Downregulation of Pax3 expression correlates with acquired GFAP expression during NSC differentiation towards astrocytes
2011; Wiley; Volume: 585; Issue: 7 Linguagem: Inglês
10.1016/j.febslet.2011.02.034
ISSN1873-3468
AutoresYan Liu, Hui Zhu, Mei Liu, Jinfeng Du, Yuyan Qian, Yongjun Wang, Fei Ding, Xiaosong Gu,
Tópico(s)Cancer-related gene regulation
ResumoFEBS LettersVolume 585, Issue 7 p. 1014-1020 Short communicationFree Access Downregulation of Pax3 expression correlates with acquired GFAP expression during NSC differentiation towards astrocytes Yan Liu, Yan Liu Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR China Contributed equally to this work. Search for more papers by this authorHui Zhu, Hui Zhu Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR China Surgical Comprehensive Laboratory, Affiliated Hospital of Nantong University, Jiangsu Province 226001, PR China Contributed equally to this work. Search for more papers by this authorMei Liu, Mei Liu Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorJinfeng Du, Jinfeng Du Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorYuyan Qian, Yuyan Qian Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorYongjun Wang, Yongjun Wang Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorFei Ding, Fei Ding Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorXiaosong Gu, Corresponding Author Xiaosong Gu neurongu@public.nt.js.cn Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaCorresponding author. Fax: +86 0513 85511585.Search for more papers by this author Yan Liu, Yan Liu Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR China Contributed equally to this work. Search for more papers by this authorHui Zhu, Hui Zhu Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR China Surgical Comprehensive Laboratory, Affiliated Hospital of Nantong University, Jiangsu Province 226001, PR China Contributed equally to this work. Search for more papers by this authorMei Liu, Mei Liu Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorJinfeng Du, Jinfeng Du Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorYuyan Qian, Yuyan Qian Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorYongjun Wang, Yongjun Wang Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorFei Ding, Fei Ding Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaSearch for more papers by this authorXiaosong Gu, Corresponding Author Xiaosong Gu neurongu@public.nt.js.cn Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, Jiangsu Province 226001, PR ChinaCorresponding author. Fax: +86 0513 85511585.Search for more papers by this author First published: 01 March 2011 https://doi.org/10.1016/j.febslet.2011.02.034Citations: 14 AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Abstract Glial fibrillary acidic protein (GFAP) is a principal intermediate filament in mature astrocytes of the central nervous system (CNS), and the regulation of GFAP transcription has not been well understood yet. In the present study, we reported paired box 3 protein (Pax3) as a novel regulator of GFAP transcription, which could bind the promoter region of GFAP and down regulate the GFAP level during the serum-induced astrocyte differentiation of neural stem cells (NSCs). Moreover, the overexpression and suppression of Pax3 could inhibit and promote NSC differentiation, respectively. These data suggest that Pax3 negatively regulates GFAP expression during astrocyte differentiation in vitro. 1 Introduction Glial fibrillary acidic protein (GFAP) is the major intermediate filament protein in mature astrocytes, and it likely plays a critical role due to its high abundance in astrocytes and strong conservation among vertebrates. Numerous reports have recently focused on the regulation of GFAP expression. The extracellular signals that may activate GFAP expression include ciliary neurotrophic factor, pituitary adenylate cyclase-activating polypeptide, and bone morphogenetic proteins [1-4]. Furthermore, the regulatory elements in the GFAP gene have been examined to understand how these signals affect astrocyte maturation and GFAP expression. Transcription factors such as AP-1 [5], NF-1, STAT, and