Escherichia coli DNA Adenine Methyltransferase
2009; Elsevier BV; Volume: 284; Issue: 27 Linguagem: Inglês
10.1074/jbc.m109.005876
ISSN1083-351X
AutoresStephanie R. Coffin, Norbert O. Reich,
Tópico(s)RNA modifications and cancer
ResumoWe have investigated the structural basis of processive GATC methylation by the Escherichia coli DNA adenine methyltransferase, which is critical in chromosome replication and mismatch repair. We determined the contribution of the orthologically conserved phosphate interactions involving residues Arg95, Asn126, Asn132, Arg116, and Lys139, which directly contact the DNA outside the cognate recognition site (GATC) to processive catalysis, and that of residue Arg137, which is not conserved and contacts the DNA backbone within the GATC sequence. Alanine substitutions at the conserved positions have large impacts on processivity yet do not impact kcat/KmDNA or DNA affinity (KDDNA). However, these mutants cause large preferences for GATC sites varying in flanking sequences when considering the pre-steady state efficiency constant kchem/KDDNA. These changes occur mainly at the level of the methylation rate constant, which results in the observed decreases in processive catalysis. Thus, processivity and catalytic efficiency (kcat/KmDNA) are uncoupled in these mutants. These results reveal that the binding energy involved in DNA recognition contributes to the assembly of the active site rather than tight binding. Furthermore, the conserved residues (Arg95, Asn126, Asn132, and Arg116) repress the modulation of the response of the enzyme to flanking sequence effects. Processivity impacted mutants do not show substrate-induced dimerization as is observed for the wild type enzyme. This study describes the structural means by which an enzyme that does not completely enclose its substrate has evolved to achieve processive catalysis, and how interactions with DNA flanking the recognition site alter this processivity. We have investigated the structural basis of processive GATC methylation by the Escherichia coli DNA adenine methyltransferase, which is critical in chromosome replication and mismatch repair. We determined the contribution of the orthologically conserved phosphate interactions involving residues Arg95, Asn126, Asn132, Arg116, and Lys139, which directly contact the DNA outside the cognate recognition site (GATC) to processive catalysis, and that of residue Arg137, which is not conserved and contacts the DNA backbone within the GATC sequence. Alanine substitutions at the conserved positions have large impacts on processivity yet do not impact kcat/KmDNA or DNA affinity (KDDNA). However, these mutants cause large preferences for GATC sites varying in flanking sequences when considering the pre-steady state efficiency constant kchem/KDDNA. These changes occur mainly at the level of the methylation rate constant, which results in the observed decreases in processive catalysis. Thus, processivity and catalytic efficiency (kcat/KmDNA) are uncoupled in these mutants. These results reveal that the binding energy involved in DNA recognition contributes to the assembly of the active site rather than tight binding. Furthermore, the conserved residues (Arg95, Asn126, Asn132, and Arg116) repress the modulation of the response of the enzyme to flanking sequence effects. Processivity impacted mutants do not show substrate-induced dimerization as is observed for the wild type enzyme. This study describes the structural means by which an enzyme that does not completely enclose its substrate has evolved to achieve processive catalysis, and how interactions with DNA flanking the recognition site alter this processivity. Processive enzyme catalysis, whereby a single substrate binding event is coupled to multiple rounds of catalytic turnovers, occurs frequently with enzymes that act on polymeric substrates such as DNA and in many cases, is essential for the viability of the organism (1.Breyer W.A. Matthews B.W. Protein Sci. 2001; 10: 1699-1711Crossref PubMed Scopus (205) Google Scholar, 2.Hübscher U. Nasheuer H.P. Syväoja J.E. Trends Biochem. Sci. 2000; 25: 143-147Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 3.Johnson K.A. Annu. Rev. Biochem. 