Portal de Periódicos da CAPES

A Novel Nonsense Mutation and Polymorphisms in the Mouse Hairless Gene

2005; Elsevier BV; Volume: 124; Issue: 6 Linguagem: Inglês

10.1111/j.0022-202x.2005.23744.x

1523-1747

Jintao Zhang, Sheng‐Guo Fang, Chun-Yao Wang,

melanin and skin pigmentation

A novel autosomal recessive mutation arose spontaneously in a breeding colony of Chinese Kunming mice. The characteristics of these mutant mice include progressive irreversible hair loss soon after birth, rhinocerotic appearance, and shorter life span. Histological evaluation of skin revealed the homogeneous enlargement of utriculi, and the formation of several rows of large cysts. Sequencing the complete cDNA of the hairless gene identified two polymorphisms and a homozygous transition for a G→A at nucleotide position 3110 (exon 12) leading to the substitution of tryptophan by a nonsense codon, designated W911X. This allele was named rhinocerotic and short-lived, with the symbol hrrhsl. Addition of hairless gene mutation into the expanding hairless mutation database allows further development of genotype/phenotype correlations towards understanding inherited atrichia. A novel autosomal recessive mutation arose spontaneously in a breeding colony of Chinese Kunming mice. The characteristics of these mutant mice include progressive irreversible hair loss soon after birth, rhinocerotic appearance, and shorter life span. Histological evaluation of skin revealed the homogeneous enlargement of utriculi, and the formation of several rows of large cysts. Sequencing the complete cDNA of the hairless gene identified two polymorphisms and a homozygous transition for a G→A at nucleotide position 3110 (exon 12) leading to the substitution of tryptophan by a nonsense codon, designated W911X. This allele was named rhinocerotic and short-lived, with the symbol hrrhsl. Addition of hairless gene mutation into the expanding hairless mutation database allows further development of genotype/phenotype correlations towards understanding inherited atrichia. base pairs hairless vitamin D receptor Yuyi hairless mice Mutations of the hairless (hr) gene are autosomal recessive allelic mutations that cause severe abnormalities during the first hair follicle regression (catagen), resulting in hair loss soon after birth (Panteleyev et al., 1998cPanteleyev A.A. Van der Veen C. Rosenbach T. Muller-Rover S. Sokolov V.E. Paus R. Towards defining the pathogenesis of the hairless phenotype.J Invest Dermatol. 1998; 110: 903-907Crossref Scopus (79) Google Scholar). Histologically, the skin of all alleles of hairless mutations is characterized by a complete absence of normal hair follicles and the formation of intradermal cystic structures (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar). Analysis of the hairless gene structure and organization reveals remarkable conservation between mice, rats, non-human primates, and humans (Ahmad et al., 1998Ahmad W. ul Haque M. Brancolini V. et al.Alopecia universalis associated with a mutation in the human hairless gene.Science. 1998; 279: 720-724Crossref PubMed Scopus (339) Google Scholar; Brancaz et al., 2004Brancaz M.V. Iratni R. Morrison A. Stephane J.C.M. Marche P. Sundberg J. Nonchev S. A new allele of the mouse hairless gene interferes with Hox/LacZ transgene regulation in hair follicle primordial.Exp Mol Pathol. 2004; 76: 173-181Crossref PubMed Scopus (13) Google Scholar). Hairless mutation in mice closely resembles the human diseases known as papular atrichia (MIM 209500) (Ahmad et al., 1999bAhmad W. Zlotogorski A. Panteleyev A.A. et al.Genomic organization of the human hairless gene and identification of a mutation underlying congenital atrichia in an Arab Palestinian family.Genomics. 1999; 56: 141-148Crossref PubMed Scopus (79) Google Scholar). Currently the human homolog of the hr gene has been identified and linked to human Chromosome 8p21, in a region syntenic with mouse chromosome 14 (Ahmad et al., 1998Ahmad W. ul Haque M. Brancolini V. et al.Alopecia universalis associated with a mutation in the human hairless gene.Science. 