Smad [3, 6, 7] have been reported to bind to the promoter region of GFAP. In our preliminary study, the promoter region of GFAP was analyzed with Genomatix software to identify new transcription factors that may regulate GFAP expression. Two potential Pax3 protein-binding sites were identified that contain well-recognized DNA motifs. Members of the Pax gene family are reported to be key regulators of the formation of multiple tissues and organs during embryonic development. Pax3 is expressed in the limb muscle, neural tube and neural crest, and is required for the migration and differentiation of muscle precursor cells and neural crest cells [8]. Pax3 is mutated in Splotch mice and human Waardenburg syndrome, in which malformation of neural tube, somite derivatives, and limb muscles occurs, and the homozygous Splotch mutations are mid-gestation lethal [9, 10]. In primary Schwann cell cultures, constitutive expression of Pax3 alters levels of GFAP expression [11], which is consistent with the idea that Pax3 may regulate GFAP expression. Thus, in our current study, we analyzed the promoter region of rat GFAP gene, and identified two elements that could bind Pax3, which further negatively regulates GFAP expression during astrocyte differentiation in vitro. 2 Materials and methods 2.1 Bioinformatics analysis and plasmid construction The promoter region spanning from −1987 to +13 bp of the rat GFAP gene (the start site of transcription is referred as the position 1) [12] was analyzed by Genomatix software (http://www.genomatix.de) to identify potential binding sites for transcription factors. The full length promoter plasmid pGFAP2000 spanning from −1987 to +13 bp of rat GFAP genomic DNA was cloned into pGL3-Basic luciferase reporter vector (Promega). The nucleotides corresponding to P1 and P2 probes (listed in Table 1 ) in pGFAP2000 were deleted singly or in combination to generate the mutated promoter constructs, using oligonucleotide directed deletions with Pfu Turbo DNA polymerase from a QuikChange kit (Stratagene). The mutated promoter constructs were termed pGFAP2000-DelP1 (19 nucleotides deletion of P1), pGFAP2000-DelP2 (19 nucleotides deletion of P2) and pGFAP2000-DelP1P2 (38 nucleotides deletion of P1 and P2), respectively. The cDNA fragment encoding rat Pax3 was also cloned into the pCI vector (Promega) for ectopic expression. All of these constructs were confirmed by sequencing. Table Table 1. Oligonucleotides used in the study Usage Targets Sequence (5′ to 3′) RT-PCR GAPDH-sense ctgcccagaacatcatccct GAPDH-antisense tgaagtcgcaggagacaacc Pax3-sense gccaatcaactgatggcttt Pax3-antisense cattcgaaggaatggtgctt GFAP-sense gactatcgccgccaactg GFAP-antisense atgacctcgccatcccg Reporter construct pGFAP2000-sense cgagctcctctccacattcccaactcatagg pGFAP2000-antisense cccaagcttttgccctgcttctgctggctcctg mutant construct Del P1-sense gtcactggggccagaaaatcccgaaggggc Del P1-antisense gccccttcgggattttctggccccagtgac Del P2-sense cccctgggacctgggattggaagcctact Del P2-antisense agtaggcttccaatcccaggtcccagggg Expression vector pCI-Pax3-sense ggaattcatgaccacgctggccgg pCI-Pax3-antisense acgcgtcgacgaacgtccacggcttac Pax3 shRNA sequence Pax3 shRNA-sense agctgggaaatcagagacaaa Pax3 shRNA-antisense tttgtctctgatttcccagct EMSA P1 probe-sense gtggtcacacaagccttta P1 probe-antisense taaaggcttgtgtgaccac P2 probe-sense tgccaattagtgtgaccca P2 probe-antisense tgggtcacactaattggca P1M probe-sense gtgggacaacaagccttta P1M probe-antisense taaaggcttgttgtcccac P2M probe-sense tgccaattagttgtcccca P2M probe-antisense tggggacaactaattggca ChIP P1 ChIP-sense ccacattcccaactcatag P1 ChIP-antisense acctttagactggacctcat P2 ChIP-sense gcagtttacccaaccca P2 ChIP-antisense gccacagagcgaatacaa 2.2 Cell culture, transfections, and luciferase assays HEK 293T cells and RSC96 cells were purchased from the American Type Culture Collection (ATCC) and cultured in the recommended medium and conditions. Luciferase reporter assays were performed by co-transfecting normal or mutated GFAP promoter reporter plasmid, together with the PRL (Promega) vector, into RSC96 cells in triplicate using Lipofectamine2000 (Invitrogen). The cell lysates were analyzed for luciferase activity using the Dual Luciferase Assay Kit according to the manufacturer's specifications. 