobacco that encodes for a CaM-binding protein (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar). Bouche et al. (19Bouche N. Scharlat A. Snedden W. Bouchez D. Fromm H. J. Biol. Chem. 2002; 277: 21851-21861Google Scholar) reported that a Brassica homolog BnCAMTA is a CaM-binding protein with nonspecific DNA-binding activity. They also showed that one of theArabidopsis homologs (AtCAMTA1) encodes a CaM-binding protein with a transcription activation domain. The Arabidopsis genome has one NtER1 homolog (AtSR1) and five related genes (AtSR2–6). Here we report that these six genes exhibit rapid and differential response to environmental stimuli such as UV, extreme temperatures, high salt concentration, and physical wounding; hormones such as ethylene and ABA; and signal elicitors such as methyl jasmonate (MJ), H2O2, and salicylic acid (SA). Furthermore, we demonstrate that calcium/CaM binds to a 23-mer peptide in all AtSRs that corresponds to the CaM-binding region of NtER1. We also show that AtSR1 targets the nucleus and has the specific binding activity to a novel DNA element (A/C/G)CGCG(G/T/C), referred to as “CGCG box.” Arabidopsis thaliana ecotype Columbia were grown in a 1:1 mixture of soil mix and vermiculite under a 14-h photoperiod/10-h dark at 20–22 °C in a greenhouse or growth room. The 3-week-old seedlings were subjected to various treatments. Temperature stress plants were incubated at 4 or 42 °C; physical wounding leaves were crushed using blunt forceps; UVB plants were exposed to two 15-watt UVB (280–320 nm) lamps (F15T8.UVB 15 watts; UVP Inc.) at a dose of 2 kJ/m2 after an irradiation period of 5 min; salt stress 200 mm NaCl was applied to soil; ethylene and MJ plants were placed in 4-liter sealed jars with 100 ppm C2H4 or 0.2 μmMJ, some plants were treated with 50 ppm MCP for 2 h prior to ethylene treatment; ABA, H2O2, and SA plants were sprayed with 100 μm ABA, 10 mmH2O2, or 400 μm SA in buffer (10 mm Tris-HCl, pH 7.2) with 1% Triton X-100, the control plants were sprayed with the buffer alone. All chemicals were purchased from Sigma. All the treatments were performed at room temperature except the temperature stress treatment. After each treatment, whole plants were collected and immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction. The 5′ end 488 bp of AtSR1 was cloned by PCR from an ArabidopsiscDNA ZAPII expression library using a gene-specific primer (AtSR1-P1, Table I) and T3 primer in the vector. The largest fragment was subcloned into pCR2.1 vector (Invitrogen) and sequenced from both sides. The full coding region ofAtSR1 was cloned by PCR from the library with two gene-specific primers (AtSR1-P2/P3) based on the 5′-cloning results (forward primer) and data base predicted cDNA sequence (reverse primer). The Pfu DNA polymerase (Invitrogen) was used for PCR amplification to maintain a high fidelity of amplification. The amplified fragment was subcloned into pET101 expression vector as described by the manufacturer (Invitrogen) and was sequenced from both sides.Table IOligonucleotide sequencesNameSequencesAtSR1-P1CCGGTTAAAAGAAGTAGAAACTCTAAtSR1-P2ATGGCGGAAGCAAGACGATTCAGAtSR1-P3GTGATTTAACTGGTCCACAAAGATGAAtSR1-P4ATGCAAAGGACTGAAGACGCGGCAtSR1-P5ATGGCGGAAGCAAGACGATTCAGAtSR1-P6ACTGGTCCACAAAGATGAGGAAtSR1-P7ATCCGGTTAAAAGAAGTAGAAACTCAtSR1-P8ATGCAAAGGACTGAAGACGCGGCAtSR1-AATGGCGGAAGCAAGACGATTCAGAtSR1-BATCAAACATAAAAACAGACCCACTTGAtSR2-AGAGTCAGAGAAAGTGATTCCCAGAGAtSR2-BATCAGTGTCATCCTGCCAATTAAAAtSR3-ACGTCCTTGTACATTACCGTGATACAAtSR3-BGCAGATTGGTTATTAAGATCGGTTGAtSR4-ACAGACACAGCCTTCTACTTTTGGTTAtSR4-BCCAAATAAGGCAAGATCAGTAGCATAtSR5-ACATACTCTTGTAAGCAAGCAACCAAtSR5-BGAAGAAACCGAGAATTCAAAAGACAAtSR6-AGGAACTCGTACTCAAGTTCGATCAAtSR6-BGGTTGGATGAGATTGTTGCTAATAtACT8-AATGAAGATTAAGGTCGTGGCAtACT8-BTCCGAGTTTGAAGAGGCTACOS-1CAGGGCTAGTGGATCCC-N30- GGGAGATCTGGAATTCGAOS-2TCGAATTCCAGATCTCCCOS-3CAGGGCTAGTGGATCCC