1993; 62: 685-713Crossref PubMed Scopus (517) Google Scholar, 4.Von Hippel P.H. Fairfield F.R. Dolejsi M.K. Ann. N.Y. Acad. Sci. 1994; 726: 118-131Crossref PubMed Scopus (74) Google Scholar, 5.Wyman C. Botchan M. Curr. Biol. 1995; 5: 334-337Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). A recent review parses processive enzymes into two structural groups: those that completely enclose their substrate, or those that partially enclose their substrate by forming a "saddle" or hand shape around it (1.Breyer W.A. Matthews B.W. Protein Sci. 2001; 10: 1699-1711Crossref PubMed Scopus (205) Google Scholar). Although the structural means by which an enzyme that completely encloses its substrate achieves processive catalysis is intuitively understood, the structural basis for processive catalysis for enzymes that only partially enclose their substrates is less obvious, particularly because structurally similar enzymes show diverse levels of processivity (1.Breyer W.A. Matthews B.W. Protein Sci. 2001; 10: 1699-1711Crossref PubMed Scopus (205) Google Scholar). For example, although the extensive protein-DNA interface observed in this latter grouping may contribute to processive kinetics, many non-processive (distributive) enzymes such as some restriction endonucleases share the saddle or hand-shaped interface (6.Bilcock D.T. Daniels L.E. Bath A.J. Halford S.E. J. Biol. Chem. 1999; 274: 36379-36386Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 7.Gormley N.A. Bath A.J. Halford S.E. J. Biol. Chem. 2000; 275: 6928-6936Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar, 8.Pingoud A. Jeltsch A. Nucleic Acids Res. 2001; 29: 3705-3727Crossref PubMed Scopus (501) Google Scholar). The involvement of Escherichia coli DNA adenine methyltransferase (EcoDam) 2The abbreviations used are: EcoDamEscherichia coli DNA adenine methyltransferaseAdoMetS-adenosylmethionineTRDtarget recognition domainWTwild typeBSAbovine serum albumin. in diverse biological pathways provides a compelling system in which to study the mechanism and biological significance of processivity. EcoDam methylates the N-6 position of adenine in the DNA sequence 5′-GATC-3′ and is highly processive, catalyzing multiple methyltransfers prior to dissociating from the DNA (9.Herman G.E. Modrich P. J. Biol. Chem. 1982; 257: 2605-2612Abstract Full Text PDF PubMed Google Scholar, 10.Urig S. Gowher H. Hermann A. Beck C. Fatemi M. Humeny A. Jeltsch A. J. Mol. Biol. 2002; 319: 1085-1096Crossref PubMed Scopus (82) Google Scholar). Unlike most bacterial methyltransferases, EcoDam does not belong to a restriction-modification system that serves to protect the cell from foreign DNA. Instead, the methylation by EcoDam of the ∼20,000 GATC sites within the E. coli genome is critical in a number of biological pathways including gene regulation, chromosome replication, mismatch repair, and nucleoid structure determination (11.Casadesús J. Low D. Microbiol. Mol. Biol. Rev. 2006; 70: 830-856Crossref PubMed Scopus (419) Google Scholar, 12.Løbner-Olesen A. Skovgaard O. Marinus M.G. Curr. Opin. Microbiol. 