2.3 Electrophoretic mobility shift assay Nuclear extracts from HEK 293T cells transfected with pCI-Pax3 were prepared, and electrophoreticmobility shift assays (EMSAs) were performed exactly as described [2, 6]. The sequences of the normal and mutated oligonucleotides used in this experiment are listed in Table 1. For supershift experiments, nuclear extracts were pre-incubated with anti-Pax3 polyclonal antibodies (sc-34918, Santa Cruz Biotechnology) before adding the labeled probes. 2.4 Neural stem cell cultures and differentiation Neural stem cells (NSCs) were derived from the cerebral cortex of E16 Sprague–Dawley rats as described previously and grown as neurospheres [13]. To induce differentiation, neurospheres or dispersed NSCs were seeded onto either dishes or coverslips coated with poly-l-lysine and cultured in Dulbecco's modified Eagle's medium (DMEM/F12) with 1% fetal bovine serum (FBS). Astrocyte differentiation was examined 3 days later. 2.5 Chromatin immunoprecipitation assays Chromatin immunoprecipitation (ChIP) assays were performed with a commercial kit (Upstate Biotechnology) as described by the manufacturer. Normal and differentiated NSCs were lysed, and the immunoprecipitation was performed with anti-Pax3 (sc-34918) polyclonal antibodies (Santa Cruz Biotechnology) or mouse immunoglobulin G (IgG; negative control). The oligonucleotide primers for polymerase chain reaction (PCR) that were used to detect the fragment of the promoter region of GFAP are listed in Table 1. 2.6 Pax3 knockdown, overexpression, and adenoviral infections The target sequences used to knockdown Pax3 by shRNA interference are listed in Table 1. The shRNA fragments were subcloned into the pYrbio-hU6-EGFP-shRNA vector (Changsha Yingrun Biotech. Co. Ltd.), which can be used as an entry vector for adenovirus construction. The pAd/CMV/V5-DEST™ vector (Invitrogen) was used to generate recombinant adenovirus, and the adenovirus packaging was performed with ViraPower™ Adenoviral Expression System (Invitrogen). The Pax3 overexpression adenoviral construct was synthesized as well. The adenoviral construct was used to produce recombinant viruses, which were used to infect the NSCs. Then, the neurospheres were transferred onto glass coverslips in 24-well dishes containing DMEM/F12 medium with 1% FBS for Pax3-expressed virus infection, or with 2% B27 for shPax3 virus infection in the absence of serum. After additional culturing for 3 days, the neurospheres were fixed and processed for immunocytochemistry followed by confocal microscopy observation. 2.7 Immunocytochemistry The cultured cells were fixed in 4% paraformaldehyde for 20 min and then incubated with polyclonal primary antibody to rabbit anti Pax3 (1:200, LifeSpan BioSciences) and monoclonal primary antibody to GFAP (1:400, Millipore) at 4 °C overnight. Fluorescence (Cy3 or FITC)-labeled secondary antibodies were added and further incubated, followed by visualization with confocal microscopy. 2.8 RT-PCR and western blot analysis Total RNA was extracted from cells with Trizol (Invitrogen), and cDNA was synthesized from total RNA using an Omniscript RT kit (QIAGEN) following the supplier's instructions. The sequences of the primers for Pax3, GFAP, and GAPDH (as an internal control) used in RT-PCR are shown in Table 1, and the cycle numbers used for amplification were 35, 30 and 25, for Pax3, GFAP, and GAPDH, respectively. Western blotting was performed according to standard protocols. The antibodies used were goat anti-GAPDH polyclonal antibody (1:800, Santa Cruz Biotechnology), rabbit anti-Pax3 polyclonal antibody (1:1000, LifeSpan BioSciences), rabbit anti-GFAP polyclonal antibody (1:400, Dakocytomation), donkey anti-goat IRDye (1:10 000, Rockland), and donkey anti-rabbit IRDye (1:10 000, Rockland). The immunblots were analyzed using the Odyssey densitometry program (Licor). GAPDH was used as an internal control for normalizing the protein load. 3 Results 3.1 Identification of Pax3 binding elements in the GFAP promoter and EMSA assay The promoter region of the rat GFAP gene was analyzed