Open table in a new tab The templates coding the N-terminal and C-terminal deletion mutants ofAtSR1 were produced by PCR amplification from the cDNA with AtSR1-specific primers cloned into the pET101 expression vector (Invitrogen). The primers (Table I) were AtSR1-P2/P1 for C-terminal deletion ΔC-(147–1032), and AtSR1-P4/P3 for ΔN-(1–146). ΔC was fused to the His6 tag in pET101 by C-terminal fusion, and ΔN was inserted to pET101 without fusion with the His6 tag. The nucleotide sequences of the cloned fragments derived by PCR amplification were determined from both sides. AtSR1 and deletion mutants were expressed inEscherichia coli strain BL21(DE3) pLysS. The recombinant AtSR1 and ΔN were extracted and purified with CaM-Sepharose column (Amersham Biosciences) essentially as described (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar), and the recombinant ΔC was purified with HisTrap column as described by manufacturer (Amersham Biosciences). The amount of protein was estimated by the method of Bradford using a protein assay kit (Bio-Rad). The proteins were separated by SDS-PAGE, electrotransfered onto polyvinylidene difluoride membrane (Millipore), and incubated with35S-labeled recombinant CaM with 0.1 mmCaCl2 or 0.5 mm EGTA as described (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar). The membrane was washed with 25 mm Tris-HCl, pH 7.5, and either 0.1 mm CaCl2 or 0.5 mm EGTA, or 0.5 mm MgCl2, and then exposed to x-ray film overnight. The synthetic peptides were prepared using an Applied Biosystems peptide synthesizer 431A in the Laboratory of Bioanalysis and Biotechnology, Washington State University. Samples containing 240 pmol (4 μg) of bovine CaM (Sigma) and differing amounts of purified synthetic peptides in 100 mm Tris-HCl, pH 7.2, and either 0.1 mmCaCl2 or 0.5 mm EGTA in a total volume of 30 μl were incubated for 1 h at room temperature. The samples were analyzed by nondenaturing PAGE as described (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar). The full-length AtSR1 or ΔC-(147–1032) or ΔN-(1–146) were amplified by PCR amplification withPfu DNA polymerase using the gene-specific primers listed in Table I. The primers were AtSR1-P5/6 for AtSR1, AtSR1-P5/7for ΔC, and AtSR1-P8/6 for ΔN. In the 5′ of each primer, an adaptor sequence of GTCTAGCGGATCC was added to create an artificialBamHI site. The 3′ was created in-frame fusion with the GFP reading frame. The amplified fragments were subcloned into the pBluescript KS vector, and the DNA was sequenced from both sides for verification. These plasmids were digested with BamHI and ligated with the BamHI-digested psmGFP, which has aBamHI site between cauliflower mosaic virus 35S promoter and GFP (20Davis S.J. Vierstra R.D. Plant Mol. Biol. 1998; 36: 521-528Google Scholar). psmGFP was used as a control. GFP expression was monitored by a transient assay using leaves of 3-week-oldArabidopsis seedlings. Plasmid DNA was introduced by particle bombardment using the method described by Christou (21Christou P. Methods Cell Biol. 1995; 50: 375-382Google Scholar). Seven-μm gold spheres were coated with plasmid DNA and accelerated by a 7-kV discharge toward the leaves placed on agar Petri plates. After bombardment, the leaves were kept in the dark for 24 h prior to confocal microscopic examination. The images were processed using a Bio-Rad MRC 1024 confocal laser scanning system with a Nikon microscope. The leaves were directly examined on a glass slide using argon laser (488 nm) for green fluorescence. Nuclear protein extracts were prepared from 3-week-old Arabidopsis plants after the wounding treatment for 4 h or control plants that grew in normal conditions. Nuclear proteins were extracted from harvested samples (30 g) following protocol described by Green et al. (22Green P.J. Kay S.A. Chua N.H. EMBO J. 1987; 18: 4689-4699Google Scholar). The nuclear proteins were further purified with CaM-Sepharose column (Amersham Biosciences) according to Yang and Poovaiah (23Yang T. Poovaiah B.W. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4097-4102Google Scholar). The purified nuclear proteins as well as the recombinant proteins were dialyzed and concentrated with Centricon YM-50 or YM-10 (Millipore) against a nuclear extraction buffer (25 mm HEPES/KOH, pH 7.5, 40 mm KCl, 0.1 mm EDTA, 10% glycerol, 1 mm dithiothreitol, and 30 μg/ml phenylmethylsulfonyl fluoride) at 4 °C before gel retardation assays. The oligo selection procedure was performed as described by Wang et al. (24Wang Z. Yang P. Fan B. Chen Z. Plant J. 1998; 16: 515-522Google Scholar). Briefly, a pool of double-stranded random oligo molecules was labeled by primed synthesis of the random oligo OS-1 using the OS-2 primer (Table I). The labeled probe was purified by 8% non-denaturing PAGE. After gel retardation assays, the retarded DNA was eluted and labeled by PCR amplification using the OS-3 primer (Table I). The amplified probe was purified by electrophoresis and used as a probe for the next round of selection with gel retardation assays. All other probes were labeled by primed synthesis of the synthesized oligos (containing an OS-2 complementary adaptor sequence in 3′) using the OS-2 primer. The labeled probes were purified by electrophoresis. DNA binding assays were performed in a 20-μl reaction mixture containing 25 mm HEPES/KOH, pH 7.5, 40 mm KCl, 0.1 mm EDTA, 10% glycerol, 1 mmdithiothreitol, 5 μg/ml antipain, and 5 μg/ml leupeptin, 5 μg of poly(dI-dC), 3 μg of recombinant proteins or 20 μg of nuclear proteins or 2 μg of CaM-binding nuclear proteins and 1–2 ng of labeled double-stranded DNA fragments (24Wang Z. Yang P. Fan B. Chen Z. Plant J. 1998; 16: 515-522Google Scholar). DNA-protein complexes were allowed to form at room temperature for 20 min and were separated on a 10% PAGE gel in 0.5× TBE at 4 °C. RNA isolation was performed as described previously by Yang and Poovaiah (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar). RT-PCR analysis was performed using gene-specific primers, which were designed from the least conserved regions in the central portion of each of theAtSR genes except AtSR1. Instead, the gene-specific primers for AtSR1 were designed from the 5′-region where the differences were observed between this study and the GenBankTM prediction. The forward/reverse primers are as follows: AtSR1-A/B, AtSR2-A/B, AtSR-3A/B, AtSR4-A/B, AtSR5-A/B, and AtSR6-A/B. The actin 8 gene (AtACT8) was used as a positive internal control. The PCR primers for detection of AtACT8mRNAs were AtACT8-A/B. All primers are listed in Table I. Two μg of total RNA were treated with 1 unit of RNase-free DNase (Invitrogen) for 10 min at 37 °C followed by 5 min at 90 °C to inactivate the DNase. The reverse transcription was carried out using 0.5 μg of oligo(dT)15 as a primer in a 20-μl reaction mixture as described by the manufacturer (Invitrogen). The PCR was performed in a 25-μl reaction mixture containing 1 μl of reverse-transcribed cDNA as the template, two gene-specific primers (0.5 μm each), and 1.5 mm MgCl2. To maintain the amplification of the internal control and AtSRs within the exponential phase, the number of PCR cycles was adjusted to 25 cycles for AtACT8 and 34 cycles for all AtSR genes or otherwise indicated. The PCR products for each pair of primers were subcloned into pCR2.1 (Invitrogen) and sequenced first time to confirm the specificity of PCR amplification. The experiments