Portal de Periódicos da CAPES

Active Influx Transport is Mediated by Members of the Organic Anion Transporting Polypeptide Family in Human Epidermal Keratinocytes

2003; Elsevier BV; Volume: 120; Issue: 2 Linguagem: Inglês

10.1046/j.1523-1747.2003.12031.x

1523-1747

Ruth Schiffer, Mark M. Neis, Daniela Höller, Felipe Rodríguez, Andreas Geier, Carsten Gartung, Frank Lammert, Alexandra Dreuw, Gabriele Zwadlo‐Klarwasser, Hans F. Merk, Frank K. Jugert, Jens Malte Baron,

Protein Interaction Studies and Fluorescence Analysis

Normal human epidermal keratinocytes have been shown to express a cell-type-specific pattern of extrahepatic cytochrome P450 enzymes and efflux transport proteins showing that these cells metabolize and excrete a variety of xenobiotics. Recently transport proteins involved in the uptake of xenobiotics have been detected and here we analyzed the mRNA and protein expression profiles and functional activities of these proteins in human keratinocytes in comparison to primary liver cells. The transporters studied included the subtypes A, B, C, D, and E of the organic anion transporting polypeptide (OATP) family, which are responsible for the uptake of various anionic and neutral molecules and especially organic cations – including drugs. Constitutive expression of OATP-B, OATP-D, and OATP-E was shown for the first time in normal human epidermal keratinocytes on a molecular level using reverse transcription polymerase chain reaction and northern blot analysis, as well as in human skin tissue shown by tissue blot hybridization and immunohistochemistry. Expression of OATP-A and OATP-C was not detected in any of the keratinocyte samples. In contrast, liver tissue showed a significant expression of OATP-A and OATP-B as well as OATP-C, a weak expression of OATP-D, and no expression of OATP-E. These data revealed that normal human epidermal keratinocytes express a specific profile of transporters involved in drug influx. Using a newly developed uptake-transport assay, uptake of known and well-characterized OATP substrates like estradiol-17β-glucuronide and estrone sulfate was inhibited in normal human epidermal keratinocytes by specific inhibitors such as taurocholate, verifying the functional capacity of the expressed OATPs. Human dermal fibroblasts seem to have a lower influx transport activity for estradiol-17β-glucuronide, which correlates with the immunohistologic data. Even though the substrate specificity of the OATP isoforms is only partially known until now, our findings support the concept that uptake of large organic cations like drugs in keratinocytes is an active transport process mediated by members of the OATP family. Normal human epidermal keratinocytes have been shown to express a cell-type-specific pattern of extrahepatic cytochrome P450 enzymes and efflux transport proteins showing that these cells metabolize and excrete a variety of xenobiotics. Recently transport proteins involved in the uptake of xenobiotics have been detected and here we analyzed the mRNA and protein expression profiles and functional activities of these proteins in human keratinocytes in comparison to primary liver cells. The transporters studied included the subtypes A, B, C, D, and E of the organic anion transporting polypeptide (OATP) family, which are responsible for the uptake of various anionic and neutral molecules and especially organic cations – including drugs. Constitutive expression of OATP-B, OATP-D, and OATP-E was shown for the first time in normal human epidermal keratinocytes on a molecular level using reverse transcription polymerase chain reaction and northern blot analysis, as well as in human skin tissue shown by tissue blot hybridization and immunohistochemistry. Expression of OATP-A and OATP-C was not detected in any of the keratinocyte samples. In contrast, liver tissue showed a significant expression of OATP-A and OATP-B as well as OATP-C, a weak expression of OATP-D, and no expression of OATP-E. These data revealed that normal human epidermal keratinocytes express a specific profile of transporters involved in drug influx. Using a newly developed uptake-transport assay, uptake of known and well-characterized OATP substrates like estradiol-17β-glucuronide and estrone sulfate was inhibited in normal human epidermal keratinocytes by specific inhibitors such as taurocholate, verifying the functional capacity of the expressed OATPs. Human dermal fibroblasts seem to have a lower influx transport activity for estradiol-17β-glucuronide, which correlates with the immunohistologic data. Even though the substrate specificity of the OATP isoforms is only partially known until now, our findings support the concept that uptake of large organic cations like drugs in keratinocytes is an active transport process mediated by members of the OATP family. organic anion transporting polypeptide normal human epidermal keratinocyte Uptake of xenobiotics into normal human epidermal keratinocytes (NHEKs) and subsequent excretion of these substances has long been thought to be a process of passive diffusion. Recently we were able to demonstrate that efflux of large organic cations such as drugs is mediated by ATP binding cassette transporters such as MRP1, MRP3–7, and MDR1 (Baron et al., 2001Baron J.M. Höller D. Schiffer R. Frankenberg S. Neis M. Merk H.F. Jugert F. Expression of multiple cytochrome P450 enzymes and MDR-associated transport proteins in human skin keratinocytes.J Invest Dermatol. 