2005; 8: 154-160Crossref PubMed Scopus (199) Google Scholar). It has been shown that there are relatively few EcoDam molecules per bacterial cell suggesting that high processivity is essential in the methylation of the large number of GATC sites in the E. coli genome to avoid hyper-mutating phenotypes (10.Urig S. Gowher H. Hermann A. Beck C. Fatemi M. Humeny A. Jeltsch A. J. Mol. Biol. 2002; 319: 1085-1096Crossref PubMed Scopus (82) Google Scholar, 11.Casadesús J. Low D. Microbiol. Mol. Biol. Rev. 2006; 70: 830-856Crossref PubMed Scopus (419) Google Scholar, 13.Modrich P. Annu. Rev. Genet. 1991; 25: 229-253Crossref PubMed Scopus (791) Google Scholar). However, EcoDam involvement in some cellular pathways lacks any need for processivity, and in some circumstances the enzyme is optimized for the lack of such activity (14.Peterson S.N. Reich N.O. J. Mol. Biol. 2006; 355: 459-472Crossref PubMed Scopus (51) Google Scholar). Gene expression and proteomic studies of bacteria in which the EcoDam gene has been deleted show dramatic and widespread changes in RNA and protein levels, in many cases involving well characterized virulence factors (15.Alonso A. Pucciarelli M.G. Figueroa-Bossi N. García-del Portillo F. J. Bacteriol. 2005; 187: 7901-7911Crossref PubMed Scopus (21) Google Scholar, 16.Oshima T. Wada C. Kawagoe Y. Ara T. Maeda M. Masuda Y. Hiraga S. Mori H. Mol. Microbiol. 2002; 45: 673-695Crossref PubMed Scopus (131) Google Scholar, 17.Watson Jr., M.E. Jarisch J. Smith A.L. Mol. Microbiol. 2004; 53: 651-664Crossref PubMed Scopus (44) Google Scholar, 18.Wu H. Lippmann J.E. Oza J.P. Zeng M. Fives-Taylor P. Reich N.O. Oral Microbiol. Immunol. 2006; 21: 238-244Crossref PubMed Scopus (19) Google Scholar). Furthermore, a growing number of bacterial pathogens that contain an EcoDam analog require adenine methylation for virulence (19.Heusipp G. Fälker S. Schmidt M.A. Int. J. Med. Microbiol. 2007; 297: 1-7Crossref PubMed Scopus (91) Google Scholar). The inhibition of EcoDam has been proposed and pursued as a viable antibiotic strategy (20.Mashhoon N. Pruss C. Carroll M. Johnson P.H. Reich N.O. J. Biomol. Screen. 2006; 11: 497-510Crossref PubMed Scopus (51) Google Scholar, 21.Naumann T.A. Tavassoli A. Benkovic S.J. ChemBioChem. 2008; 9: 194-197Crossref PubMed Scopus (36) Google Scholar) because humans lack this activity. Escherichia coli DNA adenine methyltransferase S-adenosylmethionine target recognition domain wild type bovine serum albumin. Exocyclic adenine methyltransferases can be separated into six classes (α, β, γ, ζ, δ, and ϵ) based on the arrangements of the AdoMet binding domains (X, I, II, and III) and catalytic domains (III-VIII) in relation to the target recognition domain (TRD) (22.Bheemanaik S. Reddy Y.V. Rao D.N. Biochem. J. 2006; 399: 177-190Crossref PubMed Scopus (109) Google Scholar, 23.Schubert H.L. Blumenthal R.M. Cheng X.D. Trends Biochem. Sci. 2003; 28: 329-335Abstract Full Text Full Text PDF PubMed Scopus (701) Google Scholar). EcoDam belongs to the α-class of exocyclic methyltransferases, as do orthologs such as M.EcoRV and T4 Dam (22.Bheemanaik S. Reddy Y.V. Rao D.N. Biochem. J. 2006; 399: 177-190Crossref PubMed Scopus (109) Google Scholar). The crystal structure of EcoDam (24.Horton J.R. Liebert K. Bekes M. Jeltsch A. Cheng X.D. J. Mol. Biol. 2006; 358: 559-570Crossref PubMed Scopus (108) Google Scholar) shows two distinct domains: a DNA binding domain consisting of a five-helix bundle and a β-hairpin loop, and a seven-stranded catalytic domain (Fig. 1A). The structure reveals an incomplete enclosure of the DNA in which most of the base-specific contacts occur through the major groove, whereas the DNA is positioned via direct and water-mediated phosphate interactions (24.Horton J.R. Liebert K. Bekes M. Jeltsch A. Cheng X.D. J. Mol. Biol. 2006; 358: 559-570Crossref PubMed Scopus (108) Google Scholar). This lack of structural enclosure and large DNA interface places EcoDam in the second