Inhibition of Membrane Lipid-independent Protein Kinase Cα Activity by Phorbol Esters, Diacylglycerols, and Bryostatin-1
1998; Elsevier BV; Volume: 273; Issue: 36 Linguagem: Inglês
10.1074/jbc.273.36.23160
ISSN1083-351X
AutoresSimon J. Slater, Frank J. Taddeo, Anthony Mazurek, Brigid A. Stagliano, Shawn K. Milano, Mary Beth Kelly, Cojen Ho, Christopher D. Stubbs,
Tópico(s)Melanoma and MAPK Pathways
ResumoThe activity of membrane-associated protein kinase C (PKC) has previously been shown to be regulated by two discrete high and low affinity binding regions for diacylglycerols and phorbol esters (Slater, S. J., Ho, C., Kelly, M. B., Larkin, J. D., Taddeo, F. J., Yeager, M. D., and Stubbs, C. D. (1996) J. Biol. Chem. 271, 4627–4631). PKC is also known to interact with both cytoskeletal and nuclear proteins; however, less is known concerning the mode of activation of this non-membrane form of PKC. By using the fluorescent phorbol ester, sapintoxin D (SAPD), PKCα, alone, was found to possess both low and high affinity phorbol ester-binding sites, showing that interaction with these sites does not require association with the membrane. Importantly, a fusion protein containing the isolated C1A/C1B (C1) domain of PKCα also bound SAPD with low and high affinity, indicating that the sites may be confined to this domain rather than residing elsewhere on the enzyme molecule. Both high and low affinity interactions with native PKCα were enhanced by protamine sulfate, which activates the enzyme without requiring Ca2+ or membrane lipids. However, this “non-membrane” PKC activity was inhibited by the phorbol ester 4β-12-O-tetradecanoylphorbol-13-acetate (TPA) and also by the fluorescent analog, SAPD, opposite to its effect on membrane-associated PKCα. Bryostatin-1 and the soluble diacylglycerol, 1-oleoyl-2-acetylglycerol, both potent activators of membrane-associated PKC, also competed for both low and high affinity SAPD binding and inhibited protamine sulfate-induced activity. Furthermore, the inactive phorbol ester analog 4α-TPA (4α-12-O-tetradecanoylphorbol-13-acetate) also inhibited non-membrane-associated PKC. In keeping with these observations, although TPA could displace high affinity SAPD binding from both forms of the enzyme, 4α-TPA was only effective at displacing high affinity SAPD binding from non-membrane-associated PKC. 4α-TPA also displaced SAPD from the isolated C1 domain. These results show that although high and low affinity phorbol ester-binding sites are found on non-membrane-associated PKC, the phorbol ester binding properties change significantly upon association with membranes. The activity of membrane-associated protein kinase C (PKC) has previously been shown to be regulated by two discrete high and low affinity binding regions for diacylglycerols and phorbol esters (Slater, S. J., Ho, C., Kelly, M. B., Larkin, J. D., Taddeo, F. J., Yeager, M. D., and Stubbs, C. D. (1996) J. Biol. Chem. 271, 4627–4631). PKC is also known to interact with both cytoskeletal and nuclear proteins; however, less is known concerning the mode of activation of this non-membrane form of PKC. By using the fluorescent phorbol ester, sapintoxin D (SAPD), PKCα, alone, was found to possess both low and high affinity phorbol ester-binding sites, showing that interaction with these sites does not require association with the membrane. Importantly, a fusion protein containing the isolated C1A/C1B (C1) domain of PKCα also bound SAPD with low and high affinity, indicating that the sites may be confined to this domain rather than residing elsewhere on the enzyme molecule. Both high and low affinity interactions with native PKCα were enhanced by protamine sulfate, which activates the enzyme without requiring Ca2+ or membrane lipids. However, this “non-membrane” PKC activity was inhibited by the phorbol ester 4β-12-O-tetradecanoylphorbol-13-acetate (TPA) and also by the fluorescent analog, SAPD, opposite to its effect on membrane-associated PKCα. Bryostatin-1 and the soluble diacylglycerol, 1-oleoyl-2-acetylglycerol, both potent activators of membrane-associated PKC, also competed for both low and high affinity SAPD binding and inhibited protamine sulfate-induced activity. Furthermore, the inactive phorbol ester analog 4α-TPA (4α-12-O-tetradecanoylphorbol-13-acetate) also inhibited non-membrane-associated PKC. In keeping with these observations, although TPA could displace high affinity SAPD binding from both forms of the enzyme, 4α-TPA was only effective at displacing high affinity SAPD binding from non-membrane-associated PKC. 4α-TPA also displaced SAPD from the isolated C1 domain. These results show that although high and low affinity phorbol ester-binding sites are found on non-membrane-associated PKC, the phorbol ester binding properties change significantly upon association with membranes. protein kinase C 4α-12-O-tetradecanoylphorbol-13-acetate bovine brain phosphatidylserine glutathioneS-transferase 1-oleoyl-2-acetyl-glycerol 1-palmitoyl-2-phosphatidylcholine resonance energy transfer sapintoxin-D 4β-12-O-tetradecanoylphorbol-13-acetate phorbol 12,13-dibutyrate phosphatidylserine. Protein kinase C (PKC)1constitutes a group of isozymes that are central in cellular signaling pathways that regulate numerous cellular processes, including cell growth, differentiation, and metabolism (1Nishizuka Y. FASEB J. 1995; 9: 484-496Crossref PubMed Scopus (2345) Google Scholar). Each isoform can be classified into one of three major classes according to the cofactor and activator requirements. The “conventional” PKCα, -βI, -βII, and -γ isoforms are Ca2+- and anionic phospholipid-dependent, whereas the “novel” PKCδ, -ε, -η, and -θ and “atypical” PKCζ and -λ isozymes retain a phospholipid dependence but lack a Ca2+ requirement (2Stabel S. Parker P.J. Pharmacol. Ther. 1991; 51: 71-95Crossref PubMed Scopus (452) Google Scholar). In addition, the activities of all PKC isoforms, except atypical PKC, are potentiated by the lipid second messenger, diacylglycerol, derived from the receptor-G-protein and phospholipase-catalyzed hydrolysis of phosphatidylinositides and phosphatidylcholines (3Exton J.H. Curr. Opin. Cell Biol. 1994; 6: 226-229Crossref PubMed Scopus (35) Google Scholar) and also by the potent tumor-promoting phorbol esters (4Newton A.C. J. Biol. Chem. 1995; 270: 28495-28498Abstract Full Text Full Text PDF PubMed Scopus (1460) Google Scholar). The Ca2+ and phospholipid requirements for PKC activity differ according to the lysine and arginine content of the substrate (5Nishizuka Y. Science. 1986; 233: 305-312Crossref PubMed Scopus (4014) Google Scholar). Thus, the PKC-catalyzed phosphorylation of the lysine-rich protein, histone H1, requires the presence of both Ca2+ and phospholipid, whereas the phosphorylation of the arginine-rich protein, protamine sulfate, requires neither cofactor (6Leventhal P.S. Bertics P.J. J. Biol. Chem. 1993; 268: 13906-13913Abstract Full Text PDF PubMed Google Scholar, 7Bazzi M.D. Nelsestuen G.L. Biochemistry. 1987; 26: 1974-1982Crossref PubMed Scopus (143) Google Scholar, 8Bazzi M.D. Nelsestuen G.L. Biochemistry. 1987; 26: 5002-5008Crossref PubMed Scopus (44) Google Scholar, 9Glynn B. Colliton J. McDermott J. Witters L.A. Biochem. J. 1985; 231: 489-492Crossref PubMed Scopus (12) Google Scholar, 10Ferrari S. Marchiori F. Marin O. Pinna L.A. Eur. J. Biochem. 