2001; 116: 541-548Crossref PubMed Scopus (200) Google Scholar). This study revealed that NHEKs express various metabolic active and transport associated enzymes and are therefore capable of metabolizing and eliminating xenobiotics. Other studies byAbels et al., 2000Abels C. Fickweiler S. Weiderer P. Baumler W. Hofstadter F. Landthaler M. Szeimies R.M. Indocyanine green (ICG) and laser irradiation induce photooxidation.Arch Dermatol Res. 2000; 29: 404-411Crossref Scopus (128) Google Scholar showed that the cellular uptake of indocyanine green in HaCaT keratinocytes is inhibited by bromosulfophthalein indicating the possible involvement of an organic anion transporting polypeptide (OATP) in the active uptake of organic cations like indocyanine green. Organic anion transporting polypeptide 1 (oatp1) was first identified at the molecular level in rats as a multispecific and sodium-ion-independent transporter for various organic anions, including bile acids, conjugated metabolites, and xenobiotics (Jacquemin et al., 1994Jacquemin E. Hagenbuch B. Stieger B. Wolkoff A.W. Meier P.J. Expression cloning of a rat liver Na(+)-independent organic anion transporter.Proc Natl Acad Sci USA. 1994; 91: 133-137Crossref PubMed Scopus (520) Google Scholar). Subsequently, rat oatp2 and oatp3 were isolated as homologs of oatp1 and were shown to be present in various tissues and to transport anionic and neutral compounds (Noe et al., 1997Noe B. Hagenbuch B. Stieger B. Meier P.J. Isolation of a multispecific organic anion and cardiac glycoside transporter from rat.Proc Natl Acad Sci USA. 1997; 94: 10346-10350Crossref PubMed Scopus (381) Google Scholar). As these transporters are structurally very closely related, they are considered to form a single protein family – the OATP family. In humans OATP-A (SLC21A3) was first cloned from human liver as a homolog of rat oatp1 (Kullak-Ublick et al., 1995Kullak-Ublick G.A. Hagenbuch B. Stieger B. Schteingart C.D. Hofmann A.F. Wolkoff A.W. Meier P.J. Molecular and functional characterization of an organic anion transporting polypeptide cloned from human.Gastroenterology. 1995; 109: 1274-1282Abstract Full Text PDF PubMed Scopus (355) Google Scholar).Tamai et al., 2000Tamai I. Nezu J. Uchino H. Sai Y. Oku A. Shimane M. Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family.Biochem Biophys Res Commun. 2000; 273: 251-260Crossref PubMed Scopus (517) Google Scholar identified three novel transporters OATP-B (SLC21A9), OATP-D (SLC21A11), and OATP-E (SLC21A12), structurally belonging to the OATP family. These OATPs exhibit a broad and to a certain degree overlapping substrate specificity and transport a wide range of large organic compounds including steroid conjugates, cardiac glycosides, endothelin antagonists, and certain toxins (Tamai et al., 2000Tamai I. Nezu J. Uchino H. Sai Y. Oku A. Shimane M. Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family.Biochem Biophys Res Commun. 2000; 273: 251-260Crossref PubMed Scopus (517) Google Scholar). Skin is the major interface between the environment and the body and therefore is exposed to various xenobiotics. Little is known, however, about the expression and function of influx transport proteins in human skin and the role of their interaction in uptake of such xenobiotics as well as endogenous substrates. This prompted us to analyze the expression pattern and functional activity of polyspecific membrane transporters, such as OATP-A, OATP-B, OATP-C, OATP-D, and OATP-E, in NHEKs. All reagents were of highest grade and purity commercially available. NHEKs were obtained from foreskin by dispase (Roche, Mannheim, Germany) separation of the epidermal sheet from the dermis and subsequent trypsin/ethylenediamine tetraacetic acid (EDTA) (PAA, Linz, Austria) digestion of the epidermis. The keratinocytes were cultured in low calcium (0.09 mM), serum-free, keratinocyte medium with bovine pituitary gland extract, recombinant human epidermal growth factor, insulin, gentamycin sulfate, and amphotericin B as described by the manufacturer (KGM, Clonetics, San Diego, CA). Cells were subcultivated by using the manufacturer's detach kit with Hank's balanced salt solution and trypsin/EDTA. The medium was replaced regularly three times a week. Cells used for this study were in second and third passage in late subconfluency. Induction was performed by