were repeated three times. The amplified PCR products (9 μl) were electrophoresed on a 1.5% (w/v) agarose gel, stained with ethidium bromide, and scanned using an image analyzer. The Real Time quantitative PCR was performed in the PE Biosystems GeneAmp 5700 sequence detection system using the SYBR green detection as recommended by the manufacturer. Each reaction (25 μl) contained 2.5 μl of the 10× SYBR green buffer; 200 nm dATP, dGTP, and dCTP; 400 nmdUTP; 2 mm MgCl2; 0.625 units of Amplitaq Gold DNA polymerase; 250 nm forward and reverse primers (listed in Table I), and 1 μl of the cDNA from reverse transcription.AtACT8 was used as an internal control. The reactions were performed in a MicroAmp 96-well plate capped with MicroAmp optical caps. The reaction mixtures were incubated at 95 °C for 5 min, and followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The data generated from the SYBR green detection were analyzed as described by Schmittgen et al. (25Schmittgen T.D. Zakrajsek B.A. Mills A.G. Gorn V. Singer M.J. Reed M.W. Anal. Biochem. 2000; 285: 194-204Google Scholar). Briefly, we used ΔΔC t method, in which the end point C t is defined as the PCR cycle number that crosses an arbitrarily placed signal threshold. The fold change of the gene expression was calculated by 2−(ΔΔCt), where ΔΔC t = (C tAtSRs −C tAtACT8)timeX − (C tAtSRs −C tAtACT8)time0. GenBankTM accession numbers for the genes are as follows: AF506697 (AtSR1), AF253511(NtER1), AF096260 (LeER66), AF303397(EICBP), S48041 (parsley CG-1), AU174776 (rice EST), BF278589 (cotton EST), AV835190 (barley EST), BE341351 (Sorghum EST), BE341351 (potato EST), BAA74856 (human1, KIAA0833),BAA74932 (human2, KIAA0909), and AAM10969 (Brassica BnCAMTA). The Arabidopsis data base was searched using NtER1 amino acid sequences. One NtER1 homolog (AtSR1) and five related proteins (AtSR2–6) were found in theArabidopsis genome, with gene identification numbers At2g22300, At5g09410, At3g16940, At5g64220, At1g67310, At4g16150, respectively. Based on the alignment of the amino acid sequences of AtSR1–6, some variations were observed in the N-terminal portions of AtSR1 and AtSR6, whereas AtSR2–5 showed higher similarity to each other (see Fig. 1 in the Supplemental Material). To verify the cDNA sequence of AtSR1, a gene-specific primer (AtSR1-P1) and T3 primer in the vector were used to clone the 5′ region of AtSR1. The longest DNA fragment (∼490 bp) was subcloned, and DNA sequencing revealed that the first 54 amino acids in AtSR1 were different from the prediction in GenBankTM but showed a linear similarity with other AtSRs N-terminal regions (see Fig. 1 in the Supplemental Material). Comparison of AtSR1 cDNA sequences with the genomic sequence indicated the differences resulted from the different RNA splicing sites in introns 1 and 2 (data not shown). Further cloning of the full cDNA showed that sequences in other region were the same as predicted. Reddy et al. (26Reddy A.S. Reddy V.S. Golovkin M. Biochem. Biophys. Res. Commun. 2000; 279: 762-769Google Scholar) reported the isolation of a clone (EICBP, a partial cDNA sequence was reported in GenBankTM) which had the same cDNA sequence as the GenBankTM prediction, suggesting this gene could have two types of transcripts. AtSR1 has 3302 nucleotides, and its largest open reading frame encodes a protein composed of 1032 amino acids with a predicted molecular mass of approximately 116 kDa. The predicted AtSR1 is an acidic and hydrophilic protein (pI 5.3) with no obvious membrane-spanning domains, and an overall secondary structure of α-helices. AtSR1 contains several noteworthy structural features as follows: 1) N-terminal 62–79 has a typical bipartite nuclear targeting signal (27Schwechheimer C. Zourelidou