1998; 279: 720-724Crossref PubMed Scopus (339) Google Scholar; Cichon et al., 1998Cichon S. Anker M. Vogt I.R. et al.Cloning, genomic organization, alternative transcripts and mutational analysis of the gene responsible for autosomal recessive universal congenital alopecia.Hum Mol Genet. 1998; 7: 1671-1679Crossref PubMed Scopus (126) Google Scholar; Nothen et al., 1998Nothen M.M. Cichon S. Vogt I.R. et al.A gene for universal congenital alopecia maps to chromosome 8p21–22.Am J Hum Genet. 1998; 62: 386-390Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar), and further mutation detection in hr gene has elucidated the molecular causes of papular atrichia in families from around the world (Cichon et al., 1998Cichon S. Anker M. Vogt I.R. et al.Cloning, genomic organization, alternative transcripts and mutational analysis of the gene responsible for autosomal recessive universal congenital alopecia.Hum Mol Genet. 1998; 7: 1671-1679Crossref PubMed Scopus (126) Google Scholar; Ahmad et al., 1999aAhmad W. Panteleyev A.A. Christiano A.M. The molecular basis of congenital atrichia in humans and mice: Mutations in the hairless gene.J Invest Dermatol. 1999; 4: 240-243Abstract Full Text PDF Scopus (32) Google Scholar; Kurse et al., 1999Kurse R. Cichon S. Anker M. et al.Novel hairless mutation in two kindreds with autosomal recessive papular atrichia.J Invest Dermatol. 1999; 113: 954-959Crossref PubMed Scopus (54) Google Scholar; Djabali et al., 2004Djabali K. Zlotogorski A. Metzker A. Ben-Amitai D. Christian A.M. Interaction of hairless and thyroid hormone receptor is not involved in the pathogenesis of atrichia with papular lesions.Exp Dermatol. 2004; 13: 251-256Crossref PubMed Scopus (14) Google Scholar). Including this report, some 16 allelic mutations in the mouse hr gene have been reported, ranging from recessive to semidominant, and with minor to severe clinical features (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar; Ahmad et al., 1999aAhmad W. Panteleyev A.A. Christiano A.M. The molecular basis of congenital atrichia in humans and mice: Mutations in the hairless gene.J Invest Dermatol. 1999; 4: 240-243Abstract Full Text PDF Scopus (32) Google Scholar; Cachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google Scholar; Brancaz et al., 2004Brancaz M.V. Iratni R. Morrison A. Stephane J.C.M. Marche P. Sundberg J. Nonchev S. A new allele of the mouse hairless gene interferes with Hox/LacZ transgene regulation in hair follicle primordial.Exp Mol Pathol. 2004; 76: 173-181Crossref PubMed Scopus (13) Google Scholar; Tian et al., 2004Tian M. Xiong Y.L. Wang W.Y. Zhang Y.P. Molecular genetic basis for the rhino mouse from Chinese KM subcolony.Chin Sci Bull. 2004; 49: 146-152Crossref Scopus (1) Google Scholar). These studies have revealed an intricate relationship between a varying phenotype and a wide range of mutations spread over the entire length of the gene in mice and humans (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar; Klein et al., 2002Klein I. Bergman R. Indelman M. Sprecher E. A novel missense mutation affecting the human hairless thyroid receptor interacting domain 2 causes congenital.J Invest Dermatol. 2002; 119: 920-922Crossref PubMed Scopus (20) Google Scholar). Like mutation in hr gene, some mutations in the vitamin D receptor (VDR) gene result in congenital hair loss in mice and humans, suggesting that the biochemical interaction of VDR and hr proteins is functionally relevant (Miller et al., 2001Miller J. Djabali K. Chen T. et al.Atrichia caused by mutations in the vitamin D receptor gene is a phenocopy of generalized atrichia caused by mutations in the hairless gene.J Invest Dermatol. 2001; 117: 612-617Crossref PubMed Google Scholar; Zarach et al., 2004Zarach J.M. Beaudoin G.M. Coulombe P.A. Thompson C.C. The co-repressor hairless has a role in epithelial cell differentiation in the skin.Development. 