the addition of inducers, dissolved in water. Normal human fibroblasts were obtained from foreskin specimens. After excision, the specimens were washed three times in sterile phosphate-buffered saline (PBS; PAA) containing antibiotics (penicillin/streptomycin; PAA) and antimycotics (amphotericin B; Boehringer Mannheim, Germany), and digested in dispase solution (2 U per ml, GibcoBRL, Karlsruhe, Germany) for 20 h at 4°C and subsequently for 2 h at 37°C. Then, the epidermis was removed and, for adherence to the polystyrene surface, the dermis was placed in a dry cell culture multiwell plate (FALCON-Becton Dickinson, Franklin Lakes, NJ) for 20 min. Following this, Dulbecco's minimum essential medium with high glucose and L-glutamine (GibcoBRL), 10% fetal bovine serum (FBS; Biochrom, Berlin, Germany) was added. The plates were transferred to a CO2 incubator (MCO-17AI, Sanyo, Japan) at 37°C in a humidified atmosphere with 5% CO2. Monitoring fibroblast outgrowth by light microscopy (LEICA DMIL; Leitz, Wetzlar, Germany), dermis was removed after 5–7 d. After reaching the state of early confluence, cells were washed with PBS and incubated in 1 ml trypsin/EDTA (PAA) for 3 min at 37°C. The enzymatic digestion was stopped by addition of 3 ml FBS. Then, cells were centrifuged, the supernatant was discarded, and the cells were suspended in FBS or autologous serum and subcultivated in cell culture flasks (Nunc, Roskilde, Denmark). mRNA was extracted using 5×106 keratinocytes from different donors with the Oligotex direct mRNA purification kit (Qiagen, Hilden, Germany) using the mRNA enrichment protocol (Kuribayashi et al., 1988Kuribayashi K. Hikata M. Hiraoka O. Miyamoto C. Furuichi Y. A rapid and efficient purification of poly(A)-mRNA by oligo (dT) 30-latex.Nucl Acids Res Symp Series. 1988; 19: 61-64PubMed Google Scholar). The mRNA concentration of each sample was measured using the Eppendorf BioPhotometer (Eppendorf, Hamburg, Germany) and equal amounts of mRNA were used for reverse transcription. Purified mRNA and total RNA from human liver was used as control (Clontech, Palo Alto, CA). RT-PCR was performed with the GeneAmp RNA PCR kit (Perkin Elmer, Weiterstadt, Germany) according to the manufacturer's instructions. All RT-PCR experiments were performed in duplicate for each donor. Detection of specific mRNAs for OATP-A-OATP-E was achieved using primers designed to amplify at least one intron in the gene to exclude contamination of cDNA with genomic DNA (Table I). β-Actin was used as an internal standard as described before (Baron et al., 1998Baron J.M. Zwadlo-Klarwasser G. Jugert F. Hamann W. Rübben A. Mukhtar H. Merk H.F. Cytochrome P450 1B1: a major P450 enzyme in human blood monocytes and macrophage subsets.Biochem Pharmacol. 1998; 56: 1105-1110Crossref PubMed Scopus (124) Google Scholar). Amplification was carried out with 35 cycles of 1 min denaturation at 93°C, 1 min annealing at 54°C, and 1 min extension at 72°C. Amplification was terminated with an extension step of 5 min duration after the last cycle. PCR products were separated on 1.0% agarose gels (1×TBE) and stained with ethidium bromide.Table IPrimers used for RT-PCR analysisSense primer locationAntisense primer locationPCR productOATP-AAAGAAGAGGTCAAGAAGGAAAAATGGAGCATCAAGGAACAGTCAGGTC661924–9481561–1584OATP-BCGTGCGGCCAAGTGTGTTCCATAAACAAGGATAGCCCCATAGCCAATC259295–318530–553OATP-CTGTCATTGTCCTTTTACCTATTATTGTAAGTTATTCCATTGTTTCCAC1951349–13721519–1543OATP-DCTCAAATCCTTCGCCTTCATCCTGAGGGTCAGAGTAGAGGCAAAGAAC1292090–21132194–2218OATP-ECACGGCGGGCACTCAGCATTTCCTCGATCGGGTATAAAACACATTCTA2402283–23062499–2522β-actinACCCACACTGTGCCCATCTACGGAACCGCTCATTGCC290488–507761–777 Open table in a new tab Total RNA was isolated using peqGOLD RNA-Pure® (peqlab, Erlangen, Germany) as described by the manufacturer. Twenty micrograms of total RNA were separated on 1.5% denaturating agarose gels and transferred to positively charged nylon membranes (Roche). The membranes were prehybridized at 45°C for 2 h in ULTRAhyb hybridization buffer (Ambion, Austin, TX) and hybridized overnight in the same solution with α-32P-cDNA fragments labeled with the DECAprime II DNA labeling kit (Ambion). Blots were washed twice with 2×sodium citrate/chloride buffer (SSC), 0.1% sodium dodecyl sulfate (SDS) for 1 h at 50°C, followed by two washing steps for 30 min with 0.1×SSC, 0.1% SDS at 50°C. Afterwards blots were exposed to Kodak X-OMAT AR-5 film at -70°C with intensifying screens. Human conceptional normal tissue northern blots containing 20 μg of total RNA per lane from four different human tissues (Genpak, Hampshire, U.K.) were prehybridized at 45°C for 2 h in ULTRAhyb hybridization buffer (Ambion) and hybridized overnight in the same solution containing α-32P-cDNA fragments labeled with the DECAprime II DNA labeling kit (Ambion). Blots were washed twice with 2×SSC, 0.1% SDS for 1 h at 50°C, followed by two washes for 30 min with 0.1×SSC, 