1987; 163: 481-487Crossref PubMed Scopus (30) Google Scholar). The mechanism of activation by protamine sulfate, which also acts as a substrate, has been suggested to involve a binding site(s) for arginine-rich proteins on the PKC molecule, separate from the active center of the enzyme (6Leventhal P.S. Bertics P.J. J. Biol. Chem. 1993; 268: 13906-13913Abstract Full Text PDF PubMed Google Scholar,11Bruins R.H. Epand R.M. Arch. Biochem. Biophys. 1995; 324: 216-222Crossref PubMed Scopus (18) Google Scholar). Similar to that which occurs upon membrane association induced by Ca2+ and diacylglycerol or phorbol esters, interaction with protamine sulfate has been suggested to mediate in an allosteric activating conformational change resulting in the removal of a pseudosubstrate region from the active site which, in the inactive state, blocks substrate binding (12Pears C.J. Kour G. House C. Kemp B.E. Parker P.J. Eur. J. Biochem. 1990; 194: 89-94Crossref PubMed Scopus (110) Google Scholar). Therefore, use of protamine sulfate provides a useful model for the activation of PKC in the absence of lipids by interaction with other proteins. The question of the mechanism by which PKC activity induced by protein-protein interactions is regulated has become an urgent concern, since it has become apparent that there are a large number of non-membrane protein targets for the enzyme, such as, for example, cytoskeletal and nuclear elements (e.g. Refs. 13Murti K.G. Kaur K. Goorha R.M. Exp. Cell Res. 1992; 202: 36-44Crossref PubMed Scopus (78) Google Scholar, 14Spudich A. Meyer T. Stryer L. Cell Motil. Cytoskeleton. 1992; 22: 250-256Crossref PubMed Scopus (49) Google Scholar, 15Hyatt S.L. Liao L. Chapline C. Jaken S. Biochemistry. 1994; 33: 1223-1228Crossref PubMed Scopus (80) Google Scholar, 16Buchner K. Eur. J. Biochem. 1995; 228: 211-221Crossref PubMed Scopus (159) Google Scholar, 17Cardellini E. Durban E. Biochem. J. 1993; 291: 303-307Crossref PubMed Scopus (35) Google Scholar, 18Beckmann R. Buchner K. Jungblut P.R. Eckerskorn C. Weise C. Hilbert R. Hucho F. Eur. J. Biochem. 1992; 210: 45-51Crossref PubMed Scopus (56) Google Scholar, 19Goss V.L. Hocevar B.A. Thompson L.J. Stratton C.A. Burns D.J. Fields A.P. J. Biol. Chem. 1994; 269: 19074-19080Abstract Full Text PDF PubMed Google Scholar, 20Mochly-Rosen D. Science. 1995; 268: 247-251Crossref PubMed Scopus (830) Google Scholar, 21Jaken S. Curr. Opin. Cell Biol. 1996; 8: 168-173Crossref PubMed Scopus (406) Google Scholar). Although interaction with arginine-rich proteins such as protamine sulfate relieves the Ca2+ and phospholipid requirements for PKC activity, it is not known whether this non-membrane PKC activity is modulated by phorbol esters and/or diacylglycerols in a similar manner to the membrane-associated enzyme. Evidence supporting this possibility was provided recently by the finding that PKCδ is capable of binding phorbol esters with low affinity in the absence of membrane lipids (22Kazanietz M.G. Barchi Jr., J.J. Omichinski J.G. Blumberg P.M. J. Biol. Chem. 1995; 270: 14679-14684Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) and that these compounds can induce binding of PKCε to filamentous actin (F-actin) (23Prekeris R. Mayhew M.W. Cooper J.B. Terrain D.M. Cell. 1996; 132: 77-90Crossref Scopus (227) Google Scholar). Although F-actin itself was not found to be a substrate for this isoform, this may lead to enhanced phosphorylation of other protein targets. PKCβII has also been shown to bind F-actin which is reported to be a substrate for this isoform (24Blobe G.C. Stribling D.S. Fabbro D. Stabel S. Hannun Y.A. J. Biol. Chem. 1996; 271: 15823-15830Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). In this respect, F-actin can be considered to be an example of a number of specific intracellular proteins that bind the activated form of PKC, termed “receptors for activated C-kinase” (RACKs) (20Mochly-Rosen D. Science. 