2004; 131: 4189-4200Crossref PubMed Scopus (71) Google Scholar). The hr gene encodes a putative single zinc finger transcription factor, and its product acts as a nuclear receptor co-repressor. On the other hand VDR is a member of the steroid binding receptor family and functions as a co-repressor for hairless gene (Miller et al., 2001Miller J. Djabali K. Chen T. et al.Atrichia caused by mutations in the vitamin D receptor gene is a phenocopy of generalized atrichia caused by mutations in the hairless gene.J Invest Dermatol. 2001; 117: 612-617Crossref PubMed Google Scholar; Hsieh et al., 2003Hsieh J. Sisk J.M. Jurutka P.W. Haussler C.A. Slater S.A. Haussler M.R. Thompson C.C. Physical and functional interaction between the vitamin D receptor and hairless corepressor, two proteins required for hair cycling.J Biol Chem. 2003; 278: 38665-38674Crossref PubMed Scopus (179) Google Scholar). Both the VDR and hr genes play a role in the mammalian hair cycle, as inactivating mutations in either result in generalized atrichia (Hsieh et al., 2003Hsieh J. Sisk J.M. Jurutka P.W. Haussler C.A. Slater S.A. Haussler M.R. Thompson C.C. Physical and functional interaction between the vitamin D receptor and hairless corepressor, two proteins required for hair cycling.J Biol Chem. 2003; 278: 38665-38674Crossref PubMed Scopus (179) Google Scholar; Zarach et al., 2004Zarach J.M. Beaudoin G.M. Coulombe P.A. Thompson C.C. The co-repressor hairless has a role in epithelial cell differentiation in the skin.Development. 2004; 131: 4189-4200Crossref PubMed Scopus (71) Google Scholar). Moreover, hr mutation is pleiotropic, including such effects as reproductive and immunological abnormalities, and elevated sensitivity to chemically induced skin carcinogenesis (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar). But, the precise function of the corresponding protein of the hairless gene remains elusive. The novel spontaneous allelic mutations provide crucial insights in this regard, and are powerful tools for understanding variations in human clinical symptoms for inherited atrichia. In this study, several mice lacking hair arose spontaneously in a closed colony of Chinese Kunming mice maintained in our lab. With age their skin become excessively wrinkled in a fashion similar to rhino mice previously reported (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar). But, in contrast to nude mice, these hairless mice possess thymus (Zhang et al., 2002Zhang J.T. Wang C.Y. Kang Q.Z. Du X.T. Xue J.L. Establishment of segergating inbred strain of Yuyi hairless mice and its monitoring of genetic characteristics.Acta Genet Sin. 2002; 29: 221-225Google Scholar). The inheritance mode of this phenotype was revealed, by testcross, to have resulted from an autosomal recessive mutation (Zhang et al., 1997Zhang J.T. Wang C.Y. Kang Q.Z. et al.The hereditary assay of losing hair property of KM-mice.Chin J Zool. 1997; 32: 17-18Google Scholar). We have designated this mouse Yuyi using the laboratory code (Laboratory Animal Center of Zhengzhou University), and established Yuyi hairless mice (YYHL) of segregated inbred strains (Zhang et al., 2002Zhang J.T. Wang C.Y. Kang Q.Z. Du X.T. Xue J.L. Establishment of segergating inbred strain of Yuyi hairless mice and its monitoring of genetic characteristics.Acta Genet Sin. 2002; 29: 221-225Google Scholar). To elucidate further the underlying pathogenesis of this inherited atrichia we used a molecular approach to test the hypothesis that this mutation was allelic with the hairless gene and to screen for a potential mutation in the hr gene (GeneBank Accession No. Z32675). Here we report a novel nonsense mutation in the coding region of the hr gene designated rhinocerotic and short-lived (symbol hrrhsl) 1This allele nomenclature has been approved by MGI.1This allele nomenclature has been approved by MGI. (MGI Accession No. 2678250), and two polymorphisms in the gene. YYHL grew a normal first pelage when younger than 12 d. Subsequently, they began to lose the hair around the eyes, and the shedding then progressed in the direction of the tail. Total depilation was normally completed within 2 wk with the exception of the vibrissae. Young hairless mice had a delicate pink skin. As affected