0.1% SDS at 50°C, and were then exposed to Kodak X-OMAT AR-5 film at –70°C with intensifying screens. Cells were grown in 24-well plates to about 90% confluency. Twenty-four hours before starting the uptake experiment the cell culture medium was replaced by serum-free medium. Cells were washed once with prewarmed PBS and then incubated with 500 μl of serum-free medium containing different concentrations of the inhibitor taurocholate (Sigma, Deisenhofen, Germany). Control cells were incubated in serum-free medium without the inhibitor. After incubation for 30 min at 37°C another 500 μl medium containing the tritium-labeled substrates 17β-D-glucuronide [estradiol-6,7–3H(N)] or estrone sulfate [6,7–3H(N)] (Perkin Elmer, Weiterstadt, Germany) with or without taurocholate were added. After incubation for 60 min at 37°C the radioactive medium was removed and cells were washed three times with PBS. Cells were lyzed by adding Optiphase "Supermix" (Wallac, Turku, Finland). The cell-associated radioactivity was determined by transferring 500 μl aliqouts of the lysate in a flexible 24-well plate and counting radioactivity using a cross-contamination preventing tape and a Wallac 1450 MicroBeta® TriLux liquid scintillation counter (Wallac). The cytotoxicity of drugs was determined using a bioluminescent somatic cell assay kit (Sigma) according to the manufacturer's instructions. This kit was employed for the bioluminescent determination of the ATP released from a suspension of viable somatic cells. The number of viable somatic cells is selectively counted because, as a cell dies, its ATP amount is rapidly degraded. Briefly, cells were plated in 24-well microtiter plates at an appropriate density and allowed to adhere overnight before the addition of different taurocholate concentrations. Incubation with taurocholate was carried out for 2 h; the amount of cell death was then assessed by the addition of 500 μl of ATP-releasing agent. 7.5 μl of this cell sample were added to a vial containing 0.1 ml of ATP assay mix solution and immediately the amount of light emitted, L(SAM), was measured with a luminometer (TD-20/20 Luminometer, Turner Designs, Sunnyvale, CA). The amount of ATP in the cell sample was then calculated by using an ATP standard (Lundin et al., 1986Lundin A. Hasenson M. Persson J. Pousette A. Estimation of biomass in growing cell lines by adenosine triphosphate assay.Meth Enzymol. 1986; 133: 27-42Crossref PubMed Scopus (186) Google Scholar). For isolation of total cellular protein, cells were harvested by trypsin treatment and resuspended in a buffer containing 10 mM sodium phosphate (pH 8.0), 1 mM EDTA, and 2 mM dithiothreitol. Cells were lyzed using an MSE Soniprep 150 sonicator. Protein concentration was determined spectrophotometrically using the Bradford reagent (Bio-Rad, Munich, Germany) and bovine serum albumin as standard. For detection of OATP-A and OATP-B, samples were denaturated by suspension in Laemmli sample buffer (Bio-Rad) containing 5%β-mercaptoethanol. Generally 100 μg of protein was loaded per lane. The expression of the transport proteins was analyzed by using antiserum against a C-terminal fusion protein of human OATP-A (Gao et al., 2000Gao B. Hagenbuch B. Kullak-Ublick G.A. Benke D. Aguzzi A. Meier P.J. Organic anion-transporting polypeptides mediate transport of opioid peptides across blood–brain barrier.J Pharmacol Exp Ther. 2000; 294: 73-79PubMed Google Scholar) and antiserum against a C-terminal peptide of human OATP-B (Kullak-Ublick et al., 2001Kullak-Ublick G.A. Ismair M.G. Stieger B. et al.Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver.Gastroenterology. 2001; 120: 525-533Abstract Full Text Full Text PDF PubMed Scopus (611) Google Scholar), kindly provided by Dr. Bruno Stieger, Department of Medicine, Division of Clinical Pharmacology and Toxicology, University Hospital Zürich, Switzerland. Using 7.5% Tris-HCl Criterion Precast Gels (Bio-Rad) blotting was performed onto 0.45 μm cellulose nitrate sheets (Schleicher & Schuell, Dassel, Germany) according to the method ofTowbin et al., 1979Towbin H. Straehlin T. Gorden J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.Proc Acad Natl Sci USA. 1979; 76: 4350-4354Crossref PubMed Scopus (44170) Google Scholar for 1 h with 200 V. Following blocking the remaining protein binding sites on the membrane with nonfat dry milk powder in PBS containing 0.1% Tween 20 (Sigma, Taufkirchen, Germany) (MPBST) we incubated the blot in the primary antibody solution (each 1 : 1000–1 : 2000 in MPBST) overnight. After subsequent washing steps the blot was incubated in the secondary antibody solution (each 1 : 1000 in MPBST) for 4 h. Secondary antibodies were coupled to horseradish peroxidase and were detected after subsequent washing steps using the enhanced chemiluminescence Western blotting kit (Amersham, Little Chalfont, U.K.) according to the manufacturer's