structural group of processive enzymes (1.Breyer W.A. Matthews B.W. Protein Sci. 2001; 10: 1699-1711Crossref PubMed Scopus (205) Google Scholar) thus making the basis for its highly processive nature poorly understood. We previously showed that EcoDam processivity and differential methylation of biologically derived GATC sites is in part regulated by the DNA immediately flanking the target site (14.Peterson S.N. Reich N.O. J. Mol. Biol. 2006; 355: 459-472Crossref PubMed Scopus (51) Google Scholar, 25.Coffin S.R. Reich N.O. J. Biol. Chem. 2008; 283: 20106-20116Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). This "higher order" specificity modulates the ability of the enzyme to methylate a particular sequence and act processively, and is important to the function of the enzyme in several biological pathways. Here we describe the structural basis for both processive catalysis and preferential site methylation for EcoDam. This work is directly relevant to our recent demonstration that the wild type enzyme shows complex kinetic behavior involving substrate-dependent activation and dimerization, both of which are coupled to processivity. 3S. R. Coffin and N. O. Reich, submitted for publication. This work offers insight into the structural basis of processive catalysis for an enzyme that does not completely enclose the DNA in addition to enhancing our understanding of indirect read-out by DNA modifying enzymes. Six EcoDam mutants were produced (Arg137 → Ala, Arg116 → Ala, Arg95 → Ala, Asn126 → Ala, Asn132 → Ala, and Lys139 → Ala) using the QuikChange PCR mutagenesis kit (Stratagene) with vector pDal572 as a template and six sets of primers (Operon). The resulting PCR products were digested with DpnI to remove the WT plasmid and transformed into XL2 Blue (Stratagene) E. coli cells. WT EcoDam and mutants were expressed and purified as previously described (25.Coffin S.R. Reich N.O. J. Biol. Chem. 2008; 283: 20106-20116Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). In brief, cells containing the desired construct were grown at 37 °C in LB media supplemented with 25 μg/ml kanamycin and 12.5 μg/ml tetracycline. Once an A600 of 0.4–0.6 was reached, cells were induced with 1 mm isopropyl 1-thio-β-d-galactopyranoside and 0.05% l-arabinose and grown for 2 h at 37 °C. Pelleted cells were resuspended in 40–60 ml of P-11 buffer (50 mm potassium phosphate buffer, pH 7.4, 10 mm β-mercaptoethanol, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 0.2 m NaCl, 10% glycerol) and lysed by French press. The lysate was centrifuged at 15,000 × g for 60 min at 4 °C and the supernatant loaded onto a 60-ml phosphocellulose (Whatman) column. The protein was eluted with a salt gradient between 0.2 and 0.8 m NaCl and those fractions containing EcoDam were pooled and dialyzed in BS buffer (20 mm potassium phosphate buffer, pH 7.0, 10 mm β-mercaptoethanol, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 10% glycerol). The dialyzed protein was loaded onto a 20-ml Blue Sepharose 6 Fast Flow (GE Healthcare) column pre-equilibrated in BS buffer and protein eluted with a salt gradient between 0 and 1.5 m NaCl. Fractions containing the WT and mutant enzymes were flash frozen and stored at −80 °C. Concentrations were determined using the extinction coefficient 1.16 ml mg−1 cm−1 at 280 nm. All DNA oligonucleotides were ordered from Operon and resuspended in TE (10 mm Tris, pH 7.5, 1 mm EDTA). All constructs were annealed in a 1:1 molar ratio by heating at 95 °C for 10 min followed by slow cooling (∼5 h) to 22 °C. Proper product formation was verified by PAGE. The preferred substrate (P) consisted of the annealed product of the oligonucleotides 5′-CATTTACTTGATCCGGTATGC-3 and 5′-GCATACCGGATCAAGTAAATG-3′, whereas the