M. Bevan M.W. Annu. Rev. Plant Mol. Biol. 1998; 49: 127-150Google Scholar); 2) C-terminal 900–922 has an almost identical amino acid sequence as the characterized CaM-binding region in NtER1 (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar); 3) the central portion 661–726 has two ankyrin-like repeats which is a motif known to be responsible for mediating protein-protein interactions (28Sedgwick S.G. Smerdon S.J. Trends Biochem. Sci. 1999; 24: 311-316Google Scholar); 4) the C-terminal 853–896 has two IQ motifs, which is a CaM-binding motif in many proteins (29Bahler M. Rhoads A. FEBS Lett. 2002; 513: 107-113Google Scholar); and 5) the C-terminal 1003–1019 has an acidic domain with 11 acidic amino acids. The amino acid sequences of AtSR6 were corrected based on the reported EST (GenBankTM accession number T04795) (see Fig. 1 in the Supplemental Material). AtSR2–6 had predicted lengths ranging from 852 (AtSR3) to 1035 amino acids (AtSR5) with pI values of 5.2–8. Overall similarity among six homologs ranges between 43 and 78%. They shared very high similarity in the N-terminal portion and in the C-terminal portions but not in the central portions (see Fig. 1 in the Supplemental Material). In the C terminus, all six AtSRs and NtER1 showed over 75% similarity and 65% identity, especially in the CaM-binding region with greater than 90% similarity and 79% identity. In the N-terminal portions, AtSR1–6 had over 66% similarity and 50% identity. Similar to AtSR1, AtSR2–5 have a predicted nuclear targeting signal sequence in the N terminus, one or two ankyrin repeat(s) in the center portion (except AtSR6), and more than two IQ motifs around the CaM-binding region. All six AtSRs have just one copy each in theArabidopsis genome. Five Arabidopsis chromosomes have one AtSR gene each, except chromosome 5 which has two, separated by about 20,000 kb. Phylogenetic analysis revealed that AtSR1–6 could be grouped into four subfamilies (SF); SF1 (AtSR1), SF2 (AtSR2, 4), SF3 (AtSR 3, 6), and SF4 (AtSR5) (data not shown). The overall conserved structure of all the AtSRs suggests that they may diverge from a single ancestral origin. AtSR2 and -4 share the highest similarity and are both located on chromosome 5, which suggests that they evolved by gene duplication most recently. Fig. 1 A shows the alignment of the CaM-binding region of AtSR1 with other AtSRs, tobacco NtER1 and tomato LeER66. The predicted CaM-binding domains (23 amino acids) corresponding to the NtER1 CaM-binding region are highly conserved. For example, AtSR1 has only two conserved amino acid sequence substitutions as compared with the counterpart of NtER1 in this portion (amino acids 900–922). Helical wheel projection in GCG 10 (version 10 of the GCG program) revealed that AtSR1–6 had the basic amphiphilic α-helix structure (data not shown), a typical secondary structure for most characterized CaM-binding proteins (18Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 38467-38473Google Scholar, 30O'Neil K.T. DeGrado W.F. Trends Biochem. Sci. 1990; 15: 59-64Google Scholar, 31Yang T. Poovaiah B.W. J. Biol. Chem. 2000; 275: 3137-3143Google Scholar). To determine that the AtSRs are CaM-binding proteins, the full-length AtSR1 and two truncated constructs were expressed inE. coli. The ΔC-(147–1032) was fused to a His tag in the C terminus and was purified by His-Trap column chromatography. The full-length and ΔN-(1–147) recombinant proteins were purified by a CaM-Sepharose column. The recombinant proteins were then subjected to a CaM binding assay. The results revealed that CaM binds to both AtSR1 and ΔN, but not ΔC, in the presence of 0.1 mmCaCl2 (Fig. 1 B). No CaM binding was observed for all proteins when 0.1 mm CaCl2 was replaced by either 0.5 mm calcium