instructions. Paraffin-embedded skin specimens were cut into 4 μm sections, mounted on superfrost slides (Menzel, Braunschweig, Germany), deparaffinized, and rehydrated. To unmask antigens the sections were pretreated with Target Retrieval pH 6.1 (DAKO, Glostrup, Denmark), as indicated in the work sheet, and rinsed in distilled water and Tris-buffered saline (TBS). Following this, slides were incubated for 30 min with primary antibody, either the polyclonal antibody specific for OATP-B or the isotypic control, and rinsed in TBS for 10 min. For visualization of the staining the DAKO EnVisionTM system was used according to the manufacturer's instructions. Finally sections were counterstained with hematoxylin and mounted with a coverslip. Examination and photo documentation was performed using an inverse photomicroscope (LEICA DMIL). For immunofluorescent examination frozen human foreskin specimens were cut into 4 μm sections. The sections were fixed in acetone, dried, and rehydrated in TBS for 10 min. Afterwards sections were stained with primary antibodies, either the polyclonal antibody specific for OATP-B or the isotypic control, and rinsed in TBS for 10 min. Then sections were incubated for 45 min with a secondary fluorochrome conjugated antirabbit antibody, washed with TBS, and mounted with Fluorprep (bioMerieux, Marcy l'Etoile, France). Sections were examined with ultraviolet light and subsequently photo documented using a photomicroscope (DMIL) equipped with epifluorescence illumination. Expression of the subtypes A, B, C, D, and E of the OATP family was assessed by RT-PCR in proliferating keratinocytes derived from the human epidermis of different donors and adult liver tissue. Similar amounts of template mRNA were used for each RT-PCR using different OATP primer pairs (Table I). The results of these RT-PCR studies are displayed in Fig 1. Keratinocytes revealed constitutive expression of OATP-B, OATP-D, and OATP-E, whereas expression of OATP-A and OATP-C was not detected in any of the keratinocyte samples. In contrast, liver tissue showed significant expression of OATP-A and OATP-B as well as OATP-C and a weak expression of OATP-D (Fig 1, Fig 2a,b). Expression of OATP-E in hepatocytes was not detected by RT-PCR (Fig 1). Addition of tumor necrosis factor α (TNF-α) and dexamethasone to keratinocytes revealed no change in expression level of OATP-A-OATP-E (Fig 1).Figure 2Northern blot analysis of OATP mRNA expression in keratinocytes derived from human epidermis of different donors, in HepG2 cells and in human adult liver. Twenty micrograms total RNA were subjected to northern blot analysis for OATP-D (a,b) and OATP-E (c). Equal amounts of RNA are indicated by the 18 S rRNA.View Large Image Figure ViewerDownload (PPT) Northern blot analysis revealed a strong expression of OATP-D in keratinocytes of several independent donors (Fig 2a,b). In contrast to RT-PCR analysis the expression of this transport protein could not be detected in liver or in HepG2 cells using northern blot analysis (Fig 2a,b). Expression of OATP-E mRNA in human keratinocytes could be proved by northern blot analysis (Fig 2c). Using tissue blot hybridization, OATP-D mRNA expression could be detected in human skin but not in human heart, kidney, and small intestine tissues (Fig 3). RT-PCR results were confirmed by immunoblots using specific antibodies directed against OATPs that showed reactivity with OATP-A and OATP-B (Fig 4). A strong expression of OATP-A and OATP-B was detected in human liver tissue, whereas only a weak band could be demonstrated for OATP-B in NHEKs of donors 1 and 2 (Fig 4). In accordance with RT-PCR data no expression of OATP-A was revealed in protein lysate of NHEKs (Fig 4). Specific antibodies against OATP-D and OATP-E were not available for study. The immunhistochemical and immunofluorescent staining revealed that OATP-B is expressed in all layers of the epidermis (Fig 5a,c). No positive staining could be detected in the isotype controls (Fig 5b,d). A novel uptake-transport assay for the detection of OATP-mediated influx transport in NHEKs and fibroblasts was established, using 3H-estradiol-17β-glucuronide as a substrate and taurocholate as an inhibitor (Fig 6a). Experiments were performed in quadruplicate using four different donors. Pretreatment of keratinocytes of donor 1 with taurocholate (1 mM) (Fig 6a) reduced the active uptake of 3H-estradiol-17β-glucuronide in NHEKs by 23%±4.4% (SD) compared to control uptake measured in the absence of the inhibitor. The degree of inhibition was augmented using higher concentrations of the inhibitor such that 5 mmol per l concentration of taurocholate reduced the relative uptake by an average of 49%±3.5% (SD). Similar results were obtained using keratinocytes from three other donors showing an overall uptake reduction rate of 23%±4.5% (SD) for 1 mmol per l concentration and 44%±3.9% (SD) for 5 mmol per l concentration (data not shown). Incubation of human dermal fibroblasts (Fig 6c) with taurocholate at a 5 mmol per l concentration reduced the uptake of estradiol-17β-glucuronide by 34%±11.3% (SD) and by 31%±11.5% (SD) for 1 mmol per l concentration. Using the established uptake-transport assay estrone sulfate was chosen as a substrate and taurocholate as an inhibitor (Fig 6b). Experiments were performed in hexaduplicate using two different donors. Pretreatment of cells of donor 1 with taurocholate (5 mM) (Fig 6b) reduced the active uptake of estrone sulfate in NHEKs by 33%±11.6% (SD) compared to control uptake measured in the absence of the inhibitor. Taurocholate in a 1 mM concentration reduced estrone sulfate uptake by 31%±4.5% (SD). Bioluminescent somatic cell cytotoxicity assay using different concentrations of taurocholate as substrate (Fig 6d) revealed a 1.5% reduction in viable cells determined by ATP content for the 1 mmol per l concentration and a 3% reduction for 5 mmol per l concentration. Skin is a major interface between the body and the environment. Several studies have demonstrated that the skin is not only just a physical barrier to the environment but that it has the capability of reacting biochemically with most xenobiotica by xenobiotica metabolizing enzymes (Jugert et al., 1994Jugert F. Agarwal R. Kuhn A. Bickers D.R. Merk H.F. Mukhtar H. Multiple cytochrome P450 enzymes in murine skin. Induction of P4501A, 2B, 2E, and 3A by dexamethasone.J Invest Dermatol. 1994; 102: 970-975Abstract Full Text PDF PubMed Google Scholar;Baron et al., 2001Baron J.M. Höller D. Schiffer R. Frankenberg S. Neis M. Merk H.F. Jugert F. Expression of multiple cytochrome P450 enzymes and MDR-associated transport proteins in human skin keratinocytes.J Invest Dermatol. 2001; 116: 541-548Crossref PubMed Scopus (200) Google Scholar). In recent years an important role for influx transport proteins of the OATP family has been shown in hepatocytes (Kullak-Ublick et al., 2001Kullak-Ublick G.A. Ismair M.G. Stieger B. et al.Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver.Gastroenterology. 2001; 120: 525-533Abstract Full Text Full Text PDF PubMed Scopus (611) Google Scholar). OATPs represent multispecific transporters that mediate, in addition to conjugated and unconjugated bile salts, the uptake of a vast variety of other amphipathic organic compounds, including bromosulfophthaleine, steroids and steroid conjugates like estradiol 17β-glucuronide and estrone-3-sulfate, thyroid hormones, peptides, leukotriene C4/E4, prostaglandine E2, mycotoxines, and numerous drugs like pravastatine and benzylpenicillin (Kullak-Ublick et al., 2000Kullak-Ublick G.A. Stieger B. Hagenbuch B. Meier P.J. Hepatic transport of bile salts.Semin Liver Dis. 2000; 20: 273-292Crossref PubMed Scopus (223) Google Scholar;Meier and Stieger, 2002Meier P.J. Stieger B. Bile salt transporters.Annu Rev Physiol. 2002; 64: 635-661Crossref PubMed Scopus (439) Google Scholar). Although several of these endogenous and exogenous compounds are relevant to dermatology, nothing was known about the expression profile and functional activities of these influx transport proteins in human skin tissue and especially in normal human keratinocytes. The molecular and functional characterization of transport proteins is emerging rapidly, however, and a significant number of drugs have been shown to be substrates or inhibitors (Kim, 2000Kim R.B. Transporter in drug disposition.Curr Opinion Drug Discovery Devel. 2000; 3: 94-101PubMed Google Scholar). In the liver, transport proteins are present on the sinusoidal membrane, and may be crucial for the hepatic clearance of several drugs (Kamisako et al., 1999Kamisako T. Gabazza E.C. Ishihara T. Adachi Y. Molecular aspects of organic compound transport across the plasma membrane of hepatocytes.J Gastroenterol Hepatol. 1999; 14: 405-412Crossref PubMed Scopus (22) Google Scholar). In particular the OATP family of sinusoidal transporters is known to be important in this process. These OATP transporters were detected at significant levels in various other tissues and cell lines although the expression pattern in skin tissue has not been analyzed so far (Tamai et al., 2000Tamai I. Nezu J. Uchino H. Sai Y. Oku A. Shimane M. Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family.Biochem Biophys Res Commun. 