1995; 268: 247-251Crossref PubMed Scopus (830) Google Scholar, 21Jaken S. Curr. Opin. Cell Biol. 1996; 8: 168-173Crossref PubMed Scopus (406) Google Scholar), which allow precise targeting of PKC isoforms to specific cellular locations. However, the non-membrane, phorbol-induced interaction of PKC with F-actin departs from the original definition of RACKs that were described as proteins that bind PKC that has been activated by membrane association (25Mochly-Rosen D. Khaner H. Lopez J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3997-4000Crossref PubMed Scopus (437) Google Scholar). For membrane-associated PKC, activation by diacylglycerol proceeds by two parallel mechanisms. The first involves an increased affinity for the membrane, which is revealed as a decrease in the concentrations of both Ca2+ and anionic phospholipid required for maximal activity (4Newton A.C. J. Biol. Chem. 1995; 270: 28495-28498Abstract Full Text Full Text PDF PubMed Scopus (1460) Google Scholar, 26Kishimoto A. Takai Y. Mori T. Kikkawa U. Nishizuka Y. J. Biol. Chem. 1980; 255: 2273-2276Abstract Full Text PDF PubMed Google Scholar, 27Bazzi M.D. Nelsestuen G.L. Biochemistry. 1990; 29: 7624-7630Crossref PubMed Scopus (98) Google Scholar). Second, interaction with diacylglycerol and phosphatidylserine induces an activating conformational change that results in the folding out of an N-terminal pseudosubstrate region (12Pears C.J. Kour G. House C. Kemp B.E. Parker P.J. Eur. J. Biochem. 1990; 194: 89-94Crossref PubMed Scopus (110) Google Scholar,28House C. Kemp B.E. Science. 1987; 238: 1726-1728Crossref PubMed Scopus (782) Google Scholar, 29Nakadate T. Jeng A.Y. Blumberg P.M. J. Biol. Chem. 1987; 262: 11507-11513Abstract Full Text PDF PubMed Google Scholar, 30Makowske M. Rosen O.M. J. Biol. Chem. 1989; 264: 16155-16159Abstract Full Text PDF PubMed Google Scholar, 31Orr J.W. Keranen L.M. Newton A.C. J. Biol. Chem. 1992; 267: 15263-15266Abstract Full Text PDF PubMed Google Scholar). Phorbol esters have been suggested to potentiate PKC activity in a similar manner to diacylglycerol so that the two activator types initially appeared to share a single site or two identical sites of interaction on the enzyme (4Newton A.C. J. Biol. Chem. 1995; 270: 28495-28498Abstract Full Text Full Text PDF PubMed Scopus (1460) Google Scholar, 32Sharkey N.A. Leach K.L. Blumberg P.M. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 607-610Crossref PubMed Scopus (289) Google Scholar, 33Sharkey N.A. Blumberg P.M. Biochem. Biophys. Res. Commun. 1985; 133: 1051-1056Crossref PubMed Scopus (35) Google Scholar). However, in recent studies of activator binding to PKCα, using the fluorescent phorbol ester sapintoxin D (SAPD), we showed that diacylglycerols and phorbol esters interact with differing affinities with two activator binding sites on the enzyme molecule (34Slater S.J. Kelly M.B. Taddeo F.J. Rubin E. Stubbs C.D. J. Biol. Chem. 1994; 269: 17160-17165Abstract Full Text PDF PubMed Google Scholar, 35Slater S.J. Ho C. Kelly M.B. Larkin J.D. Taddeo F.J. Yeager M.D. Stubbs C.D. J. Biol. Chem. 1996; 271: 4627-4631Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 36Slater S.J. Kelly M.B. Larkin J.D. Ho C. Mazurek A. Taddeo F.J. Yeager M.D. Stubbs C.D. J. Biol. Chem. 1997; 272: 6167-6173Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Furthermore, it was shown that the site with low affinity for phorbol esters binds diacylglycerol with a relatively higher affinity, suggesting that the specificity of this site may differ from the high affinity phorbol ester-binding site (35Slater S.J. Ho C. Kelly M.B. Larkin J.D. Taddeo F.J. Yeager M.D. Stubbs C.D. J. Biol. Chem. 1996; 271: 4627-4631Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Interaction of diacylglycerol with this low affinity phorbol ester-binding