by Genomatix software to identify potential binding sites for transcription factors. Two potential Pax3 protein binding sites, designated P1 (5′-gtggTCACacaagccttta-3′, spanning from −1935 to −1917 bp on the positive strand) and P2 (5′-tgggTCACactaattggca-3′, spanning from −416 to −434 bp on the minus strand), were identified by the matrices database of transcription factor binding sites. The IUPAC string consensus is a representation of the matrix, which was described as follows: 5′-bnwgTCACactdvynwtn-3′ (B: G/T/C, N: A/G/C/T, W: A/T, D: G/A/T, V: G/C/A, Y: T/C). Nucleotides in capital letters of the IUPAC string consensus denote the core sequence used by the software, and the core sequence of a matrix is defined as the (usually 4) highest conserved, consecutive positions of the matrix. The consensus sequence also coincides with the well-defined Pax3 binding motif that had been reported previously [14]. To determine whether the identified cis-element can recruit transcription factors to regulate promoter activity, EMSA was performed with nuclear extracts from pCI-Pax3 transfected HEK293T cells (Fig. 1 A). The double-stranded oligonucleotides corresponding to the predicted cis-element in the GFAP promoter formed sequence-specific DNA–protein complexes with the nuclear extracts of Pax3-expressing HEK293T cells, while the mutated P1 and P2 probes failed to generate such a DNA–protein complex (Fig. 1A) in the EMSA. Finally, we performed EMSA supershift analysis with nuclear extracts from pCI-Pax3-transfected HEK 293Tcells and anti-Pax3 antibody. The presence of the anti-Pax3 antibody generated the supershifted band (Fig. 1B). These results indicate that Pax3 binds to P1 and P2 elements on the GFAP promoter. Figure 1Open in figure viewerPowerPoint Pax3 binds to the P1 and P2 elements in the GFAP promoter and negatively regulates GFAP expression in vitro. (A) Nuclear extracts from HEK293T cells ectopically expressing Pax3 were incubated with biotin labeled probes corresponding to P1 and P2 elements, respectively, to determine whether they could form the complex. In both P1 and P2 panels, Lane 1, negative control with probe only. Lane 2, 3 and 4, nuclear extracts from pCI-Pax3 transfected HEK293T cells. Lane 3, nuclear extracts were incubated with 200-fold molar excess unlabelled oligonucleotide of identical probe sequence in addition (self competitor). Lane 4, nuclear extracts were incubated with mutated P1 or P2 oligonucleotide (P1M and P2M) (mutation within the core Pax3 binding domain). (B) Anti-Pax3 antibody or goat IgG was added to the reactions for supershift analysis (Lanes 2 and 3). Protein–DNA complexes and antibody-protein–DNA complexes that supershifted are shown with arrows. SS, supershifted complex. (C) Effect of Pax3 on transcriptional activity of the GFAP promoter. The different rat GFAP reporter constructs were co-transfected into RSC96 cells for the luciferase assay. Mutated promoters that specifically delete Pax3 binding elements were introduced into RSC96 cells. Firefly luciferase expression levels were normalized to the luciferase activity of internal Renilla control. The results are the means ± standard deviation (S.D.) of three separate experiments performed in triplicate for each group. One-way analysis of variance (ANOVA) was used for statistical analysis. ∗∗ P < 0.01. The results indicate that both P1 and P2 elements are negative regulatory elements. (D) The effect of Pax3 overexpression on the mRNA level of GFAP in RSC96 cells. The mRNA levels of GFAP after transient transfection of pCI-Pax3 or control pCI-neo were analyzed by RT-PCR. (E) The effect of Pax3 overexpression on the protein level of GFAP in RSC96 cells. The protein levels of GFAP after transient transfection of pCI-Pax3 or control pCI-neo, were analyzed by Western blotting. A t-test was used for statistical analysis, and the results are shown as means ± S.D. ∗ p < 0.05 vs pCI-neo, n = 3. 