mice aged, the skin became progressively thick, loose, and redundant, forming rhinoceros-like folds. A waxy deposition on the skin that peels off in large flakes developed in aging mutant mice (Figure 1a). Toenails also became excessively long and curved, especially the toes of the hind limbs. Heterozygous mice had normal hair and were indistinguishable from genotypically normal individuals. Yuyi hairless female and male mice were fertile, but most females displayed abnormalities in their maternal behavior; they did not nurse their young well, and usually ate their young after 1–2 d of postnatal life. Heterozygous mice had a normal reproductive capability. The thymus of mutant mice underwent accelerated atrophy with age. The homozygotes had reduced life span and usually expired at the age of 6–10 mo. Autopsy on deceased mice revealed only the remnants of the thymus and a marked enlargement of the spleen and liver. But there were no other macroscopic abnormalities in other internal organs, compared with haired littermates. When successive backcrossing onto BALB/c strain was performed to two rounds, a few heterozygous offspring appeared with the dominant characteristic of shedding of hair on either side of their snouts (Figure 1b). Histological sections of skin from the backs of mice were observed and revealed obvious histopathological defects when compared with the wild-type mouse of the same age. YYHL showed the disintegration of hair follicles and formation of utriculi and dermal cystic structures in the dermis and both the follicular and epidermal hyperkeratosis. The utriculi were hypertrophic, excessively large, and filled with masses of cornified material. With advancing age the cysts became larger and more numerous. In 8 mo old animals, cysts filled with keratinized laminae nearly obliterated the dermis and adipose layer (Figure 1c). The excessive skin mass growth is because of excessive dilatation of utriculi and the enlargement of dermal cysts. Sequencing (Table I) of the entire hr cDNA on both strands between mutant homozygous (hrrhsl/hrrhsl) (GenBank Accession No. AY547390), heterozygous, and normal Kunming control mice (GenBank Accession No. AY547391) revealed that all affected mice were homozygous for an A→G substitution at cDNA position 3110 (numbered according to Genbank No. Z32675) (Figure 1d), converting a tryptophan to a nonsense mutation of stop codon (W911X). The wild-type (+/+) Kunming mice possess G at nucleotide position 3110, which is the third position of the tryptophan code (TGG). The +/hrrhsl mice possess this mutation in the heterozygous state (G/A) (Figure 1d). The mutation is just in the overlap region amplified by two sets of primers EP and FP. Using five homozygous BALB/c hairless mice and sequencing from genomic DNA performed with MP primers gave the same result, confirming the mutation. Furthermore, no evidence for the mutant allele was found by direct sequencing of DNA samples from 20 normal, unrelated kunming mice; it was not a polymorphism. To reflect the characteristics of this new mutation at the hr locus, we have designated this allele hrrhsl (MGI Accession No. 2678250) according to the rhinocerotic and short-lived phenotype of this mutation in accordance to existing guidelines for nomenclature.Table IPCR primers for the amplification of exons 1–19 of hr genePrimer namecDNA regionPrimers (forward/reverse)Annealing temperature (°C)Products (bp)BP1–336GGGGCCGCCGAATCACG/CCCCATGGCCGGACAGAGG59884CP230–1229CTGAGCAGAAAGCGGGAGAACG/CAGGCCTGGGGGACAAGAAG561000DP1103–1795AGGCCCCTCACTTCACCA/AGCCTAATCCTGCCATCTCG59693AP1737–2615AAGGCGGAGGCAGAGCAACAAGAG/TGACCGGCCAGCACCATCC61879EP2501–3206AACTCCCCCAACTCCACAACCT/CACCCTGCTAGCGTCCTTATCC55706FP2961–4016GGCCAGCCCGTGTTAGTGTCAG/AAGTTCCCCAGTACCATTCATTCC561056GP3864–4017GTGCTGGAACGCGATTGAAAA/CAGGGCCAGGACGAGGAACA52272bp, base pairs; hr, hairless. Open table in a new tab bp, base pairs; hr, hairless. During the search for pathogenetic mutation, two additional sequence variants in exons 4 and 5 were discovered (Table II). One of them, 1905 T→A, substituted