site was found to lead to an enhancement in the level of high affinity phorbol ester binding and consequently to a potentiated level of PKC activity. By contrast to diacylglycerol, the potent PKC activator and anti-tumor agent, bryostatin-1, was found to compete more effectively for high affinity phorbol ester binding and did not potentiate the level of phorbol ester-induced PKC activity. Based on these results, a model for PKC activation was proposed in which interaction of an activator with the low affinity for phorbol ester-binding site leads to an enhanced level of binding of either the same or a second activator to the high affinity phorbol ester-binding site and consequently to an elevated level of PKCα activity (35Slater S.J. Ho C. Kelly M.B. Larkin J.D. Taddeo F.J. Yeager M.D. Stubbs C.D. J. Biol. Chem. 1996; 271: 4627-4631Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). The activator binding site with relatively high affinity for phorbol esters likely resides within the C1 domain, which consists of two cystine-rich zinc finger motifs, termed C1A and C1B (37Hurley J.H. Newton A.C. Parker P.J. Blumberg P.M. Nishizuka Y. Protein Sci. 1997; 6: 477-480Crossref PubMed Scopus (313) Google Scholar). Interaction of phorbol esters with these subdomains has been extensively characterized by truncation/deletion and mutagenesis studies (38Kazanietz M.G. Wang S. Milne G.W.A. Lewin N.E. Liu H.L. Blumberg P.M. J. Biol. Chem. 1995; 270: 21852-21859Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 39Burns D.J. Bell R.M. J. Biol. Chem. 1991; 266: 18330-18338Abstract Full Text PDF PubMed Google Scholar, 40Quest A.F.G. Bardes E.S.G. Bell R.M. J. Biol. Chem. 1994; 269: 2953-2960Abstract Full Text PDF PubMed Google Scholar, 41Quest A.F.G. Bardes E.S.G. Bell R.M. J. Biol. Chem. 1994; 269: 2961-2970Abstract Full Text PDF PubMed Google Scholar, 42Quest A.F.G. Bell R.M. J. Biol. Chem. 1994; 269: 20000-20012Abstract Full Text PDF PubMed Google Scholar) along with both crystal (43Zhang G. Kazanietz M.G. Blumberg P.M. Hurley J.H. Cell. 1995; 81: 917-924Abstract Full Text PDF PubMed Scopus (590) Google Scholar) and solution-state structural determinations (44Wender P.A. Irie K. Miller B.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 239-243Crossref PubMed Scopus (53) Google Scholar, 45Ichikawa S. Hatanaka H. Takeuchi Y. Ohno S. Inagaki F. J. Biochem. (Tokyo). 1995; 117: 566-574Crossref PubMed Scopus (61) Google Scholar). By using glutathione S-transferase (GST) fusion proteins containing either the C1A or C1B subdomains, it has been shown that both are capable of binding phorbol esters (39Burns D.J. Bell R.M. J. Biol. Chem. 1991; 266: 18330-18338Abstract Full Text PDF PubMed Google Scholar, 42Quest A.F.G. Bell R.M. J. Biol. Chem. 1994; 269: 20000-20012Abstract Full Text PDF PubMed Google Scholar,46Irie K. Yanai Y. Oie K. Ishizawa J. Nakagawa Y. Ohigashi H. Wender P.A. Kikkawa U. Bioorg. Med. Chem. 1997; 5: 1725-1737Crossref PubMed Scopus (33) Google Scholar). However, the phorbol ester binding affinities of the two subdomains may differ for each PKC isoform. For example, whereas PKCγ C1A and C1B appear to bind phorbol esters with similar affinities, in the case of the novel PKCs, PKCη and PKCδ C1B bind phorbol esters with higher affinity than C1B (47Yanai Y. Irie K. Ohigashi H. Wender P.A. Bioorg. & Med. Chem. Lett. 1997; 7: 117-122Crossref Scopus (11) Google Scholar, 48Hunn M. Quest A.F. FEBS Lett. 1997; 400: 226-232Crossref PubMed Scopus (45) Google Scholar). Recent studies have indicated that these isoform-specific differences in phorbol ester binding to C1A and C1B may be carried over into the native enzyme. While for PKCδ C1B has been identified as being a high affinity phorbol ester-binding site, due to its role