3.2 P1 and P2 are negative regulatory elements for GFAP transcription To address the effect of P1 and P2 elements on GFAP transcription, we constructed three recombinants containing normal and mutated promoters of GFAP, and performed luciferase reporter gene assays to elicit their effect. The RSC96 cell line is a spontaneously transformed rat Schwann cell line derived from long-term culture of rat primary Schwann cells [15], and it was used for luciferase assay due to its endogenous expression of Pax3, even though at a low level. The normal pGFAP2000 luciferase promoter construct showed low transcription activity, while absence of P1 or/and P2 in the promoter resulted in an obvious increase of transcription activity (Fig. 1C). These results indicate that these Pax3 binding sequences are negative regulatory elements for GFAP transcription. 3.3 Pax3 inhibits GFAP expression in RSC96 cells Subsequently, we performed RT-PCR and western blotting to measure the mRNA and protein expression levels of GFAP in both Pax3-overexpressing RSC96 cells and control RSC96 cells. RSC96 cells showed endogenous expression of GFAP as well, and the ectopically expressed Pax3 decreased the GFAP level. The results indicated that the expression of Pax3 is inversely related to the expression of GFAP both at the mRNA and protein levels (Fig. 1D and E), suggesting that Pax3 negatively regulates GFAP gene expression. 3.4 Pax3 negatively regulates GFAP expression during astrocyte differentiation GFAP expression is a characteristic marker of astrocyte maturation, and we asked whether Pax3-mediated regulation is involved in this process. The serum-induced astrocyte differentiation model was applied in our study. In our preliminary study, non-specific staining of Pax3 antibody to neurospheres was observed. Therefore, we used only dispersed NSCs in this experiment, while intact neurospheres were used in the following assays. NSCs derived from the cerebral cortex were nestin (data not shown) and Pax3 positive but GFAP negative, and they differentiated into GFAP-positive astrocytes in response to FBS (Fig. 2 A and B). The differentiated astrocytes were positively stained by S100beta antibody as well (Supplementary data). We further measured Pax3 and GFAP level of NSCs before and after differentiation by Immunocytochemistry and RT-PCR. After differentiation, the expression of Pax3 clearly decreased. The signal could not be detected by immunostaining, and only a weak band was observed by RT-PCR owing to the high sensitivity of PCR. In the meantime, the expression of GFAP increased dramatically (Fig. 2C), which suggests a negative regulatory role of Pax3 on the GFAP expression. Figure 2Open in figure viewerPowerPoint The expression of Pax3 and GFAP in control and differentiated NSCs. (A) Control NSCs were labeled with specific antibody or probes (green; GFAP, red; Pax3, blue; Hoechst). (B) The NSCs differentiated into GFAP-positive astrocytes upon serum treatment for 3 days. (C) RT-PCR was performed to measure Pax3 and GFAP level in control and differentiated NSCs. A t-test was used for statistical analysis, and the results are shown as means ± S.D. ∗ p < 0.05; ∗∗ P < 0.01 vs NSC, n = 3. 3.5 Pax3 binds the promoter region of endogenous GFAP in NSCs The next question was whether Pax3 could bind to the promoter region of endogenous GFAP in the context of native chromatin. Therefore, a ChIP assay was performed to address this issue. The Pax3 antibody specifically immunoprecipitated a Pax3–DNA complex in the proximal region of the GFAP promoter, and the binding of Pax3 to the P1 and P2 regions was subsequently demonstrated by PCR performed with specific primers in both undifferentiated and differentiated NSCs (Fig. 3 ). The results indicated that Pax3 indeed occupies the promoter region of GFAP before the differentiation response is triggered, and the binding could not be detected after GFAP expression had been initiated. The results further support the idea that Pax3 functions in transcriptional regulation. Figure 3Open in figure viewerPowerPoint Chromatin immunoprecipitation assays indicating that Pax3 occupied the promoter of the endogenous GFAP gene in undifferentiated NSCs, but not in differentiated NSCs (FBS medium). The specific anti-Pax3 antibody or control normal mouse IgG was used for immunoprecipitations. The products of PCR amplifications for P1 (159 bp) and P2 (358 bp) from the proximal region of the GFAP promoter are shown. 