chelator EGTA (Fig. 1 B) or other divalent ions such as 0.5 mm MgCl2 (data not shown). Therefore, CaM binding to AtSR1 was Ca2+-dependent, and the CaM-binding region was within the C-terminal residues 147–1032. Furthermore, four peptides (representing four SFs) corresponding to the putative CaM-binding domains of AtSR1,2,3,5 were synthesized. Gel mobility shift assays revealed that CaM bound to all of them in a Ca2+-dependent manner. Two examples (AtSR1 and AtSR3) are shown in Fig. 1 C. These results indicated that AtSR1–6 were all Ca2+-dependent CaM-binding proteins. Because many IQ motifs were CaM-binding domains, the peptides corresponding to the two IQ motifs of AtSR1 were used for the mobility shift assay. CaM did not bind to these two peptides, either in the presence of CaCl2 or EGTA (data not shown). A search of GenBankTM revealed that several partial clones from both dicots and monocots had over 66% similarity and 50% identity with AtSRs N-terminal portion (AtSR1, amino acids 13–134). These plants included parsley, potato, cotton, rice, barley and sorghum. This portion also showed over 56.6% similarity and 42.4% identity with two predicted proteins, KIAA0833 and KIAA0909, based on cDNA isolated from adult human brains. Alignment of these sequences indicated that they had the similar secondary structure with several predicated α-helices and two β-sheets, as well as several positive charged amino acids (more than 10 net positive charges) in this portion. In particular, they all have conserved bipartite nuclear localization signals (AtSR1, amino acids 62–79). We further selected AtSR1 for detailed studies on its subcellular localization by making the full-length of AtSR1, ΔN-(1–146) and ΔC-(147–1032) with GFP fusion constructs. Transient transformation into Arabidopsis leaves was performed by DNA bombardment, and the image was analyzed 24 h after transformation using a confocal microscope. The green fluorescence was throughout the cytoplasm for the GFP control construct. However, both AtSR1:GFP fusion and ΔC:GFP fusion predominantly were localized to the nucleus. In contrast, the ΔN:GFP fusion was visualized as patches in the cytoplasm (Fig. 2). Thus AtSR1 targets nuclei, and the nuclear localization signals are within N-terminal 146 amino acids. Furthermore, the fact that all other AtSRs and related proteins have conserved bipartite nuclear localization signals suggests that they all are nuclear proteins. Parsley CG-1 (147 amino acids) is a partial clone with high similarity with N-terminal portion of AtSRs. da Costa e Silva (32da Costa e Silva O. Plant Mol. Biol. 1994; 25: 921-924Google Scholar) reported that parsley CG-1 bound to a DNA fragment CGCGTTTAATCTCCAACAAACCCCTTCTAG in which CGCG was crucial for DNA binding. The gel retardation assay showed that neither full-length AtSR1 nor deletion mutants bound to this DNA fragment (data not shown). In order to test whether the nuclear protein AtSR1 had specific interacting DNA elements, an oligo selection procedure was used with a pool of 30 completely random sequences of oligonucleotides. Because the putative DNA-binding domain was located in the N terminus, the recombinant AtSR1ΔC-(147–1032) was used for gel retardation assays to avoid the potential negative effects of other domains on DNA binding. The poly(dI-dC) was used as a nonspecific competitor. After three rounds of selection, gel-retarded oligo DNA molecules were amplified, and then a library enriched in DNA inserts containing specific sequences recognized by ΔC was established. The DNA sequencing revealed that half of the positive clones had a common DNA element of 6-bp ACGCGG (or CCGCGT). However, AtSR1 also bound to other fragments with ACGCGT (30%), CCGCGG (10%), ACGCGC (or G
Referência(s)