in phorbol ester-induced intracellular translocation (49Szallasi Z. Bogi K. Gohari S. Biro T. Acs P. Blumberg P.M. J. Biol. Chem. 1996; 271: 18299-18301Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar), for PKCγ the high affinity site may correspond to C1A (46Irie K. Yanai Y. Oie K. Ishizawa J. Nakagawa Y. Ohigashi H. Wender P.A. Kikkawa U. Bioorg. Med. Chem. 1997; 5: 1725-1737Crossref PubMed Scopus (33) Google Scholar). The first aim of this study was to determine if the high and low affinity activator binding sites, previously identified on membrane-associated PKCα (35Slater S.J. Ho C. Kelly M.B. Larkin J.D. Taddeo F.J. Yeager M.D. Stubbs C.D. J. Biol. Chem. 1996; 271: 4627-4631Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar), similarly exist on the non-membrane form of this isoform. Second, the effects of phorbol esters and other activators of membrane-associated PKC on lipid-independent activity induced by protein-protein interactions with protamine sulfate were determined. Finally, while the high affinity phorbol ester-binding site clearly resides with the C1 domain, whether the low affinity binding site is similarly located was also investigated. The results indicate that both high and low affinity phorbol ester-binding sites on non-membrane PKCα pre-exist in the absence of membrane lipids and that both sites are confined within the C1 domain of this isoform. However, phorbol esters, diacylglycerol, and bryostatin-1, although clearly described as being potent activators of membrane-associated PKCα, are shown in the present study to be potent inhibitors of non-membrane PKCα activity induced by protamine sulfate. SAPD was from Calbiochem. 4β-12-O-Tetradecanoylphorbol-13-acetate (TPA), 4α-12-O-tetradecanoylphorbol-13-acetate (4α-TPA), and protamine sulfate were from Sigma. Bryostatin-1 was obtained from Alexis Biochemicals, Inc. (San Diego, CA). Bovine brain phosphatidylserine (BPS), 1-palmitoyl-2-oleoylphosphatidylcholine (POPC), and 1-oleoyl-2-acetoyl-glycerol (OAG) were from Avanti Polar Lipids (Alabaster, AL). Adenosine 5′-triphosphate (ATP) was from Boehringer Mannheim, and [γ-32P]ATP was from NEN Life Science Products. All other chemicals were of analytical grade and obtained from Fisher. The recombinant conventional PKC isoform, PKCα (rat brain), was prepared using the baculovirusSpodoptera frugiperda (Sf9) insect cell expression system (50Burns D.J. Bloomenthal J. Lee M.H. Bell R.M. J. Biol. Chem. 1990; 265: 12044-12051Abstract Full Text PDF PubMed Google Scholar) and purified to homogeneity, as described previously (51Slater S.J. Kelly M.B. Taddeo F.J. Ho C. Rubin E. Stubbs C.D. J. Biol. Chem. 1994; 269: 4866-4871Abstract Full Text PDF PubMed Google Scholar). The specific activity of the PKCα preparation was typically ∼1 nmol min−1 μg−1. Based on evidence that GST stabilizes the isolated C1 domain and to ensure the production of only full-length peptides, the fusion protein, GST-C1-(His)6, was constructed. The nucleotide consensus sequence assigned to the C1 domain of PKCα was that described previously (52Quest A.F. Bardes E.S. Xie W.Q. Willott E. Borchardt R.A. Bell R.M. Methods Enzymol. 1995; 252: 153-167Crossref PubMed Scopus (13) Google Scholar). This was amplified by PCR withPfu polymerase (Stratagene, La Jolla, CA) using full-length rat cDNA as the template. Primers were designed so thatEcoRI and HpaI restriction sites were inserted at the 5′ and 3′ ends of the domain, respectively, to facilitate insertion into pGEX-5X-2 (Amersham Pharmacia Biotech). The reverse primer also encoded a blunt restriction site after the last amino acid of the domain which was utilized to insert a (His)6 sequence (5′-CAT CAC CAT CAC CAT CAC TGA-3′). The domain fragment was subcloned into pGEX-5x-2 yielding a