3.6 The effect of overexpression and suppression of Pax3 on astrocyte differentiation Finally, we examined whether overexpression and suppression of Pax3 modulated the differentiation of NSCs. NSCs were regarded to be differentiated when the neurospheres were attached and cell spreading was observed, and the NSCs remaining as neurospheres were taken as undifferentiated. Overexpression of Pax3 dramatically inhibited astrogliogenesis and promoted maintenance of NSCs. GFAP expression was also suppressed as expected (Fig. 4 A1, A2 and A3). However, when endogenous Pax3 was knocked down in neurospheres with shRNA, GFAP (Fig. 4B1, B2 and B3) and S100beta (Supplementary data) expression were observed, which indicates that astrocyte differentiation occurred in the absence of FBS. These results imply a critical role for Pax3 not only in GFAP expression, but also in the maintenance of the undifferentiated state of NSCs. Figure 4Open in figure viewerPowerPoint Pax3 negatively regulates astrocyte differentiation of NSCs. (A) Overexpression of Pax3 inhibited NSCs induced to differentiate by 1% FBS. (A1) The neurospheres infected with control GFP-adenovirus differentiated upon serum treatment for 3 days. (A2) Differentiation of neurospheres infected with Pax3-adenovirus was dramatically inhibited. (A3) The ratio of differentiated/undifferentiated neurospheres is shown as means ± S.D. from three independent experiments. Statistical analysis was performed using a t-test, ∗∗ P < 0.01 vs. control. (B) Suppression of Pax3 by shRNA in NSCs stimulated astrocyte differentiation of NSCs. (B1) Neurospheres infected with control GFP-adenovirus remained undifferentiated after incubation in serum-free medium for 3 days. (B2) Neurospheres infected with shPax3-adenovirus underwent differentiation after 3 days in the absence of serum. (B3) The ratio of differentiated neurospheres is shown as means ± S.D. from three independent experiments. Statistical analysis was performed using a t-test, ∗∗ P < 0.01 vs. control. 4 Discussion GFAP has previously been considered to be directly correlated with Pax3 expression in sciatic nerve repair, serving as a positively regulated target of Pax3 [16]. However, no supporting evidence focused on the transcriptional relationship between Pax3 and GFAP has been reported. Here, we first identified two Pax3 binding elements in GFAP promoter and demonstrated that Pax3 inhibits GFAP transcription in RSC96 cells (spontaneously transformed Schwann cells). Since GFAP is the major intermediate filament protein in mature astrocytes, and GFAP mRNA has been reported to initiate from a different site in Schwann cells than in astrocytes, the transcription of GFAP may differ between Schwann cells and astrocytes [17, 18]. We further determined the effect of Pax3 on astrocyte differentiation and GFAP expression. Our results indicated that Pax3 acts as a transcriptional repressor during serum-induced astrocyte differentiation of NSCs. Pax3 was also reported to be a negative regulator of terminal differentiation by binding to sites located upstream of the myelin basic protein (MBP) promoter [11]. Hence, it is reasonable to speculate that Pax3 represses expression of GFAP during embryonic development. In addition, the Pax3 binding sites were also identified in the promoter of mouse and human GFAP gene with the same consensus motif by Genomatix software, with the binding sites being located 6.5 and 8.5 Kb upstream of transcription start site in mouse and human, respectively. This supports the generality of our reported findings among different species. The requirement of a decrease in Pax3 for appropriate expression of GFAP during astrocytogenesis is suggested by our observations that neurospheres infected with Pax3-expressing adenovirus failed to differentiate into astrocytes in response to serum. These observations are consistent with reports that Pax3 is required for maintaining cells in an undifferentiated state. A well-known example is that persistent maintenance of Pax3 expression in neural crest cells blocks neural crest-derived osteoblast