a serine in position 510 by a threonine (S510T) (Figure 2a). The occurrence of the T→A transition was tested in 20 normal Kunming mice and revealed that the mutated allele 1905A (Thr510) has a frequency of 25%. Four mice were homozygous for the T→A transition, and two mice were heterozygous. Another, 1978–1980 del 3 base pairs (bp), resulted in a deletion of a glutamic acid at position 534 of the hairless protein (E534del) (Figure 2b). Of the 20 normal Kunming mice screened for this sequence variation in exon 5, 13 mice were homozygous for the AAG allele, four were homozygous for the AAG deletion allele, and three were heterozygous for AAG/AAGdel. The allele frequencies are therefore 0.725 for the AAG and 0.275 for the AAG deletion. All of them had normal hair development. Thus, these mutations represent two common polymorphisms.Table IIPathogenic mutations and polymorphisms in the mouse hr geneAlleleLocationMutationaNucleotide numbers refer to cDNA sequence of the mouse hr gene (Genbank accession no. Z32675).EffectReferenceMutationshrhrIntron 6Pmv43 insertionMis-splicingCachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google ScholarhrrhExon 62166C>TR597XCachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google ScholarhrrhslExon 123110G>AW911XThis reporthrrh-JExon 51977–1979delE534delTian et al., 2004Tian M. Xiong Y.L. Wang W.Y. Zhang Y.P. Molecular genetic basis for the rhino mouse from Chinese KM subcolony.Chin Sci Bull. 2004; 49: 146-152Crossref Scopus (1) Google Scholarhrrh-7JExon 31253G>AW292XCachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google Scholarhrrh-8JExon 41910–1911 GA>TTQ511H, K512XAhmad et al., 1999aAhmad W. Panteleyev A.A. Christiano A.M. The molecular basis of congenital atrichia in humans and mice: Mutations in the hairless gene.J Invest Dermatol. 1999; 4: 240-243Abstract Full Text PDF Scopus (32) Google Scholarhrrh-bmhExon 193918 del 296 bpDeletion at the 3′ end of hairless geneBrancaz et al., 2004Brancaz M.V. Iratni R. Morrison A. Stephane J.C.M. Marche P. Sundberg J. Nonchev S. A new allele of the mouse hairless gene interferes with Hox/LacZ transgene regulation in hair follicle primordial.Exp Mol Pathol. 2004; 76: 173-181Crossref PubMed Scopus (13) Google ScholarhrrhChrExon 41776C>TR467XAhmad et al., 1999aAhmad W. Panteleyev A.A. Christiano A.M. The molecular basis of congenital atrichia in humans and mice: Mutations in the hairless gene.J Invest Dermatol. 1999; 4: 240-243Abstract Full Text PDF Scopus (32) Google ScholarhrrhYExon 163520ins 13 bpFrameshift, premature stop codon at aa 1137Panteleyev et al., 1998aPanteleyev A.A. Ahmad W. Malashenko A.M. Ignatieva E.L. Paus R. Sundberg J.P. Christiano A.M. Molecular basis for the rhino Yurlovo (hrrhY) phenotype: Severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene.Exp Dermatol. 1998; 7: 281-288Crossref PubMed Scopus (43) Google ScholarhrrhKIZExon 112817C>TR814XTian et al., 2004Tian M. Xiong Y.L. Wang W.Y. Zhang Y.P. Molecular genetic basis for the rhino mouse from Chinese KM subcolony.Chin Sci Bull. 2004; 49: 146-152Crossref Scopus (1) Google ScholarhrTg5053MmIntron 5–Exon 8Transgene insertionDeletion of most of the 3′ end of hairless geneCachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google Scholarhrtm1CctExon 8–10Homologous recombinationLoss of function (hr(-/-))Zarach et al., 2004Zarach J.M. Beaudoin G.M. Coulombe P.A. Thompson C.C. The co-repressor hairless has a role in epithelial cell differentiation in the skin.Development. 