plasmid, the sequence of which was confirmed by dideoxy sequencing (Nucleic Acid Facility, Thomas Jefferson University), that encoded GST-C1-(His)6, a protein-tagged N terminus with GST and C terminus with (His)6. Along with the GST-C1-(His)6, a fusion protein lacking the C1 domain was prepared by insertion of the (His)6 sequence alone into pGEX-5x-2 (GST-(His)6). Escherichia coli BL21 cells harboring the expression plasmids for GST-C1-(His)6 or GST-(His)6 were grown in LB medium containing 100 μg/ml ampicillin until the absorbance at 600 nm (A 600) was ∼1. Expression of the fusion proteins was induced at room temperature with 0.1 mm isopropylthiogalactoside for 4 h, after which the cells were pelleted, washed once with phosphate-buffered saline, re-pelleted, and stored at −80 °C. The fusion proteins were purified from the frozen E. coli pellets as described previously (52Quest A.F. Bardes E.S. Xie W.Q. Willott E. Borchardt R.A. Bell R.M. Methods Enzymol. 1995; 252: 153-167Crossref PubMed Scopus (13) Google Scholar). Briefly, frozen cell pellets were homogenized at 4 °C in buffer A (50 mm Hepes, pH 8.0, 10% ethylene glycol, 1% v/v Triton X-100, 0.5 mg/ml lysozyme, 320 units of benzonase, 1 mm phenylmethylsulfonyl fluoride, 10 mm benzamidine, 4 μg/ml pepstatin A, 4 μg/ml aprotinin, 10 μg/ml leupeptin). The homogenate was placed on ice for 20 min and then centrifuged at 30,000 × g for 30 min at 4 °C. Sufficient dithiothreitol was added to the cleared lysate to a yield a final concentration of 1 mm which was then loaded slowly onto a 1-ml column containing glutathione agarose (Sigma) previously equilibrated with buffer A. The eluate was re-applied to the column two times followed by extensive washing with 1 mm sodium phosphate buffer, pH 7.3, containing 15 mm NaCl, 0.5% v/v Triton X-100. The fusion proteins were eluted in a pH 8.0 buffer containing 50 mm Hepes, 10% v/v ethylene glycol, 15 mm reduced glutathione, and 0.4% w/v sucrose monolaurate. In order to isolate full-length peptides the crude preparation was further purified by metal affinity chromatography using TALON resin (CLONTECH, Palo Alto, CA) according to the manufacturer's procedures. Fractions containing the purified fusion protein (detected by SDS-polyacrylamide gel electrophoresis followed by Coomassie Blue staining) were pooled and dialyzed extensively against 50 mm Hepes, pH 8.0, containing 10% v/v ethylene glycol. The resultant product was finally concentrated by dialysis against the same buffer saturated with polyethylene glycol and stored at −80 °C in the presence of 20% v/v glycerol. To facilitate isolation and purification, a (His)6 affinity tag was added to the C terminus of PKCζ. Briefly, the last 1100 base pairs were amplified by PCR using Pfu polymerase (Stratagene, La Jolla, CA) and using PKCζ cDNA as a template, which was cloned in this laboratory. 2Frank J. Taddeo, Mark D. Yeager, and Christopher D. Stubbs, manuscript in preparation. The reverse primer was designed so that the stop codon was eliminated, and the (His)6 sequence (CATCACCATCACCATCACTGA) followed by a stop codon and an HpaI restriction site was inserted in frame with the coding sequence. The PCR product was gel-purified on 1% agarose, A-tailed using TAQ polymerase and dATP, and subcloned into pCR 2.1 (Invitrogen, Carlsbad, CA). The nucleotide sequence was confirmed by dideoxy sequencing (Nucleic Acid Facility, Thomas Jefferson University). The first 1203 nucleotides of PKCζ were excised from PKCζ/pCR2.1 using EcoRI/BlnI, and the last 576 nucleotides including the (His)6 tag were excised from PKCζ-3′(His)6/pCR2.1 usingBlnI/HpaI. The fragments were gel-purified, ligated into the EcoRI/StuI site of pFastBac1 (Life Technologies, Inc.), and transformed into DH5α E. coli. A clone containing