2000; 273: 251-260Crossref PubMed Scopus (517) Google Scholar). OATP proteins are expressed ubiquitously in fetal tissue, whereas expression in adult tissue is variable. In our study we revealed a constitutive expression of OATP-B, OATP-D, and OATP-E in NHEKs using RT-PCR (Fig 1) and northern blot analysis (Fig 2a–c), as well as in skin tissue shown by tissue blot hybridization (Fig 3). Expression of OATP-B was detected in the epidermis of skin specimens by immunofluorescence and immunohistochemistry (Fig 5a,c); expression of OATP-D and OATP-E could not be analyzed in human skin as specific antibodies against these proteins are not available. Expression of OATP-A and OATP-C was not detected in any of the samples (Fig 1, Fig 4). In contrast, liver tissue revealed a different expression profile of OATPs showing a significant expression of OATP-A and OATP-B as well as OATP-C and a weak expression of OATP-D (Fig 1, Fig 2, Fig 4). Expression of OATP-E was not detected by RT-PCR (Fig 1). These expression profiles could point to their physiologic roles in vivo. Expression of OATP-C for example is strongly and exclusively expressed in liver, suggesting a crucial role in this tissue. OATP-E is expressed in different tumor tissues and skin cells but not in liver (Fig 1) and normal blood cells (Tamai et al., 2000Tamai I. Nezu J. Uchino H. Sai Y. Oku A. Shimane M. Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family.Biochem Biophys Res Commun. 2000; 273: 251-260Crossref PubMed Scopus (517) Google Scholar). Such an expression profile might be useful for transporter-mediated delivery of anticancer agents to tumors of the skin without accumulation in blood cells, which often causes severe side-effects. In contrast to many efflux transporters, OATP proteins reveal major differences in their substrate specificity (van Montfoort et al., 1999van Montfoort J.E. Hagenbuch B. Fattinger K.E. Muller M. Groothuis G.M. Meijer D.K. Meier P.J. Polyspecific organic anion transporting polypeptides mediate hepatic uptake of amphipathic type II organic cations.J Pharmacol Exp Ther. 1999; 291: 147-152PubMed Google Scholar) and comparison of 16 transport substrates revealed that OATP-B has the smallest substrate spectrum (Meier et al., 1997Meier P.J. Eckhardt U. Schroeder A. Hagenbuch B. Stieger B. Substrate specificity of sinusoidal bile acid and organic anion uptake systems in rat and human liver.Hepatology. 1997; 26: 1667-1677Crossref PubMed Scopus (307) Google Scholar). Therefore the expression pattern of OATPs in NHEKs has an important influence on the spectrum of substances that enter the cell by active transport. In addition the polymorphic expression of, for example, OATP-B has been shown to affect the physiologic and/or pharmacologic effects of OATP-B substrates (Nozawa et al., 2002Nozawa T. Nakajima M. Tamai I. et al.Genetic polymorphisms of human organic anion transporters OATP-C (SLC21A6) and OATP-B (SLC21A9): Allele frequencies in the Japanese population and functional analysis.J Pharmacol Exp Ther. 2002; 302: 804-813Crossref PubMed Scopus (281) Google Scholar). Studies bySugiyama et al., 2001Sugiyama D. Kusuhara H. Shitara Y. et al.Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier.J Pharmacol Exp Ther. 2001; 298: 316-322PubMed Google Scholar andTamai et al., 2000Tamai I. Nezu J. Uchino H. Sai Y. Oku A. Shimane M. Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family.Biochem Biophys Res Commun. 2000; 273: 251-260Crossref PubMed Scopus (517) Google Scholar have shown that estradiol-17β-glucuronide is a well-characterized substrate for OATP transporters such as OATP-C and OATP-E. High activity of estrone-3-sulfate transport was reported for OATP-B and OATP-C, intermediate activity for OATP-E, and low activity for OATP-D (Tamai et al., 2000Tamai I. Nezu J. Uchino H. Sai Y. Oku A. Shimane M. Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family.Biochem Biophys Res Commun. 2000; 273: 251-260Crossref PubMed Scopus (517) Google Scholar). Estrogens are hormones with wide-ranging biologic effects and skin is an important target organ for estrogens. The major effects of estrogens are as regulators of connective tissue molecules, namely collagen and hyaluronic acid.Gendimenico et al., 2002Gendimenico G.J. Mack V.J. Siock P.A. Mezick J.A. Topical estrogens: their effects on connective tissue synthesis in hairless mouse skin.Arch Dermatol Res. 2002; 294: 231-236Crossref PubMed Scopus (13) Google Scholar showed that application of topical estrogens increased epidermal thickness and biotransformation of estradiol has been detected in the human keratinocyte cell line HaCaT byAltenburger and Kissel, 1998Altenburger R. Kissel T. Biotransformation of estradiol in the human keratinocyte cell line HaCaT: metabolism kinetics and the inhibitory effect of ethanol.Pharm Res. 1998; 15: 1684-1689Crossref PubMed Scopus (9) Google Scholar. In addition serum estradiol and estrone measurements in venous blood samples showed the percutaneous systemic uptake of these substances following transdermal estradiol gel or patch treatment (Jarvinen et al., 2000Jarvinen A. Granander M. Laine T. Viitanen A. Effect of dose on the absorption of estradiol from a transdermal gel.Maturitas. 2000; 35: 51-56Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar). OATP-dependent influx can be inhibited by nonselective inhibitors such as probenecid and selective inhibitors such as taurocholate. Taurocholate has been shown to inhibit OATP-E-mediated uptake transport (Fujiwara et al., 2001Fujiwara K. Adachi H. Nishio T. et al.Identification of thyroid hormone transporters in humans: different molecules are involved in a tissue-specific manner.Endocrinology. 