2004; 131: 4189-4200Crossref PubMed Scopus (71) Google ScholarLocationVariationbNucleotide numbers refer to cDNA sequence of the mouse hr gene (Genbank accession no. Z32675).EffectAllele frequencyReferencePolymorphismsExon 41905T>AS510T0.75/0.25This reportExon 51978–1980delE534del0.725/0.275This reportbp, base pairs; hr, hairless.a, b Nucleotide numbers refer to cDNA sequence of the mouse hr gene (Genbank accession no. Z32675). Open table in a new tab bp, base pairs; hr, hairless. In this study, we report the identification of a novel nonsense mutation W911X in the hr gene by automated sequencing of cDNA, genomic DNA and confirm that the hrrhsl mutation is a disease-causing mutation that is responsible for the typical cutaneous phenotype of hairless mice. This result validates the hypothesis that the hrrhsl hairless mutation is allelic with the hr gene. To date, 12 pathogenic hr mutations among 16 reported mutations (including this report) have been identified around the world (Table II), demonstrating the heterogeneity of the hairless phenotype. These mutations reflect a wide spectrum of possible types of mutations, including a proviral pmv43 insertion in intron 6 (Cachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google Scholar), as well as a series of nonsense and deletion mutations in exons of the hr gene (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar; Ahmad et al., 1999aAhmad W. Panteleyev A.A. Christiano A.M. The molecular basis of congenital atrichia in humans and mice: Mutations in the hairless gene.J Invest Dermatol. 1999; 4: 240-243Abstract Full Text PDF Scopus (32) Google Scholar; Cachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google Scholar; Brancaz et al., 2004Brancaz M.V. Iratni R. Morrison A. Stephane J.C.M. Marche P. Sundberg J. Nonchev S. A new allele of the mouse hairless gene interferes with Hox/LacZ transgene regulation in hair follicle primordial.Exp Mol Pathol. 2004; 76: 173-181Crossref PubMed Scopus (13) Google Scholar; Tian et al., 2004Tian M. Xiong Y.L. Wang W.Y. Zhang Y.P. Molecular genetic basis for the rhino mouse from Chinese KM subcolony.Chin Sci Bull. 2004; 49: 146-152Crossref Scopus (1) Google Scholar). Furthermore, we have identified two new polymorphisms in the mouse hr gene, S510T and E534del. It was reported that hrrh-J mutation with the rhinocerotic and hairless phenotypes resulted from three base deletions at 1977–1979 position, leading to deletion of glutamic acid at 534 (Cachon-Gonzalez et al., 1999Cachon-Gonzalez M.B. San-Jose I. Cano A. et al.The hairless gene of the mouse: Relationship of phenotypic effects with expression profile and genotype.Dev Dyn. 1999; 216: 113-126Crossref PubMed Scopus (54) Google Scholar; Tian et al., 2004Tian M. Xiong Y.L. Wang W.Y. Zhang Y.P. Molecular genetic basis for the rhino mouse from Chinese KM subcolony.Chin Sci Bull. 2004; 49: 146-152Crossref Scopus (1) Google Scholar; Zarach et al., 2004Zarach J.M. Beaudoin G.M. Coulombe P.A. Thompson C.C. The co-repressor hairless has a role in epithelial cell differentiation in the skin.Development. 2004; 131: 4189-4200Crossref PubMed Scopus (71) Google Scholar). But the phenotype of Kunming mice with three base deletions at 1978–1980 position leading to the same deletion of glutamic acid at 534 is normal, indicating that this deletion is insignificant. The question is why does the same amino acid deletion may induce different results? One possibility is that the mutation of three base deletions at 1977–1979 position is in fact non-pathogenic sequence alteration. Another possibility is that the background modifiers, such as the VDR (Miller et al., 2001Miller J. Djabali K. Chen T. et al.Atrichia caused by mutations in the vitamin D receptor gene is a phenocopy of generalized atrichia caused by mutations in the hairless gene.J Invest Dermatol. 2001; 117: 612-617Crossref PubMed Google Scholar) and retinoid X receptor-α genes (Klein et al., 2002Klein I. Bergman R. Indelman M. Sprecher E. A novel missense mutation affecting the human hairless thyroid receptor interacting domain 2 causes congenital.J Invest Dermatol. 2002; 119: 920-922Crossref PubMed Scopus (20) Google Scholar), play an important role. But, the most likely explanation for the discrepant findings is that the previous reports have not yet detected the true mutation in their mice. The nonsense mutation may lead to nonsense mediated mRNA decay (Maquat, 1996Maquat L.E. Defects in RNA splicing and the consequence of shortened translational reading frames.Am J Hum Genet. 