differentiation [19]. Our data show that suppression of Pax3 by shRNA induced astrocyte differentiation of NSCs without serum. Similarly, neural crest cells in Splotch mice were reported to undergo premature neurogenesis [20], and downregulation of Pax3 in neural crest cultures inhibits sensory neuron differentiation without affecting survival of sensory neurons or precursor populations [21]. It is now well recognized that transcriptional regulation is an extremely complex and tightly controlled process and is the result of finely balanced activities of activator and repressor proteins. The actual transcription level of a gene is determined by a combination of cis-elements and trans-factors available within cells during a certain physiological or pathological process. Pax3 physically interacts with the transcription factor Sox10 to specify melanoblasts from neural crest cells [22]. The binding sites of Sox family transcription factors were also identified in the promoter region of GFAP by Genomatix software (http://www.genomatix.de). Whether they are involved in transcription suppression is an interesting issue for future study. In conclusion, we have first shown that Pax3 binds to the GFAP promoter and negatively regulates GFAP expression and astrocyte differentiation from NSCs. Pax3 can be considered a regulator of NSC differentiation and may determine cell fate and simultaneously maintain an undifferentiated state, leaving the cells poised to differentiate in response to external stimuli. An important focus for future investigations will be to identify the upstream regulators of Pax3 genes during serum-induced astrocyte differentiation of NSCs, which will link the extracellular signal to the expression of GFAP and should further facilitate our understanding of the transcriptional mechanism of GFAP gene. Acknowledgments This research was supported by the grants from (863 Program, Grant No. 2006AA02A128), National Natural Science Foundation of China (31071874), Basic Research Program of Jiangsu Education Department (09KJA180005, CX09S019Z), Research Program of Education Ministry (208044) and Natural Science Foundation of Jiangsu Province (BK2010274). Appendix A A Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.febslet.2011.02.034. Supporting Information Filename Description feb2s0014579311001384-sup-f0025.jpgapplication/jpg, 185.3 KB Supplementary Figure 1. The expression of Pax3 and S100beta in control and differentiated NSCs. (A) Control NSCs were labeled with specific antibody or probes (green; S100, red; Pax3, blue; Hoechst). (B) NSCs differentiated into S100 and GFAP-positive astrocytes upon serum treatment for 3 days (green; GFAP, red; S100, blue; Hoechst). feb2s0014579311001384-sup-f0030.jpgapplication/jpg, 100.6 KB Supplementary Figure 2. Suppression of Pax3 by shRNA in NSCs stimulated astrocyte differentiation of NSCs. (A) Neurospheres infected with control GFP-adenovirus remained undifferentiated in serum-free medium for 3 days. (B) Neurospheres infected with shPax3-adenovirus underwent differentiation after 3 days in the absence of serum (red; S100, blue; Hoechst). Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article. References 1 A. Bonni, Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway. Science, 278, (1997), 477– 483. CrossrefCASPubMedWeb of Science®Google Scholar 2 B. Cebolla, A. Fernandez-Perez, G. Perea, A. Araque, M. Vallejo, DREAM mediates cAMP-dependent, Ca2+-induced stimulation of GFAP gene expression and regulates cortical astrogliogenesis. J. Neurosci., 28, (2008), 6703– 6713. CrossrefCASPubMedWeb of Science®Google Scholar 3 R.E. Gross, M.F. Mehler, P.C. Mabie, Z. Zang, L. Santschi, J.A. Kessler, Bone morphogenetic proteins promote astroglial lineage commitment by mammalian subventricular zone progenitor cells. Neuron, 17, (1996), 595– 606. CrossrefCASPubMedWeb of Science®Google Scholar 4 I. Vallejo, M. Vallejo, Pituitary adenylate cyclase-activating polypeptide induces astrocyte differentiation of precursor cells from developing cerebral cortex. Mol. Cell. Neurosci., 21, (2002), 671– 683. CrossrefCASPubMedWeb of Science®Google Scholar 5 S.C. Barnett, M. Rosario, A. Doyle, A. Kilbey, A. Lovatt, D.A. Gillespie, Differential regulation of AP-1 and novel TRE-specific DNA-binding complexes during differentiation of oligodendrocyte-type-2-astrocyte (O-2A) progenitor cells. Development, 121, (1995), 3969– 3977. PubMedWeb of Science®Google Scholar 6 B. Cebolla, M. Vallejo, Nuclear factor-I regulates glial fibrillary acidic protein gene expression in astrocytes differentiated from cortical precursor cells. J. Neurochem., 97, (2006), 1057– 1070. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 7 K. Nakashima, M. Yanagisawa, H. Arakawa, N. Kimura, T. Hisatsune, M. Kawabata, K. Miyazono, T. Taga, Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science, 284, (1999), 479– 482. CrossrefCASPubMedWeb of Science®Google Scholar 8 P. Rajan, D.M. Panchision, L.F. Newell, R.D. McKay, BMPs signal alternately through a SMAD or FRAP-STAT pathway to regulate fate choice in CNS stem cells. J. Cell Biol., 161, (2003), 911– 921. CrossrefCASPubMedWeb of Science®Google Scholar 9 D.J. Epstein, M. Vekemans, P. Gros, Splotch (Sp2H), a mutation affecting development of the mouse neural tube, shows a deletion within the paired homeodomain of Pax-3. Cell, 67, (1991), 767– 774. CrossrefCASPubMedWeb of Science®Google Scholar 10 A. Mansouri, M. Hallonet, P. Gruss, Pax genes and their roles in cell differentiation and development. Curr. Opin. Cell Biol., 8, (1996), 851– 857. CrossrefCASPubMedWeb of Science®Google Scholar 11 C. Kioussi, M.K. Gross, P. Gruss, Pax3: a paired domain gene as a regulator in PNS myelination. Neuron, 15, (1995), 553– 562. CrossrefCASPubMedWeb of Science®Google Scholar 12 R. Kaneko, N. Hagiwara, K. Leader, N. Sueoka, Glial-specific cAMP response of the glial fibrillary acidic protein gene cell lines. Proc. Natl. Acad. Sci. USA, 91, (1994), 4529– 4533. CrossrefCASPubMedWeb of Science®Google Scholar 13 X.M. Zhou, A rat model for studying neural stem cell transplantation. Acta Pharmacol. Sin., 30, (2009), 1496– 1504. CrossrefCASPubMedWeb of Science®Google Scholar 14 G. Chalepakis, P. Gruss, Identification of DNA recognition sequences for the Pax3 paired domain. Gene, 162, (1995), 267– 270. CrossrefCASPubMedWeb of Science®Google Scholar 15 A. Badache, G.H. De Vries, Neurofibrosarcoma-derived Schwann cells overexpress platelet-derived growth factor (PDGF) receptors and are induced to proliferate by PDGF BB. J. Cell Physiol., 177, (1998), 334– 342. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 16 C. Kioussi, P. Gruss, Making of a Schwann. Trends Genet., 12, (1996), 84– 86. CrossrefCASPubMedWeb of Science®Google Scholar 17 D.L. Feinstein, G.A. Weinmaster, R.J. Milner, Isolation of cDNA clones encoding rat glial fibrillary acidic protein: expression in astrocytes and in Schwann cells. J. Neurosci. Res., 32, (1992), 1– 14. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 18 M. Su, H. Hu, Y. Lee, A. d'Azzo, A. Messing, M. Brenner, Expression specificity of GFAP transgenes. Neurochem. Res., 29, (2004), 2075– 2093. CrossrefCASPubMedWeb of Science®Google Scholar 19 M. Wu, J. Li, K.A. Engleka, B. Zhou, M.M. Lu, J.B. Plotkin, J.A. Epstein, Persistent expression of Pax3 in the neural crest causes cleft palate and defective osteogenesis in mice. J. Clin. Invest., 118, (2008), 2076– 2087. CASPubMedWeb of Science®Google Scholar 20 H. Nakazaki, Key basic helix-loop-helix transcription factor genes Hes1 and Ngn2 are regulated by Pax3 during mouse embryonic development. Dev. Biol., 316, (2008), 510– 523. CrossrefCASPubMedWeb of Science®Google Scholar 21 S.A. Koblar, M. Murphy, G.L. Barrett, A. Underhill, P. Gros, P.F. Bartlett, Pax-3 regulates neurogenesis in neural crest-derived precursor cells. J. Neurosci. Res., 56, (1999), 518– 530. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 22 D.J. Smit, A.G. Smith, P.G. Parsons, G.E. Muscat, R.A. Sturm, Domains of Brn-2 that mediate homodimerization and interaction with general and melanocytic transcription factors. Eur. J. Biochem., 267, (2000), 6413– 6422. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Citing Literature Volume585, Issue7April 06, 2011Pages 1014-1020 FiguresReferencesRelatedInformation
Referência(s)