non-preferred substrate (N-P) consisted of the annealed product of the oligonucleotides 5′-CATTTAGACGATCTTTTATGC-3′ and 5′-GCATAAAAGATCGTCTAAATG-3′, respectively. Two 58-bp oligonucleotides with the sequences 5′-TAGCTCTTGATCCGGCAAACAGCTGTTCGCATCCTTTGATCTTTTCTACGCCTATGCC-3′ and 5′GGCATAGGCGTAGAAAAGATCAAAGGATGCGAACAGCTGTTTGCCGGATCAAGAGCTA-3′ were annealed to form the substrate for processivity analysis. Concentrations of all DNA constructs were determined by measuring the A260. Anisotropy experiments were performed on a Fluoromax-2 fluorimeter (ISA SPEX) equipped with an L-format autopolarizer at 22 °C. The change in anisotropy of 20 nm singly labeled (fluorescein) duplex DNA in MRB (100 mm Tris, pH 8.0, 1 mm EDTA, 1 mm dithiothreitol, 0.2 mg/ml BSA) supplemented with 50 μm sinefungin was monitored as increasing enzyme was added. Data for each addition of enzyme were collected by monitoring the excitation at 494 nm and emission at 518 nm. Slit widths of 8 nm were used for all experiments. The resultant changes in anisotropy were plotted against enzyme concentration and the dissociation constant derived by fitting the data to the modified quadratic equation, f=a+x+b−a+x+b2−4xa1/22(Eq. 1) where b = KD, x = [enzyme] × [DNA], and a = [enzyme-DNA]. All graphical analysis was done with Sigma Plot 6.1 (SSPS, Inc.). Incorporation of tritiated methyl groups onto DNA was monitored by a filter binding assay as previously described (33.Bergerat A. Kriebardis A. Guschlbauer W. J. Biol. Chem. 1989; 264: 4064-4070Abstract Full Text PDF PubMed Google Scholar). EcoDam and mutants were diluted in protein dilution buffer (20 mm potassium phosphate, pH 7.5, 200 mm NaCl, 0.2 mm EDTA, 0.2 mg/ml BSA, 2 mm dithiothreitol, 10% glycerol). Reactions were carried out at 22 °C and contained 2–5 nm enzyme in MRB, 0.2 mg/ml BSA, 25 μm tritiated AdoMet (PerkinElmer Life Sciences), and DNA (0–500 nm) in a final volume of 20 μl. Mixtures were allowed to equilibrate at 22 °C prior to initiation with DNA. Reactions were quenched with 10 μl of 1% SDS at a single time point (30–60 min dependent upon activity) and 25 μl was spotted onto 2.5-cm Whatman DE81 circular filter papers. Filter papers were washed three times in 50 mm KH2PO4, once in 80% ethanol, once in 100% ethanol, and once in diethyl ether for 5 min each. Papers were dried and submerged in BioSafeII scintillation fluid. Tritium levels were quantitated in a Beckman-Coulter LS6500 scintillation counter. Counts were converted to methylated product per unit time and plotted against the DNA concentration. Values for KmDNA and kcat were found by fitting the data to a rectangular hyperbola in Sigma Plot 6.1. Reactions were carried out in MRB with 50 nm enzyme, 500 nm DNA, and 30 μm tritiated AdoMet at 22 °C. Reactions were quenched by placing 10-μl aliquots of the reaction into an equal volume of 1% SDS at time points 0, 15, 30, 45, 60, 90, and 120 s or 0, 1, 5, 10, 30, 60, and 120 min depending upon reactivity of the enzyme. 15 μl of the resulting mixture was spotted on DE81 filter papers and washed as described above. Tritium levels were quantitated, converted to methylated product, and plotted against time in Sigma Plot. The kcatapp (not shown) was found by fitting the data to a linear curve and dividing the slope of the line by the enzyme concentration. This value was comparable with the actual kcat of WT and mutant enzymes. The y intercept of the linear fit to the data represents the burst magnitude. For the WT enzyme and R137A mutant, single turnover measurements to determine kchem were performed by using a rapid chemical-quench flow apparatus (RQF-3, Kin Tek Instruments, University Park, PA) with saturating enzyme and AdoMet (420 nm and 30 μm) and limiting DNA (288 nm) in MRB. The