1996; 59: 279-286PubMed Google Scholar). Thus, the introduction of the hrrhsl nonsense mutation has been predicted to have led to an absence of functional hairless protein (Cui et al., 1995Cui Y. Hagan K.W. Zhang S. Peltz S.W. Identification and characterization of genes that are required for the accelerated degradation of mRNAs containing a premature translational termination codon.Genes Dev. 1995; 9: 423-436Crossref PubMed Scopus (220) Google Scholar). The YYHL share several common symptoms with other alleles of this locus, including hairless (hrhr/hrhr) and rhino (hrrh/hrrh) (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar). These include the patterns of hair loss, gross appearance, genetic features, reproductive defects, immune function impairment (Kang et al., 2002Kang Q.Z. Zhang J.T. Du C.Y. Du X.T. T-lymphocyte subsets and sIL-2R level in segregating inbred strain of Yuyi hairless mouse.Chin J Zool. 2002; 37: 18-20Google Scholar), and histological evidence including the disintegration of hair follicles and the formation of cystic structures in the dermis. In addition, the homozygous YYHL have a reduced life span and enhanced skin abnormalities markedly similar to rhino Yurlovo (hrrhY/hrrhY) (Panteleyev et al., 1998aPanteleyev A.A. Ahmad W. Malashenko A.M. Ignatieva E.L. Paus R. Sundberg J.P. Christiano A.M. Molecular basis for the rhino Yurlovo (hrrhY) phenotype: Severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene.Exp Dermatol. 1998; 7: 281-288Crossref PubMed Scopus (43) Google Scholar). But, that the Yuyi hairless homozygous females are able to give birth normally and are different from the homozygous hrrhY/hrrhY females that are not fecund at all. Interestingly, when successive backcrossing onto BALB/c strain was performed to two rounds, a few heterozygous offspring appeared with the dominant characteristic of shedding of hair on either side of their snouts (Figure 1b). Such phenotypic diversity in different alleles of hairless gene may be because of the effects of modifier genes on different backgrounds (Panteleyev et al., 1998aPanteleyev A.A. Ahmad W. Malashenko A.M. Ignatieva E.L. Paus R. Sundberg J.P. Christiano A.M. Molecular basis for the rhino Yurlovo (hrrhY) phenotype: Severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene.Exp Dermatol. 1998; 7: 281-288Crossref PubMed Scopus (43) Google Scholar). The clinical and histopathological features of YYHL are similar to those observed in humans with papular atrichia (Ahmad et al., 1999bAhmad W. Zlotogorski A. Panteleyev A.A. et al.Genomic organization of the human hairless gene and identification of a mutation underlying congenital atrichia in an Arab Palestinian family.Genomics. 1999; 56: 141-148Crossref PubMed Scopus (79) Google Scholar; Kurse et al., 1999Kurse R. Cichon S. Anker M. et al.Novel hairless mutation in two kindreds with autosomal recessive papular atrichia.J Invest Dermatol. 1999; 113: 954-959Crossref PubMed Scopus (54) Google Scholar). Thus, the identification of hrrhsl nonsense mutation emphasizes the importance of the hr gene in follicle development, and expands our understanding of the spectrum of mutations underlying hairlessness in mice. YYHL thereby provide a potential model for further studies of the hairless gene function, and may facilitate insights into the pathophysiology of inherited atrichia in humans associated with the disruption of hr gene activity (Panteleyev et al., 1998aPanteleyev A.A. Ahmad W. Malashenko A.M. Ignatieva E.L. Paus R. Sundberg J.P. Christiano A.M. Molecular basis for the rhino Yurlovo (hrrhY) phenotype: Severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene.Exp Dermatol. 