2001; 142: 2005-2012Crossref PubMed Scopus (137) Google Scholar) but is no substrate for OATP-B (Kullak-Ublick et al., 2001Kullak-Ublick G.A. Ismair M.G. Stieger B. et al.Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver.Gastroenterology. 2001; 120: 525-533Abstract Full Text Full Text PDF PubMed Scopus (611) Google Scholar). In our studies taurocholate revealed no major toxic effect on cultured NHEKs (Fig 6d). Using these data we have established a novel influx transport assay in NHEK using estradiol-17β-glucuronide as substrate and taurocholate as inhibitor (Fig 6a). This assay revealed a reduction of the active uptake of estradiol-17β-glucuronide in NHEK by nearly 50% in comparison to control uptake measured in the absence of the inhibitor (Fig 6a), verifying the active role of the expressed OATPs. Absolute transport values for keratinocytes were compared with human dermal fibroblasts in an additional transport experiment (Fig 6c). Fibroblasts seem to have a lower influx transport activity, which correlates with the immunohistologic data (Fig 5a,c). Uptake of estrone sulfate was decreased by 33% (Fig 6b). The incomplete inhibition of estradiol-17β-glucuronide uptake by taurocholate can be explained by an incomplete competitive inhibition of OATP-D and the missing inhibition of OATP-B. This would also explain the decreased inhibitory effect of taurocholate on the uptake of estradiol sulfate, which is a known substrate of OATP-B. These findings indicate that OATP-mediated uptake of xenobiotics and endogenous compounds like estrogens can be inhibited by compounds such as taurocholate, but probably also by topically or systemically administered drugs that are substrates of OATPs like steroid conjugates or antibiotics (Tamai et al., 2001Tamai I. Nozawa T. Koshida M. Nezu J. Sai Y. Tsuji A. Functional characterization of human organic anion transporting polypeptide B (OATP-B) in comparison with liver-specific OATP-C.Pharm Res. 2001; 18: 1262-1269Crossref PubMed Scopus (184) Google Scholar). It is still possible that other transport mechanisms for the active transport of this substrate may be present in keratinocytes, although significant levels of other known influx transporters like the organic cation transporter 1 (OCT1) and the organic anion transporters (OAT1-3) could not be detected in NHEKs by RT-PCR or immunoblot (data not shown). The presented influx assay offers a novel powerful tool for the detection of specific substrates and inhibitors of the active OATP-mediated transport in human skin cells. In particular, the role of OATPs in the active uptake of systemically and topically applied drugs can be further elucidated using this technique. Development of specific inhibitors for the OATP proteins expressed in human skin would provide a unique tool for future experiments as well as for therapeutic use. Recent studies have shown that TNF-α downregulates mRNA expression of oatp1 and oatp2 in rat liver (Geier et al., 2000Geier A. Kim S.K. Stieger B. Meier P.J. Matern S. Gartung C. Inactivation of TNFα prevents down-regulation of basolateral organic anion transporters in rats with CCl4-induced hepatitis.Hepatology. 2000; 32: 436APubMed Google Scholar). In addition, rat oatp2 has been shown to be increased by drug-metabolizing enzyme inducers such as dexamethasone mainly at the protein level (Guo et al., 2002Guo G.L. Chouduhuri S. Klassen C.D. Induction of rat organic anion transporting polypeptide 2 (oatp2) by prototypical drug-metabolizing enzyme inducers that activate gene expression through ligand-activated transcription factor pathways.J Pharm Exp Ther. 2002; 300: 206-212Crossref PubMed Scopus (50) Google Scholar). The molecular mechanism of this post-translational regulation remains so far unknown, however. In this study RT-PCR analysis (Fig 1) of NHEKs revealed no alteration in OATP expression after induction with either TNF-α or dexamethasone. These findings suggest target tissue differences in OATP expression in liver and skin cells. Our prior studies demonstrated that NHEKs possess cytochrome-P450-dependent catalytic activity as well as functional active efflux pumps. In this study we have shown that uptake of large organic cations such as drugs in keratinocytes is also an active transport process mediated by members of the OATP family, which can be modulated by specific competitive inhibitors, in vitro. The ultimate fate of endogenous and exogenous substrates is likely to be the result of multiple processes such as those described here. These studies were supported by a grant from the DFG (BA 1803/4–1, SFB542 C11, and LA 997/3–1) and IZKF BIOMAT (TVB 48). The authors wish to thank Heike Hermanns for critical reading of the manuscript.