temperature was maintained at 22 °C for all experiments. Enzyme and substrates in two 20-μl sample loops were mixed rapidly into a single reaction loop of specified dimensions to control the time of the reaction. Reactions were quenched with 1% SDS at 0, 0.2, 0.5, 1, 2, 3, 5, 10, and 30 s. At least three data points from each time point were measured and averaged. All other single turnover assays were completed at 22 °C with limiting DNA and excess EcoDam and AdoMet. Reactions took place in MRB with 0.2 mg/ml BSA, 288 nm DNA, 420 nm EcoDam, and 30 μm AdoMet in a total volume of 100 μl. All reactions were initiated with addition of DNA. At 0, 15, 30, 60, 90, 120, 180, 300, and 600 s 10-μl aliquots of the reaction were removed and quenched in 10 μl of 1% SDS. 15 μl of the resulting mixture was placed on DE81 filter papers. Samples were washed, dried, and counted as described above. Counts were converted to nanamolar methylated product and plotted against time. The kchem for each substrate was found by fitting the data to a single exponential in Sigma Plot 6.1. Processivity assays were carried out at 22 °C with limiting enzyme in MRB supplemented with 0.2 mg/ml BSA. WT and mutant enzymes were diluted into protein dilution buffer so that each reaction contained 10 nm enzyme, 600 nm DNA, and 30 μm AdoMet. Reactions were quenched by removing aliquots from the reaction mixture into pre-heated TE at 75 °C, and incubated for at least 15 min to ensure heat inactivation of EcoDam. After cooling to room temperature, samples were digested with DpnII for at least 12 h at 37 °C. A 10-bp ladder (Invitrogen), an uncut control, and the digested samples were run on 12 (58-bp substrate) or 8% (270-bp substrate) native polyacrylamide gels for 4 h at 250 V. Gels were stained with SYBR Au (Invitrogen) and scanned on a Storm 840 PhosphorImager (Amersham Biosciences). Band density was determined using ImageQuant version 1.2 (GE Healthcare) and further analyzed in Microsoft Excel. Density changes with time were finally plotted in Sigma Plot 6.1. The slope of the linear fit to the formation of products that were methylated at both positions (vABC), methylated at only the preferred site (vAB), and methylated at only the non-preferred site (vBC) were compared as previously described (26.Jack W.E. Terry B.J. Modrich P. Proc. Natl. Acad. Sci. U.S.A. 1982; 79: 4010-4014Crossref PubMed Scopus (150) Google Scholar, 27.Stanford N.P. Szczelkun M.D. Marko J.F. Halford S.E. EMBO J. 2000; 19: 6546-6557Crossref PubMed Scopus (157) Google Scholar). EcoDam site preference (EP/EN-P) is a comparison of the rate at which the preferred site is methylated (vAB) in relation to the rate at which the non-preferred site is methylated (vBC) and is described as, EP/EN−P=VAB/VBC(Eq. 2) where large EP/EN-P values correspond to large preference for preferred GATC sites. The processivity factor (fP) is defined as the fraction of enzymatic encounters that result in both GATC sites being methylated and is defined by the following equation. fP=VABC−VAB−VBC/VABC+VAB+VBC(Eq. 3) The initial velocity of WT and mutant EcoDams were monitored at various enzyme concentrations at time points that were within the early phase of product formation (less than 35% conversion). Reactions contained various concentrations of enzyme (0, 10, 20, 50, 75, 100, and 200 nm), saturating AdoMet (30 μm), and saturation DNA (1 μm) in MRB supplemented with 0.2 mg/ml BSA in a total reaction volume of 70 μl. Reactions were initiated with addition of DNA. At specific time points that varied with enzyme concentration, 10 μl of the reaction was quenched by submerging the mixture into 1% SDS. Resulting aliquots were spotted onto DE81 filter papers and processed as described above. Product