1998; 7: 281-288Crossref PubMed Scopus (43) Google Scholar, Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar). In conclusion, we report and name a novel spontaneous hairless mutation in the mouse, and clarify that the molecular basis for rhinocerotic and short-lived (hrrhsl) phenotype is the nonsense mutation at nucleotide position 3110 within the hr gene. The functional consequences of this mutation are essentially similar to those of the previously described mutation. Furthermore, we have identified two new polymorphisms in mouse hairless gene. These data once again illustrate phenotypic and genetic heterogeneity and expand our understanding of the molecular basis of the hairless phenotype. All animals were from the Laboratory Animal Center of Zhengzhou University, and were housed in community cages under conventional conditions (12 h light periods, water and mouse chow ad libitum). Moreover, the mutant allele was backcrossed onto BALB/c mice, by performing successive rounds of cross–intercross, and obtaining BALB/c hairless mice. For preliminary morphological comparison, the age-matched hairless and haired mice on different months were scarified by cervical dislocation. The skin samples were harvested from the upper back and immediately frozen in liquid nitrogen for histology and nucleic acid isolation. All mice were cared for according to the Guide for the Care and Use of Laboratory Animals, and the study was approved by the Medical Ethical Committee of Zhejiang University. Skin samples were fixed by immersion in neutral buffered 10% formaldehyde. The biopsies were sectioned perpendicularly to the skin surface and embedded in paraffin. Sections of 3 μm thickness of harvested skin were stained with hematoxylin and eosin for routine histology, and examined microscopically. On the basis of the similar characteristic feature and genotype of mutant hairless mice with previously reported cases of mice harboring hr gene mutations (Panteleyev et al., 1998bPanteleyev A.A. Paus R. Ahmad W. Sundberg J.P. Christiano A.M. Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans.Exp Dermatol. 1998; 7: 249-267Crossref PubMed Scopus (114) Google Scholar), we initiated a screening for a mutation in the hr gene from these mutant hairless mice, in contrast with normal Kunming mice. A set of primers (Table I) were designed based on the available murine hr gene sequence (GenBank Accession No. Z32675) and 14 Chromosome sequences (gi.20878405) to amplify 1–19 exons. Genomic DNA was extracted from the tail by standard procedures. Total RNA was extracted from mouse skin samples following the manufacturer's protocol (Qiagen, Valencia, California). Exons 1 and 19 were amplified using genomic DNA as a template. The PCR conditions were as follows: 4 min at 94°C, followed by 35 cycles of 45 s at 94°C, 1 min at appropriate annealing temperature (Table I), 1 min at 72°C, and a final extension step of 10 min at 72°C. Other exons were analyzed with mRNA selective PCR kit (TaKaRa, Otsu, Japan). The selective PCR conditions were 50°C for 25 min, 85°C for 2 min, then 30 cycles of 85°C for 1 min, the appropriate annealing temperature (Table I) for 1 min and 72°C for 1 min, with a final extension step of 10 min at 72°C. The PCR products were electrophoresed in a 1% agarose gel in 1 × TAE buffer, and eluted from the agarose gel with gel extraction kit (TaKaRa), then sequenced directly on both strands using Big Dye Terminator V3.1 cycle sequencing kit (PE Applied Biosystems, Foster City, California) on ABI Prism377 automated DNA sequencer (PE Applied Biosystems). To confirm the mutation the above procedures were repeated using five homozygous BALB/c hairless mice carrying this mutant gene. A 252 bp PCR fragment encompassing exon 12 was amplified from genomic DNA using MP primers (forward primer 5′-GCTCCCCAACAATTCTTTTCTC-3′ and reverse primer 5′-TCCCAGCTCCCTCTATCCTATG-3′). For verification of the polymorphisms, PCR was carried out on genomic DNA from 20 normal Kunming mice with PP primers (forward primer 5′-CCCCGAGATGGCAGGATTAGG-3′ and reverse primer 5′-GCAGCAGGCGGCAGAGTCG), and PCR products were directly sequenced. We thank Dr Charlie Manolis and Dr Robin Fitzgerald for their help with manuscript revision. We are most grateful to Dr Y. M. Xi, C. Wood, Dr Y. C. Xu, Dr X. C. Ma, and Dr Q. H. Wan for advice and revision of the manuscript, and to Dr Cathy Lutz of mouse genome informatics, the Jackson Laboratory for kind help in the mutant and allele nomenclature. This work was supported by a Special Grant from the State Forestry Administration of China (No. 2003442).