the full-length PKCζ coding sequence including the (His)6 tag was selected by restriction analysis of plasmid DNA. A recombinant baculovirus containing the PKCζ-(His)6 sequence was generated using the Bac-to-Bac Baculovirus Expression System (Life Technologies, Inc.). Sf9 cells were infected with the recombinant baculovirus at a multiplicity of infection of 5, incubated for 3 days at 27 °C, harvested by centrifugation, and pellets stored at −80 °C. Frozen cell pellets were homogenized in 20 mm Tris/HCl, pH 8.0, 100 mm NaCl, 20 mm β-mercaptoethanol, 1% (v/v) Triton X-100, 1 mm phenylmethylsulfonyl fluoride, 10 mm benzamidine, 4 μg/ml pepstatin A, 4 μg/ml aprotinin, 10 μg/ml leupeptin at 4 °C and clarified by centrifugation (30,000 × g, 4 °C, 30 min). PKCζ-(His)6 was then purified by metal affinity chromatography using TALON resin (CLONTECH, Palo Alto, CA) according to the manufacturer's procedures. Fractions containing PKCζ-(His)6 were pooled and concentrated by dialysis against 20 mm Tris/HCl, pH 7.4, 150 mmNaCl, 0.5 mm EGTA, 0.5 mm EDTA, and 10 mm β-mercaptoethanol saturated with polyethylene glycol at 4 °C. The concentrated pool was then loaded onto a Superdex 200 gel filtration XK 16/70 column (Amersham Pharmacia Biotech), connected to a fast protein liquid chromatography system, and equilibrated with 20 mm Tris/HCl, pH 7.4, 150 mm NaCl, 0.5 mm EGTA, 0.5 mm EDTA, 10 mmβ-mercaptoethanol. The column was developed at 0.2 ml/min overnight. Fractions containing PKCζ-(His)6 were pooled and dialyzed against 20 mm Tris/HCl, pH 7.4, 100 mm(NH4)2SO4, 0.5 mm EGTA, 0.5 mm EDTA, 10 mm β-mercaptoethanol and stored at −80 °C in the presence of 20% glycerol. PKCα activity was determined in the presence of protamine sulfate, which acts both as a phosphate acceptor and an activator of the enzyme, as described previously (34Slater S.J. Kelly M.B. Taddeo F.J. Rubin E. Stubbs C.D. J. Biol. Chem. 1994; 269: 17160-17165Abstract Full Text PDF PubMed Google Scholar). Briefly, the assay consisted of 50 mm Tris/HCl, pH 7.4, PKCα (0.04 ng/μl or 0.52 nm final), and protamine sulfate (0.4 mg ml−1). To this was added either TPA or 4α-TPA from 0.5 mm dimethyl sulfoxide (Me2SO) stock solutions, OAG from a 10 mm methanol stock, or bryostatin-1 from a 50 μm methanol stock, so that the total assay volume was 75 μl. The assay was allowed to thermally equilibrate to 30 °C and initiated by the addition of ATP (15 μm), [γ-32P]ATP (∼1 μCi), and MgCl2 (15 mm) in 50 mm Tris/HCl, pH 7.4. After 30 min, the assay was quenched by the addition of 100 μl of phosphoric acid (175 mm), 100 μl of which was transferred to Whatman P81 anion exchange papers. These were washed three times with 75 mm phosphoric acid, air-dried, and placed into scintillation mixture. The incorporation of 32P into protamine sulfate was then measured by scintillation counting. Results are expressed as specific activities. The linearity of the assay was confirmed in separate experiments (results not shown). The concentration of phorbol ester, diacylglycerol, or bryostatin-1 required to reduce protamine sulfate-induced activity by 50% (IC50) and the corresponding Hill coefficient (n) were determined by fitting activity data to a linear Hill equation by linear regression analysis (53Cornish-Bowden A. Principles of Enzyme Kinetics. Butterworths & Co., London1976: 121Google Scholar) as shown in Equation 1.logvIv0−vI=log IC50+n log[I](Eq. 1) where, v 0 and v I are the reaction velocities in the absence and presence of inhibitor. Binding of the fluorescent phorbol ester, SAPD, to PKCα, PKCζ-(His)6, or GST-C1-(His)6 in the absence of membranes was quantified as described previously by measuring the resonance energy transfer (RET) from tryptophans to the 2-(N-methylamino)benzoyl fluor
Referência(s)