formation versus time was plotted for each enzyme concentration in Sigma Plot. The corresponding slope for each curve is equal to the initial velocity at that enzyme concentration. Initial velocities were then plotted versus enzyme concentration and the data fit to a linear and quadratic plot. The WT, K139A, and R137A were best fit to a quadratic function, whereas R95A, N132A, N126A, and R116A best fit to a linear curve. To validate the quadratic nature of WT, K139A, and R137A and the linearity of R95A, N132A, N126A, and R116A, an enzyme squared (E2) re-plot analysis of the data were performed. The E2 re-plot should be linear if the reaction obeys second-order kinetics in relation to enzyme concentration. The crystal structure of EcoDam bound to DNA and AdoHcy (Protein Data Bank code 2G1P) was used to align the primary amino acid sequences of the following orthologs (EMB accession number): EcoDam (AAG58487.1), M.MboIA (BAA03071.1), M.MjaIII (AAB98590.1), M.CviBI (AAA88829.1), M.EcoRV (CAA25209.1), and M.DpnIIA (AAA268721), Klebsiella pneumoniae (ABR79145.1), Salmonella enterica (CAD08130.1), M.SmaII (CAA55177.1), Yersinia pestis (CAL18840.1), Vibrio cholerae (AAF95767.1), T4Dam (AAD42553.1), M.HindIV (AAC21877.1), and Neisseria meningitides (AAY52162). The alignment was performed in ESPript 2.2 (28.Gouet P. Courcelle E. Stuart D.I. Métoz F. Bioinformatics. 1999; 15: 305-308Crossref PubMed Scopus (2560) Google Scholar) under default conditions. For simplicity, only a portion of the target binding domain and the β-hairpin are shown. PDB file 2G1P containing the EcoDam/DNA co-crystal structure was downloaded from the RCSB data base and analyzed in PyMOL version 0.98 (DeLano Scientific). The target binding domain and the conserved residues within hydrogen bonding distance (≤3.0 Å) of the phosphate groups flanking the target GATC were displayed. Direct hydrogen bonds made from a side chain to the phosphate backbone were found by measuring the distances between atoms. Additional residues within hydrogen bonding distance of conserved residues were displayed and their interactions were measured in the same way as mentioned above. Images were rendered and saved as png files for use in Fig. 9. A structure-based sequence alignment of a portion of the TRD of EcoDam (PDB code 2G1P) and selected orthologs reveals the conservation of the Arg116, Lys139, and Asn132 residues and the invariant residues Arg95 and Asn126 (Fig. 2). This is consistent with previous structure-based sequence alignments based on the T4 Dam structure (29.Yang Z. Horton J.R. Zhou L. Zhang X.J. Dong A. Zhang X. Schlagman S.L. Kossykh V. Hattman S. Cheng X. Nat. Struct. Biol. 2003; 10: 849-855Crossref PubMed Scopus (41) Google Scholar). Although each of the conserved residues is found within the TRD, none are involved in direct contacts to the GATC site. Instead, the crystal structure shows that these residues are involved in direct hydrogen bonds to the backbone of DNA surrounding the GATC site (Fig. 1). Arg116 and Lys139 contact two phosphates on the left-hand (5′) side of the adenine being methylated, whereas Arg95, Asn126, and Asn132 contact phosphates on the non-target strand of the right-hand (3′) side of the target adenine. These residues appear to anchor the β-hairpin that contains base-specific interacting residues and this extensive, conserved, protein-DNA interface is thought to aid in the positioning of the enzyme onto DNA so that catalysis can occur (24.Horton J.R. Liebert K. Bekes M. Jeltsch A. Cheng X.D. J. Mol. Biol. 2006; 358: 559-570Crossref PubMed Scopus (108) Google Scholar). Furthermore, the orthologous residues in T4 Dam have been shown to stabilize a nonspecific enzyme-DNA complex (29.Yang Z. Horton J.R. Zhou L. Zhang X.J. Dong A. Zhang X. Schlagman S.L. Kossykh V. Hattman S. Cheng X. Nat. Struct. Biol. 2003; 10: 849-855Crossref PubMed Scopus (41) Google Scholar). This observation, in addition to our previous work, suggests that these residues may aid in the processive methylation of multiple GATC sites in EcoDam in addition to providing an indirect readout mechanism responsible for higher-order specificity (14.Peterson S.N. Reich N.O. J. Mol. Biol. 2006; 355: 459-472Crossref PubMed Scopus (51) Google Scholar, 25.Coffin S.R. Reich N.O. J. Biol. Chem. 2008; 283: 20106-20116Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). We replaced the residues at the conserved positions with alanines to test their role in processivity, catalysis, and site preference. Additionally Arg137, which contacts the phosphate backbone within the GATC site, was also mutated to alanine to serve as a control. To clarify, although all of the residues targeted for mutagenesis interact with a phosphate on the DNA substrate, they are distinct by virtue of the location of the particular phosphate within or outside of the GATC site. The EcoDam mutants were tested for their ability to processively methylate a 58-bp duplex DNA substrate containing preferred (P) and a non-preferred (N-P) GATC sites (Fig. 3A). By monitoring the product formed in the early phases of the reaction (≤25% completion) we can describe the fraction of enzymatic encounters that result in double methylation events as the processivity factor (fP) and the site preference on this substrate (EP/EN-P) as previously described (25.Coffin S.R. Reich N.O. J. Biol. Chem. 2008; 283: 20106-20116Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar, 26.Jack W.E. Terry B.J. Modrich P. Proc. Natl. Acad. Sci. U.S.A. 1982; 79: 4010-4014Crossref PubMed Scopus (150) Google Scholar, 27.Stanford N.P. Szczelkun M.D. Marko J.F. Halford S.E. EMBO J. 2000; 19: 6546-6557Crossref PubMed Scopus (157) Google Scholar). For example, Stanford et al. (27.Stanford N.P. Szczelkun M.D. Marko J.F. Halford S.E. EMBO J. 2000; 19: 6546-6557Crossref PubMed Scopus (157) Google Scholar) demonstrated that the endonuclease EcoRV endonuclease is less likely to processively cleave adjacent cognate sites as the distance between them increases. They observed that when EcoRV sites were placed 54 bp apart, the fP value is about 0.4; whereas when the distance between the sites increased to 764 bp, the fP value decreased to 0.1. In general, a highly processive enzyme would have a predicted fP value around 1, whereas a distributive enzyme would have an fP value close to zero. As shown in Fig. 3B, WT EcoDam methylates the 58-bp duplex in a high processively with an fP of ∼1 (Fig. 3D). Only a small amount of intermediates corresponding to single methylation events at the preferred or non-preferred sites could be detected above background levels. Therefore, little to no site preference is revealed on this substrate. In comparison with the WT enzyme, all mutants showed a decrease in processivity on the 58-bp substrate; however, K139A and control R137A showed the smallest variability from WT with fP values equal to 0.73 and 0.58, respectively. This small change in processivity still results in a majority of binding events producing methylation at both sites and is minimal when compared with the conserved flanking interacting mutants whose processivity is decreased substantially (Fig. 3D). Under these conditions, the R116A and N126A mutants gave the largest decrease in processive methylation with fP values of 0.10 and 0.13, respectively, in addition to the largest discrimination between the P and N-P substrates with EP/EN-P values of 18.75 and 16.50, respectively (Fig. 3). To identify the kinetic step responsible for the
Referência(s)